ID: 1114474816

View in Genome Browser
Species Human (GRCh38)
Location 14:22986846-22986868
Sequence CAGTTCCACCCAAAGCTCTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114474816_1114474822 6 Left 1114474816 14:22986846-22986868 CCTCAGAGCTTTGGGTGGAACTG 0: 1
1: 0
2: 0
3: 8
4: 186
Right 1114474822 14:22986875-22986897 GGCAGAAACAACTCAGAGACAGG 0: 1
1: 0
2: 1
3: 30
4: 253
1114474816_1114474824 22 Left 1114474816 14:22986846-22986868 CCTCAGAGCTTTGGGTGGAACTG 0: 1
1: 0
2: 0
3: 8
4: 186
Right 1114474824 14:22986891-22986913 AGACAGGGCATATGTCAAGAAGG 0: 1
1: 0
2: 2
3: 12
4: 174
1114474816_1114474823 7 Left 1114474816 14:22986846-22986868 CCTCAGAGCTTTGGGTGGAACTG 0: 1
1: 0
2: 0
3: 8
4: 186
Right 1114474823 14:22986876-22986898 GCAGAAACAACTCAGAGACAGGG 0: 1
1: 0
2: 3
3: 29
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114474816 Original CRISPR CAGTTCCACCCAAAGCTCTG AGG (reversed) Exonic
901493391 1:9607930-9607952 CAGTTCCCCCCAAAGAAATGGGG + Intronic
901672074 1:10861903-10861925 CTGTGCCTCCCACAGCTCTGGGG + Intergenic
902565242 1:17307139-17307161 CAGGTGCAACCACAGCTCTGAGG + Intergenic
902744778 1:18466502-18466524 CAGCTCCAGCAAAGGCTCTGAGG - Intergenic
902754561 1:18540493-18540515 CAGTGCTCCCCCAAGCTCTGTGG - Intergenic
903289387 1:22298252-22298274 CAACTCCACCCGAAGCTCAGAGG + Intergenic
903755539 1:25657992-25658014 CATTTCCAGCCAAGGCCCTGTGG + Intronic
904160957 1:28521674-28521696 CAGATCCACCCACAGATGTGGGG - Intronic
909087159 1:71181667-71181689 CAGTGCCACCCAAATCCCTCAGG + Intergenic
913063445 1:115228435-115228457 CAGTGCCACCCAAAGCTTCATGG - Intergenic
915004245 1:152622197-152622219 CAGTTGCTGCCACAGCTCTGGGG + Intergenic
916059350 1:161088180-161088202 CATCTCCAGCCAAAGCTTTGAGG - Intronic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
917791917 1:178504449-178504471 CAGTTCCAGCAGGAGCTCTGGGG - Intergenic
918938016 1:190949982-190950004 CAGTTCCAGATAAAGCTCCGAGG - Intergenic
920521739 1:206632646-206632668 CAGTTCCACCTATAGCCCTGAGG - Intergenic
921123552 1:212157475-212157497 CAGGTCCTCCCACAGCTCTTTGG + Intergenic
921185286 1:212665173-212665195 CAGTTCTACCCCAGGCCCTGAGG - Intergenic
924591320 1:245407183-245407205 CAGCTACACTCAGAGCTCTGGGG - Intronic
1063164466 10:3447382-3447404 CAGCTCCAGCCAAAGATTTGAGG - Intergenic
1064281695 10:13957137-13957159 CCTTTCCACACATAGCTCTGCGG - Intronic
1067744659 10:48926536-48926558 CAGTTCCTCCAAAAGGTCAGTGG - Intronic
1069655299 10:70083352-70083374 CTCTCCCACCCAAATCTCTGTGG + Intronic
1069760419 10:70806851-70806873 CAGTTCAACCCATAGCACTTAGG + Intergenic
1070647461 10:78211571-78211593 CAGTTTCCCCCAAAGCGCTCAGG - Intergenic
1072743102 10:97922145-97922167 CAGCTCCACCCCACACTCTGGGG + Intronic
1073754347 10:106565141-106565163 CAGTTCCTCCAAATTCTCTGGGG - Intergenic
1074387799 10:113030837-113030859 GAGTCCCACCCAAAGGGCTGTGG - Intronic
1074549319 10:114428036-114428058 CAGGTGCCCCCAAAGCACTGTGG - Intergenic
