ID: 1114476446

View in Genome Browser
Species Human (GRCh38)
Location 14:22998537-22998559
Sequence GATTGAGGAGCTGCGGCAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 286}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114476446_1114476454 23 Left 1114476446 14:22998537-22998559 CCAGCTGCCGCAGCTCCTCAATC 0: 1
1: 0
2: 4
3: 20
4: 286
Right 1114476454 14:22998583-22998605 GCTGTCACACTCCTCTTCCACGG 0: 1
1: 0
2: 0
3: 12
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114476446 Original CRISPR GATTGAGGAGCTGCGGCAGC TGG (reversed) Exonic
900410134 1:2508830-2508852 GAGTGAGGCGCTGCAGCTGCCGG - Exonic
901463838 1:9407862-9407884 GCTTGAGAAGCTGAGGCAGGAGG + Intergenic
902181710 1:14694245-14694267 GATGGGTGAGCTGAGGCAGCTGG - Intronic
902507746 1:16948829-16948851 GTTTGAGGTGCAACGGCAGCTGG + Exonic
902819181 1:18933175-18933197 GATTGAGGATCTGAGGCTGGAGG - Intronic
902856492 1:19210092-19210114 GATGAAGGAGTTGCCGCAGCTGG - Exonic
902857940 1:19222705-19222727 GCTGGAGGACCTGGGGCAGCTGG + Exonic
903405726 1:23094048-23094070 GATTGAAGTGCTGCGCCAGCGGG - Exonic
904037367 1:27566044-27566066 GATTGGGGAGCTGGTGCAGGGGG - Intronic
904351240 1:29908150-29908172 GATTGAGGACCTAAGGCAGGAGG + Intergenic
904399262 1:30244991-30245013 GACTGAGGAGCTGGGCCAGAGGG + Intergenic
906286063 1:44588671-44588693 GATTGAGAAGGTGAGCCAGCTGG + Intronic
909629812 1:77759688-77759710 GCTTGCGGAGGTGCGGCTGCAGG - Exonic
913292765 1:117290122-117290144 GCTGGAGAAGCTGTGGCAGCTGG - Intergenic
914719967 1:150281823-150281845 GATGGAGGAGCCGCCCCAGCGGG + Intergenic
916671271 1:167023174-167023196 GTTTGGGAAGCTGAGGCAGCAGG + Intergenic
917336290 1:173927343-173927365 CTTTGAGAAGCTGAGGCAGCTGG - Intergenic
917760213 1:178148555-178148577 GCTTGAGGAGCTGAGGCAGGAGG - Intronic
919925290 1:202188890-202188912 CATGGAGCAGCTGCTGCAGCAGG + Intergenic
920033263 1:203049693-203049715 GATTGAGAAGCTGCGCCAAGAGG + Intronic
922200174 1:223394291-223394313 GATACGGGAGCTGCAGCAGCAGG + Exonic
923637156 1:235710364-235710386 GCTTCAGGAGCGGCAGCAGCAGG + Intronic
924057064 1:240134378-240134400 GATTGGGAAGCTGAGGCAGGAGG + Intronic
924334970 1:242978458-242978480 GTTTGAGGGGCTGAGGCAGGTGG - Intergenic
1063612729 10:7576618-7576640 GAAGGAGCGGCTGCGGCAGCGGG - Exonic
1064120139 10:12611369-12611391 GGTAGAGGAGCTGCAGGAGCGGG - Intronic
1067980106 10:51074632-51074654 GATCGAGGAGCTGAGGCAGCGGG + Exonic
1068661407 10:59627054-59627076 GATTGAGCAGCCGAGGCAGTGGG - Intergenic
1068818640 10:61347156-61347178 GATCGAGGAGCAGCTGCAGATGG + Intergenic
1069255045 10:66322469-66322491 GTTGGAGGAGGTGAGGCAGCTGG + Intronic
1069831472 10:71284742-71284764 GATCGAGGTGTCGCGGCAGCAGG + Exonic
1069903309 10:71718284-71718306 GAGTGAGGTCCTGCGGCTGCTGG - Intronic
1070150366 10:73801465-73801487 GACCAAGGAGCTGTGGCAGCGGG + Exonic
1071023394 10:81083911-81083933 GTTGGTGGAGCTGTGGCAGCTGG + Intergenic
1071982427 10:91016973-91016995 GGTTGGGAAGCTGCGGCAGGTGG - Intergenic
1072982967 10:100115184-100115206 GATTCAGGCCCTGCCGCAGCAGG - Intergenic
1077187299 11:1241047-1241069 GCTGGAGGAGCTGGGCCAGCAGG + Exonic
1077545037 11:3165451-3165473 GGATGAGGAGAAGCGGCAGCCGG - Intronic
1079309549 11:19352538-19352560 AAGTGAGGCTCTGCGGCAGCTGG + Intronic
1081254304 11:40873276-40873298 TATTGAGGCACTGCAGCAGCAGG - Intronic
1081811689 11:45917790-45917812 GATGGAGAAGCTGCGGCTCCTGG - Exonic
1082835826 11:57649537-57649559 GAGAGAGGAGCGGAGGCAGCGGG + Exonic
1083897227 11:65625963-65625985 GTTTGCGGAGTTGTGGCAGCAGG - Exonic
1085447759 11:76612074-76612096 ACTTGAGGAGCTGAGGCAGGAGG - Intergenic
1086116768 11:83259771-83259793 GCTTGGGAGGCTGCGGCAGCAGG - Exonic
1086906469 11:92423724-92423746 GATTGTGGAGCTGGAGAAGCAGG + Intronic
1089234502 11:117011734-117011756 GCTTGGGGAGCTGAGGCAGAAGG + Intronic
1089570719 11:119407151-119407173 GGGTGAGGGGCTGCGGCAGATGG + Intergenic
1090090214 11:123690073-123690095 GCTTGAAAAGCTGGGGCAGCAGG - Intergenic
1092387181 12:8044775-8044797 GATGGTGGAGCAGTGGCAGCAGG + Exonic
1095254924 12:40023346-40023368 GCTTGAGGGGCTCCTGCAGCGGG + Intronic
1096216269 12:49799142-49799164 GCTGGAGGCGCTGCTGCAGCTGG - Intronic
1097102700 12:56600707-56600729 GGTAGAGGAGCTGGAGCAGCGGG - Exonic
1098305536 12:69099017-69099039 GCTTGGGAAGCTGAGGCAGCAGG - Intergenic
1099388381 12:82047610-82047632 GCTTGAAGAGCTGTGGCATCTGG - Intergenic
1102058014 12:109911176-109911198 CATTGAGGAGCAGCTGCAGCTGG + Exonic
1102444292 12:112989870-112989892 GAGTGAGGAGGTGGGGGAGCTGG - Intronic
1102837562 12:116079645-116079667 ACTTGAGGAGCTGAGGCAGGAGG - Intronic
1103205024 12:119122153-119122175 GTTTGAGGAGTTGGGGCATCTGG + Intronic
1104811299 12:131621883-131621905 AGTGCAGGAGCTGCGGCAGCAGG - Intergenic
1104892009 12:132144657-132144679 GAATGGGGGGCTGCGGCGGCAGG + Intronic
1105946993 13:25198532-25198554 GAGTGAGGGGCTGAGGGAGCTGG + Intergenic
1106526003 13:30541968-30541990 AATTGAGCACCTGCGGAAGCTGG - Intronic
1108701495 13:52947991-52948013 GGTTGAGAGGCTGCAGCAGCGGG + Intergenic