1076067837 10:127463401-127463423 CAGTTCCCTCCAAAGCCCTCTGG + Intergenic
1076696594 10:132250171-132250193 CAGTGCCACCCTGGGCTCTGCGG - Intronic
1078352302 11:10604247-10604269 CAGTTCCCCCCAACTCTCTGAGG + Intronic
1078466596 11:11554657-11554679 CAGTTCCATTCCAGGCTCTGGGG - Intronic
1079184849 11:18227577-18227599 CAGTTCCACCCCCATATCTGAGG + Intronic
1080056619 11:27913262-27913284 CAGATCAACACAAAGCTTTGAGG + Intergenic
1081746984 11:45480376-45480398 TAGTTCCAACTAAAGCCCTGGGG + Intergenic
1082752200 11:57031349-57031371 CAGTGCCTCCCCAAGCTGTGGGG - Intergenic
1089387889 11:118079855-118079877 CAGTGCCATCCTAGGCTCTGAGG + Intronic
1091279061 11:134371657-134371679 CAGTTCTTCCCTACGCTCTGGGG - Intronic
1094263648 12:28529273-28529295 CTGTTCTAGGCAAAGCTCTGCGG - Intronic
1096217117 12:49803872-49803894 CAGTGCCAGCCAGAGCCCTGGGG - Intronic
1097241943 12:57581593-57581615 GAGTCCCACCCAAAGCTCCCTGG + Intronic
1101544499 12:105698463-105698485 CAGTTCCTTCAAAAGGTCTGTGG + Intergenic
1101799097 12:108005002-108005024 CTGCTATACCCAAAGCTCTGTGG - Intergenic
1107676567 13:42803882-42803904 CAGTGCCACGCAAAACTCAGGGG - Intergenic
1108806722 13:54166454-54166476 CAGCTCAATACAAAGCTCTGAGG - Intergenic
1109620985 13:64904790-64904812 GAGTTCCACCCAAAGCAATCAGG + Intergenic
1113781010 13:112977378-112977400 CACTTCCTCCCTAAGCTCCGTGG - Intronic
1114329132 14:21618272-21618294 CACTTCCTCCAAAAGGTCTGTGG + Intergenic
1114474816 14:22986846-22986868 CAGTTCCACCCAAAGCTCTGAGG - Exonic
1114767967 14:25395951-25395973 AAGGTCCACCCAAAACTCTTAGG - Intergenic
1115546171 14:34466546-34466568 CAGTCCCACCCCCAGCTCTCTGG + Intergenic
1117828411 14:59726988-59727010 GAGTTCCAACCAAAGTCCTGCGG - Exonic
1118715080 14:68553773-68553795 CAGATCCAGCCAAAGGTCAGAGG + Intronic
1121487008 14:94324254-94324276 CAGTTCCCCCCAAAAGTCTATGG + Intergenic
1121785821 14:96660197-96660219 CAATTCCCCCCAAAGCTAAGTGG - Intergenic
1125178328 15:36851788-36851810 CATTTCCACCAAAAGTGCTGGGG - Intergenic
1126638308 15:50800938-50800960 CTGTTTCACCCACAGCTTTGGGG - Intergenic
1127540799 15:59937002-59937024 TAGTTCCTCCCAATGCTCTTGGG + Intergenic
1127968772 15:63943170-63943192 CTCTGCCACCCAAAGTTCTGGGG - Intronic
1130520981 15:84660432-84660454 CAGCTGCAGCCACAGCTCTGAGG + Intergenic
1132394640 15:101463803-101463825 CAGTGCCTACCAAAGCTGTGAGG + Intronic
1132635085 16:940181-940203 CAGTTCCACCCAAGTCTCTATGG - Intronic
1132779875 16:1617292-1617314 AAGTGCCTCCCAAAGCACTGAGG - Intronic
1133633307 16:7642386-7642408 CAGTCCCAGCCATAGCTGTGGGG - Intronic
1133744854 16:8678327-8678349 GAGTTACAACCAAAGCGCTGGGG + Intronic
1136922970 16:34346593-34346615 CAGTTCTGCCCAACCCTCTGGGG - Intergenic
1136981603 16:35065213-35065235 CAGTTCTGCCCAACCCTCTGGGG + Intergenic
1137417939 16:48302462-48302484 CAGGTCCATCCAAAGCTGAGTGG + Intronic
1137435838 16:48453629-48453651 CAGCCACATCCAAAGCTCTGAGG - Intergenic