1113802992 13:113096129-113096151 GCGTGAGGGGCTGGGGCAGCTGG + Intronic
1114476446 14:22998537-22998559 GATTGAGGAGCTGCGGCAGCTGG - Exonic
1115304691 14:31922196-31922218 AAGGGAGGAGCTGGGGCAGCCGG - Intergenic
1116245476 14:42406320-42406342 GATTGATGAGCTCTGGCAGTTGG + Intergenic
1116864189 14:50018074-50018096 CATTGAGGAGCTGAGGGCGCTGG + Intergenic
1117164851 14:53023012-53023034 GCTTTAGGAGCTGAGGCAGCTGG + Intergenic
1118894082 14:69931340-69931362 GAAGGAGGAGTTGGGGCAGCTGG - Intronic
1119496878 14:75087267-75087289 GATTGAGGAGCTATGACACCTGG - Intronic
1120700999 14:87698667-87698689 CATTGAGGAGGCGCAGCAGCTGG - Intergenic
1122449844 14:101796840-101796862 ACTTGAGGAGCAGAGGCAGCAGG - Intronic
1125800904 15:42445938-42445960 GAGTGTGGAGGTGGGGCAGCGGG + Intronic
1125999385 15:44195022-44195044 GGTTGATGAGCGGCAGCAGCAGG - Exonic
1127884646 15:63189021-63189043 GACTGAGGGGCTGCGGGAGGGGG + Intergenic
1128061819 15:64740300-64740322 GAATGAGGAGCAGCGGCGGGCGG + Exonic
1129458625 15:75688919-75688941 GTTTGGGGAGCTGCAGAAGCAGG - Exonic
1130283421 15:82536645-82536667 GATTCAGGTGCTGCTGCATCTGG - Intergenic
1132516305 16:367722-367744 GATCCAGCAGCTGCAGCAGCAGG - Exonic
1132600462 16:770594-770616 GGTGGAGGAGCTGCGGCACCTGG - Exonic
1133108993 16:3534372-3534394 CATCGAGGAGCAGAGGCAGCTGG + Intronic
1133210665 16:4261817-4261839 GATTGAGCTGCGGCAGCAGCTGG - Exonic
1136506446 16:30707203-30707225 GATTGCTGAGCTGCGGAAGGAGG + Exonic
1137280452 16:46972942-46972964 GAGGGAGGAGCTCCCGCAGCCGG + Intronic
1138485985 16:57343953-57343975 GAGTGAGGGGCTGAGGCAGGTGG + Intergenic
1139267821 16:65656487-65656509 GACTGGGGAGCTTAGGCAGCAGG - Intergenic
1139473934 16:67193072-67193094 GATCGAGGAGCTGCAGCAGCGGG + Exonic
1139481020 16:67230752-67230774 GACTGAGAACCTGGGGCAGCTGG - Exonic
1139905486 16:70362766-70362788 GTTTGAGAAGCTGAGGCAGGTGG + Intronic
1140810289 16:78570608-78570630 GGTTGAGTAACTGCAGCAGCTGG - Intronic
1141615748 16:85208477-85208499 GAGTCAGGAGCTGAGGCAGCAGG - Intergenic
1143130690 17:4675131-4675153 AATTGAGGACCTGGGGAAGCAGG + Exonic
1143595057 17:7909163-7909185 GATTGAGGAGCAGCTGCGGCGGG + Exonic
1144448559 17:15354979-15355001 GATTGGGGAGCTGCTACAGCAGG - Intergenic
1144675480 17:17158861-17158883 GATTGAGCAGCGGTGGCATCAGG + Exonic
1147478484 17:40736691-40736713 ACTTGAGGGGCTGCGGCAGGAGG - Intergenic
1147501293 17:40966388-40966410 CATTGAGGAGCTCCAGCAGAAGG - Exonic
1147540117 17:41350419-41350441 CATTGAGGAGCTCCAGCAGAAGG - Exonic
1147542133 17:41369402-41369424 CATTGAGGAGCTCCAGCAGAAGG - Exonic