1142567686 17:851263-851285 CAGCTCCACCCAAAGTTCCCCGG + Intronic
1143768680 17:9154004-9154026 TGGTTCCACTCAAGGCTCTGGGG - Intronic
1145746282 17:27322290-27322312 CAGTTCCACCCAATGCAGTCTGG - Intergenic
1146452366 17:32984910-32984932 CATTTACACCAAAATCTCTGGGG - Intronic
1148157191 17:45431180-45431202 CAGGGCCACCCAAAGCTCTCCGG + Intronic
1150653674 17:67025670-67025692 CACTGTCACCCACAGCTCTGTGG - Intronic
1150660971 17:67078416-67078438 CAGTAGCCCCCAGAGCTCTGCGG - Exonic
1151605483 17:75132667-75132689 CAGTTCCACATAAAGTCCTGAGG - Intergenic
1155989858 18:32269217-32269239 TATTTCCACCCAAAAGTCTGAGG + Intronic
1156101385 18:33599845-33599867 AAATTGCACCCACAGCTCTGTGG - Intronic
1160464306 18:79063338-79063360 CAGTCCCACCCAAAGATGAGGGG - Intergenic
1161506333 19:4645843-4645865 CAGGTCCGTCCACAGCTCTGAGG - Intronic
1164788454 19:30956462-30956484 CAGTCCCAGCCTAAGCTCTCAGG + Intergenic
1165155850 19:33787075-33787097 CAGCTCCCCCCAAAGCCCAGTGG - Intergenic
1167352734 19:48985787-48985809 CAGGAAAACCCAAAGCTCTGGGG - Intronic
928138783 2:28709579-28709601 TAATACCACCCATAGCTCTGTGG - Intergenic
928400790 2:30977340-30977362 CAGGTCCTCCCAAAGTGCTGGGG + Intronic
929822682 2:45286029-45286051 CAGTACAGCCCCAAGCTCTGGGG + Intergenic
931239870 2:60442481-60442503 GAGTTTCTCCCAGAGCTCTGTGG - Intergenic
932438754 2:71718519-71718541 CAGCTCCACCCCTTGCTCTGGGG + Intergenic
933173865 2:79155792-79155814 CAGTTCCAGGCGAGGCTCTGTGG - Intergenic
933878912 2:86648114-86648136 CATTTCCACGGAAAACTCTGTGG - Intronic
934578278 2:95416962-95416984 GACTTTCACCCACAGCTCTGTGG - Intergenic
934601159 2:95659741-95659763 GACTTTCACCCACAGCTCTGTGG + Intergenic
934852859 2:97712566-97712588 CAGTTCCACACAGGTCTCTGAGG + Intergenic
936152598 2:110029952-110029974 CTGTACCACCCAACGCCCTGAGG - Intergenic
936192082 2:110341460-110341482 CTGTACCACCCAACGCCCTGAGG + Intergenic
936534535 2:113301908-113301930 GACTTTCACCCACAGCTCTGTGG + Intergenic
937459943 2:122076980-122077002 CAGCTCCAGCGATAGCTCTGTGG - Intergenic
938125128 2:128665559-128665581 CAGCTGCACCTGAAGCTCTGGGG - Intergenic
940464709 2:154013655-154013677 CAGTTGCACCCACCGCTGTGCGG + Intronic
940857045 2:158737463-158737485 CACTGTAACCCAAAGCTCTGTGG + Intergenic
942185129 2:173417446-173417468 CAGCTCCACACAATGCTATGTGG - Intergenic
946616870 2:221519394-221519416 ACATTCCTCCCAAAGCTCTGTGG + Intronic
947532948 2:230924304-230924326 AAGTGCCGCCCACAGCTCTGTGG - Intronic
948653098 2:239461296-239461318 CAGCTCCTCCCCAAGCTTTGGGG - Intergenic
1169046083 20:2535673-2535695 GAATTCCATCCACAGCTCTGGGG + Intergenic
1169970236 20:11261836-11261858 CAAATCCTCCCAAAGCCCTGGGG - Intergenic
1170391380 20:15878403-15878425 CTATTGCATCCAAAGCTCTGGGG - Intronic
1174409867 20:50328272-50328294 CAGTTCCACTTATAGGTCTGGGG + Intergenic
1176148298 20:63575119-63575141 CAGATCGCCCCAAAGCTCAGGGG - Intergenic
1178175188 21:30088979-30089001 CAGTTGCTTTCAAAGCTCTGAGG + Intergenic
1178595835 21:33951513-33951535 CAGTGCCACCCAGAGACCTGAGG + Intergenic
1180094931 21:45552030-45552052 AAATTCCACCCCATGCTCTGAGG - Intergenic
1180783724 22:18535588-18535610 CACCTCCACCCTAAGGTCTGGGG - Intergenic
1181127294 22:20709639-20709661 CACCTCCACCCTAAGGTCTGGGG - Intronic
1181240626 22:21474940-21474962 CACCTCCACCCTAAGGTCTGGGG - Intergenic
1182137599 22:27919922-27919944 CAGTTACACCGAAAGCGCCGTGG + Intronic
1184734260 22:46388827-46388849 CACTCCCACCCGCAGCTCTGAGG - Intronic
949401609 3:3670406-3670428 CAGTACCACCTACAGCTCTTGGG - Intergenic
950272482 3:11629463-11629485 CAGTTCCAGCCCCAGCTATGTGG - Intronic
952404945 3:32997377-32997399 CAGATGCACCGAAAGCCCTGAGG + Intronic
956203126 3:66728226-66728248 CAGTTGCAACCAGAGCTCTAAGG - Intergenic
958076024 3:88679340-88679362 CTGTTCCAACCAAAACTCTCTGG - Intergenic
958080644 3:88742160-88742182 ATTTTTCACCCAAAGCTCTGTGG + Intergenic
959018034 3:101158175-101158197 CAGTTCCCCCCAACTATCTGGGG - Intergenic
961430983 3:126882973-126882995 CAGCCCCACCCATACCTCTGGGG + Intronic
962012203 3:131402619-131402641 CAGATGCAATCAAAGCTCTGAGG - Intergenic
962083589 3:132166792-132166814 CAGTTGGACCCAAAGGTCTTGGG + Intronic
962256135 3:133871501-133871523 CAAATCCACCCACAGCTTTGGGG + Intronic
962735886 3:138324895-138324917 CATTTCCTCCCAAAGCTCTTGGG + Exonic
962826158 3:139102286-139102308 AGGTTCTACCCAGAGCTCTGAGG - Intronic
965789826 3:172375391-172375413 CTGTTTCACCCAAAGCTCTTAGG + Intronic
968596361 4:1487985-1488007 CAGTCCCACCGAGAGCTCTCAGG + Intergenic
969076839 4:4586191-4586213 GAGCTCCACCCAAAGCTGTTGGG + Intergenic
969707272 4:8818831-8818853 AAGCTCCACCCAAAGCTTTCTGG - Intergenic
973231086 4:47839204-47839226 CAGTTCCACCAACTACTCTGAGG + Intergenic
973252473 4:48075042-48075064 AAGATCCCCCCAAAGCTCAGGGG - Intronic
973956610 4:56069121-56069143 CAGTTCCTCCAAAGGCTCTAAGG - Intergenic
974846981 4:67363334-67363356 CAGTTCTGCCCCTAGCTCTGGGG - Intergenic
978682566 4:111399614-111399636 CAGTGCCACCCATTGCTTTGTGG - Intergenic
979030224 4:115633791-115633813 CAGTTCCTTCAAAAGGTCTGTGG + Intergenic
982108053 4:152028560-152028582 CAGGTGCTCCTAAAGCTCTGTGG - Intergenic
982304346 4:153914276-153914298 AACTTCCAACCAAATCTCTGAGG - Intergenic
984261761 4:177451369-177451391 TAATTGCACCCAGAGCTCTGAGG + Intergenic
984619668 4:181937949-181937971 CTTTTCCATCCAAGGCTCTGTGG + Intergenic
985142296 4:186853983-186854005 GATTTACACCCAAAGCTTTGTGG - Intergenic
985937374 5:3107261-3107283 CAGTTCCACCCAGAGCCAGGGGG + Intergenic
992006329 5:72481847-72481869 TAGTTCCCCCCAAACCCCTGAGG + Intronic
992324858 5:75650755-75650777 CAATCCAACCCAAAGCTCAGTGG + Intronic
998838184 5:146224809-146224831 CTCTGCCTCCCAAAGCTCTGGGG + Intronic
999152819 5:149437730-149437752 CATTTCCTCCCAAGGCTGTGGGG + Intergenic
999595932 5:153204696-153204718 CGCTTCCACTCAAATCTCTGTGG - Intergenic