1147543669 17:41381898-41381920 CATTGAGGAGCTCCAGCAGAAGG - Exonic
1147545347 17:41397191-41397213 CATTGAGGAGCTCCAGCAGAAGG - Exonic
1147554330 17:41466857-41466879 CATTGAGGAGCTCCAGCAGAAGG - Exonic
1147555821 17:41478465-41478487 GAGTGAGGAGCTGAACCAGCAGG - Exonic
1147557281 17:41487455-41487477 GACTGAGGAGCTGAACCAGCAGG - Exonic
1147740143 17:42666626-42666648 GTTTGACAAGCTGCGGAAGCGGG + Exonic
1147948434 17:44093398-44093420 GCTGGAGCAGCAGCGGCAGCGGG - Exonic
1148663836 17:49360650-49360672 GATTGAGGAGCTGCTGTTGCTGG - Intronic
1148734744 17:49858999-49859021 GGGTGGGGAGCTGGGGCAGCAGG + Intergenic
1148791400 17:50175293-50175315 CACAGAGGAGCTGCGGCAGATGG + Exonic
1149536965 17:57440745-57440767 GACTGAGGAGGTGGGGAAGCAGG + Intronic
1149976592 17:61271916-61271938 ACTTGAGAAGCTGCGGCAGAAGG - Intronic
1150398189 17:64837089-64837111 GGCTGAGGGGCTGCCGCAGCCGG - Intergenic
1151297025 17:73193201-73193223 GAAGGAGGAGCTGCGGCAGATGG + Exonic
1151783810 17:76265517-76265539 CATGGACGAGCTGCGGCACCAGG + Exonic
1151963755 17:77420642-77420664 GACAGAGGAGCAGGGGCAGCAGG - Intronic
1152756472 17:82089122-82089144 GATAGAGGTGCTGAGCCAGCGGG + Exonic
1152769366 17:82157852-82157874 GGTTTTGGAGCTGCGGAAGCAGG - Exonic
1152991947 18:371648-371670 GAAAGGGGAGCTGCGGCAACAGG + Intronic
1153382297 18:4454203-4454225 CATTGAGGGGCGGCTGCAGCTGG - Intronic
1155553492 18:26992200-26992222 GAGTGAGGGGCTGAGGCATCTGG - Intronic
1156994218 18:43447185-43447207 TTTTGTGGAGCTACGGCAGCTGG - Intergenic
1157587960 18:48817235-48817257 GCGCGAGGAGCTGCAGCAGCAGG + Exonic
1160033161 18:75279554-75279576 AATTGAGGAGCTGGAGCAGGAGG + Intronic
1160805429 19:990404-990426 GGCTGAGGACCTGCGGCTGCTGG - Intronic
1161164246 19:2777441-2777463 GCTTGAGGGGCTGAGGCAGGAGG + Intronic
1161484344 19:4526747-4526769 GCTTGAGAAGCTGAGGCAGGAGG + Intronic
1161744539 19:6047648-6047670 AAGTGAGGAGCTGCGGAAACAGG + Intronic
1162016682 19:7850047-7850069 GTTTGAAGAGCTCCCGCAGCCGG - Exonic
1162995722 19:14333763-14333785 GATGGAGGAGGAGCGGCATCCGG - Intergenic
1164537559 19:29097558-29097580 GAGTGGGGAGCTGCTGCAGCTGG - Intergenic
1165319018 19:35074609-35074631 CTCTGAGGAGCTGCGGCTGCTGG + Intergenic
1167430495 19:49451484-49451506 ATTTGAGGAGCTGCTGCTGCAGG - Exonic
1167571599 19:50292365-50292387 GGCTGAGGTGCTGCGGCTGCAGG + Exonic
1168631120 19:57956926-57956948 GTTCCAGGAGCTGGGGCAGCAGG - Intergenic
1168643367 19:58044601-58044623 TAATGAGGAGCTGCCGCGGCTGG + Intronic
1168647274 19:58067821-58067843 GAGTGAGGAGCTGTGGCTGAAGG - Exonic
925101512 2:1250337-1250359 GAGGGAGGAGCTGCAGCATCTGG - Intronic
925601053 2:5609077-5609099 GATTGAGGAGGTGCTGCACTGGG - Intergenic
925899066 2:8495572-8495594 GGTCGAGGAGCAGCTGCAGCTGG - Intergenic
926010222 2:9400997-9401019 CATTGTGGAGCTGCGGCAGGAGG - Intronic
926930138 2:18029472-18029494 GCTTGGGAAGCTGAGGCAGCAGG - Intronic
927787151 2:25982013-25982035 GATTGAAGAGCTGCGCCTGGGGG - Exonic
930684175 2:54290171-54290193 GATCGCGGGGCGGCGGCAGCCGG - Intronic
931058741 2:58502566-58502588 GAGTAAAGAGCTGCGGAAGCTGG - Intergenic
931116936 2:59175084-59175106 TCTGGAGGAGCAGCGGCAGCGGG - Intergenic
931344457 2:61433388-61433410 CTTTGAGGAGCTGAGGCAGGCGG + Intronic
932698019 2:73973207-73973229 GTTGGAGGAGCTGCTGCAGGAGG - Intergenic
932771601 2:74503554-74503576 GACCGAGCAGCTGCGGGAGCTGG - Intergenic
935660390 2:105461627-105461649 TATTCAGGAGCTGAGGCAGGAGG + Intergenic
935677017 2:105603545-105603567 AATTGAGGGGCTGGGGCAGGAGG - Intergenic
936439763 2:112541830-112541852 GATGGAGGGGATGGGGCAGCGGG - Intergenic
937096699 2:119240405-119240427 GATTGAGGTGCTGGGGCCACTGG - Intronic
937276219 2:120685773-120685795 GCTTGAGAAGCTGAGGCTGCAGG - Intergenic
937321844 2:120965668-120965690 GATGCAGGTGCTGCGGCAGAGGG + Intronic
940767471 2:157805930-157805952 ACTTGAGGGGCTGAGGCAGCAGG - Intronic
942118197 2:172749477-172749499 GATAGAGCAGCTGGGACAGCTGG + Intronic
942231850 2:173867567-173867589 GATGGAGGAGATGCAGCAGTGGG - Intergenic
942446346 2:176081066-176081088 GCCTGAGGAGCAGCAGCAGCCGG - Intronic
943644875 2:190399527-190399549 GATTGAGGAGCTGTCACAGATGG + Intergenic
943755847 2:191556199-191556221 GCTTGAGGGGCTGAGGCAGGAGG - Intergenic
946086420 2:217177697-217177719 GATTGAGGAGCACCAGCATCTGG - Intergenic
946331678 2:219013132-219013154 CATTGAGGGGCTGGGCCAGCAGG - Intronic
946406698 2:219495783-219495805 GATTGAAAAGCTGCCCCAGCAGG + Intronic
947745610 2:232505947-232505969 GACTGGGAGGCTGCGGCAGCAGG + Intergenic
948155002 2:235774327-235774349 GATAGAGGTGCTGCTGCAGAGGG + Intronic
1168896786 20:1329116-1329138 GATTCAGCAGCGGCAGCAGCTGG - Intronic
1171034876 20:21706517-21706539 CATTGTGGAGCTGGCGCAGCTGG + Exonic
1172167906 20:32910059-32910081 GATGGTGGTGCTGGGGCAGCGGG + Intronic
1172272966 20:33664689-33664711 GAGTGAGGAGAAGCAGCAGCAGG - Intronic
1173803933 20:45911921-45911943 GATTTAGGACCTGAGGGAGCCGG - Exonic
1174750132 20:53103836-53103858 ACTTGAGGAGCTGCCGCAGGTGG + Intronic
1176108383 20:63400002-63400024 GAGTGAGGAGCAGGGGCGGCTGG - Intergenic