1003665687 6:8109317-8109339 CAGCTCCAACCACAGCCCTGGGG + Intergenic
1004389724 6:15199805-15199827 CATTTCTTCCCAAAGCTATGTGG + Intergenic
1008048948 6:46880609-46880631 CTGTCCCACCCATAGCTGTGTGG + Intronic
1014138681 6:117916821-117916843 CAGCTTCACCTCAAGCTCTGAGG + Intronic
1018417969 6:163617729-163617751 CACTTCCTCCAAAGGCTCTGGGG - Intergenic
1020245364 7:6425076-6425098 CAGTTCAATCCGAATCTCTGGGG - Intronic
1021148659 7:17121312-17121334 CATTTCCACTCACAGCTCAGTGG - Intergenic
1021899965 7:25275422-25275444 CAGATTCACCAAAATCTCTGAGG - Intergenic
1024215770 7:47246777-47246799 CAATTGCACTCAAATCTCTGTGG - Intergenic
1024987644 7:55209149-55209171 CAATTCAACCCAAATCTCGGGGG + Exonic
1025082452 7:55995536-55995558 CAGCACCACACAAGGCTCTGGGG - Intronic
1026174876 7:67987851-67987873 CACTTGCACCCAAAACTTTGAGG + Intergenic
1027200917 7:76063400-76063422 CTGTTCCACCCTGAGTTCTGGGG + Intronic
1028071080 7:86451583-86451605 CTGCTCAACCCAAACCTCTGGGG + Intergenic
1028197692 7:87926563-87926585 CAGTTCCTTCAAAAGGTCTGTGG - Intergenic
1028822514 7:95229262-95229284 CAGTTCCTTCAAAAGGTCTGTGG - Intronic
1029328592 7:99831956-99831978 CAGCTACACCCAAATCTCTGTGG - Intronic
1029845821 7:103411287-103411309 CAGTTACTCCCAGAGCTCTGGGG + Intronic
1033796369 7:144849950-144849972 GTGTTCCTCCCAAAGCTGTGCGG - Intergenic
1034894648 7:154868662-154868684 CAGGTCCAGCTAATGCTCTGGGG - Intronic
1035367300 7:158357555-158357577 CAGGCCCACCCAAATCACTGAGG + Intronic
1038584941 8:28779834-28779856 CAGTTACACCAGAAGCACTGGGG - Intronic
1040576548 8:48656687-48656709 CAGTTCCACCCCAGCCACTGTGG - Intergenic
1044805670 8:96005871-96005893 CAGCTCCTCCCAGGGCTCTGTGG + Intergenic
1046993006 8:120482092-120482114 TAATTCAACCCAAATCTCTGGGG + Intronic
1047151534 8:122269112-122269134 TAATTCCAGCCAATGCTCTGAGG - Intergenic
1049239965 8:141532494-141532516 CAGTAGCTCCCAAAGCTCAGAGG + Intergenic
1053361127 9:37487256-37487278 CACTTTTACACAAAGCTCTGAGG + Intronic
1058089689 9:100790859-100790881 CTGCTCCACTTAAAGCTCTGAGG + Intergenic
1060821234 9:126662631-126662653 CACTTCCACCCATACCTCTCTGG - Intronic
1186801056 X:13092720-13092742 ACATTCCACCCACAGCTCTGAGG + Intergenic
1187930812 X:24292087-24292109 GAGGTCCACCCAAAGCCCAGGGG - Intergenic
1189630816 X:42951477-42951499 GAGCTCCACCCTAAGCTCAGTGG - Intergenic
1190253420 X:48744768-48744790 GAGATCCTCCCAAAGCACTGGGG + Intergenic
1191586036 X:62827689-62827711 CAGTTGCACCCATTGCCCTGAGG - Intergenic
1191961761 X:66711166-66711188 AAGTTCCACTCCAAACTCTGGGG + Intergenic
1193885540 X:86981478-86981500 CAGTTCCAGCCATGGCTCAGAGG - Intergenic
1193900276 X:87167860-87167882 CAGCTCCAGCCACAGCTCAGAGG - Intergenic
1195305158 X:103574588-103574610 CAGGTCCACCCAAAGCCATATGG - Intergenic
1195673403 X:107487687-107487709 CAGTTACACCAGAATCTCTGTGG + Intergenic
1199121537 X:144060621-144060643 CAGTTCCTTCAAAAGGTCTGTGG - Intergenic
1201746344 Y:17378363-17378385 CAGATCGACCCAACTCTCTGTGG - Intergenic