1176844984 21:13869789-13869811 GGTGCAGGAGCTGGGGCAGCCGG + Intergenic
1177898182 21:26880136-26880158 GATTGAAGAGCTGGGTTAGCAGG - Intergenic
1178484965 21:33013312-33013334 GATGGAGGTGATGCAGCAGCAGG - Intergenic
1179506886 21:41847090-41847112 CATTGAGGAGCTGCAGCTCCAGG + Exonic
1180010636 21:45048201-45048223 GACTGAGGAGCGGCGGAGGCTGG + Intergenic
1180953306 22:19730399-19730421 GATTGAGGAGTAGCCACAGCGGG - Intergenic
1181005956 22:20013629-20013651 GATTGAGGGGCTGCCGCCTCTGG - Intronic
1181406550 22:22689043-22689065 GATTGAGGAGCTGCTGGAAATGG + Intergenic
1181895318 22:26102093-26102115 GTTTGGGGAGCTGAGGCAGGTGG + Intergenic
1183062433 22:35344449-35344471 CACAGAGGAGCTGCGGAAGCTGG - Intronic
1183170308 22:36182992-36183014 GAGTGAGGCGCTGCAGCAGAAGG + Intergenic
1183301408 22:37060837-37060859 GCTGGAGGAGCAGCAGCAGCAGG + Exonic
1183683780 22:39350257-39350279 GAAGGAGGAGCGGCGGCAGCGGG - Intronic
1184100488 22:42339515-42339537 AAGTGAGGAGTTGGGGCAGCTGG + Intronic
1184160090 22:42692746-42692768 TGTTGAGGAGCTGTGGGAGCAGG - Exonic
1184520451 22:44990978-44991000 TGTGGAGGAGCCGCGGCAGCAGG - Intronic
1185171840 22:49298882-49298904 GGTGGAGAAGCTGCTGCAGCGGG - Intergenic
949635621 3:5978605-5978627 TATTGAGGAGGTGGGGCAGGGGG + Intergenic
950693917 3:14683142-14683164 GTCTGAGGAGCTCCGTCAGCAGG - Exonic
950841753 3:15974697-15974719 GCTACAGGAGCTGCTGCAGCTGG + Intergenic
952790848 3:37199574-37199596 GATTGAGGACATGTGGCAACTGG - Intergenic
952967599 3:38630836-38630858 GATAGGGAAGCTGCGTCAGCAGG + Intronic
953328600 3:42033477-42033499 TATTGAGGGGCTGAGGCAGGAGG + Intronic
954222418 3:49162879-49162901 GGATGATGAGGTGCGGCAGCGGG - Exonic
954291607 3:49652871-49652893 GACGGAGGAGCTGAGGCAGGCGG + Exonic
954326718 3:49868075-49868097 GACTGGGGGGCTGCAGCAGCTGG - Intronic
956142406 3:66159137-66159159 GCTTTAGGAGCTGGGTCAGCAGG + Intronic
956778938 3:72589303-72589325 GATTGAGTAGTTGAGGCAACAGG - Intergenic
958104942 3:89059596-89059618 GAGTAAGGAGCTGAGGCACCAGG - Intergenic
958423874 3:93959203-93959225 TATTCAGGAGCTGAGGCAGGAGG + Intronic
960096756 3:113696674-113696696 GCTTGCTGAGCTGCGGCCGCGGG - Intergenic
963133171 3:141876763-141876785 GCGAGAGGAGCTGCGGCCGCGGG - Exonic
963308428 3:143679988-143680010 GATTGAGGAACTCCTCCAGCAGG + Intronic
964829660 3:160869975-160869997 GATTGAGTAACAGTGGCAGCTGG - Intronic
964964124 3:162469250-162469272 GATTTAGGAGTTGCTGTAGCAGG - Intergenic
967188861 3:186968019-186968041 GAATGAGGGGCTGGGGCTGCAGG - Intronic
967937010 3:194737103-194737125 GAAGGAGAAGCTGCGGCAGAAGG - Intergenic
968671762 4:1855915-1855937 TACTGAGGAGCTGCCGCGGCCGG - Exonic
968869945 4:3236680-3236702 GGGTGAGGAGCAGCGGCAGGAGG + Intronic
969535923 4:7756116-7756138 GAAGGAGGAGCTGGGGGAGCAGG - Intergenic
970537936 4:17048758-17048780 GATTGGGAAGCTGAGGCAGGAGG + Intergenic
973044514 4:45519387-45519409 GAGAGTGGAGCTGCAGCAGCTGG - Intergenic
973589806 4:52429599-52429621 GATTGAGGTGCTGCTGCTGGTGG - Intergenic
973982008 4:56315056-56315078 GGTGGAGGAGCTGCGGTGGCAGG + Exonic
974585618 4:63872650-63872672 ATTTGAGAAGCTGGGGCAGCAGG - Intergenic
975668556 4:76757029-76757051 GGTTCAGGAGCTGTGGCAGTAGG - Intronic
976634433 4:87273565-87273587 GATTGAGAGGCTGAGGCAGGTGG - Intergenic
977308299 4:95352631-95352653 GATTGGGGAGCTGTGTCAACAGG - Intronic
979242145 4:118456821-118456843 GTTTGAGGGGCTGAGGCAGGTGG + Intergenic
980122278 4:128740303-128740325 ACTTGGGGAGCTGAGGCAGCAGG + Intergenic
982462268 4:155685536-155685558 GGTGGAGGAGCTGCGGAAGCTGG - Intronic
982740879 4:159055599-159055621 AATTGAGGAGCTGAGGCTGGAGG + Intergenic
983511239 4:168611420-168611442 GCTTTAGGAGCTCTGGCAGCTGG - Intronic
984536237 4:180979388-180979410 GCTTGAGGGGCTGAGGCAGGAGG - Intergenic
984757042 4:183334023-183334045 GACTGAGGAGCTGTGGCAGGAGG - Intergenic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
985150171 4:186938751-186938773 GCTTGAGGGGCTGAGGCAGGAGG + Intergenic
987125319 5:14806680-14806702 AATAGAAGAGCTGCCGCAGCCGG - Intronic
997647354 5:135490179-135490201 GATTGAGGTGCAGCCGAAGCTGG + Intergenic
997713902 5:136028499-136028521 GATTGAGGAGCTGGGGAGGGTGG + Intergenic
998055154 5:139069015-139069037 CTTTGAGAAGCTGAGGCAGCAGG + Intronic
998101706 5:139440011-139440033 GCCTGAGGAGCTGGGGCAGTAGG - Intronic
998493450 5:142566622-142566644 GATTCAGCAGCAGCAGCAGCAGG - Intergenic
998939056 5:147260943-147260965 GAAGGAGAAGCCGCGGCAGCCGG - Intronic
1001960722 5:175878987-175879009 GCAGGAGGCGCTGCGGCAGCAGG + Exonic
1002196467 5:177504190-177504212 GGTTGTGGGGCTGCGGCTGCCGG + Exonic
1002416105 5:179121761-179121783 GAGAGAGGGGCTGCGGCCGCAGG + Intronic
1003120804 6:3317855-3317877 GAAGGAAGAGCTGCGGCAGCTGG - Intronic
1004088488 6:12474806-12474828 GCTTGAGAAGCTGAGGCAGGAGG + Intergenic
1004165340 6:13251809-13251831 GATTGAGAGGCTGAGGCAGGAGG + Intronic
1004319371 6:14620809-14620831 GCTGGAGGAGCCGTGGCAGCTGG - Intergenic
1005966610 6:30731058-30731080 GATTGAGGAGCAGCGGGTGCAGG - Exonic
1006210511 6:32389750-32389772 GATTGGGGAGCAGTGGCTGCAGG + Intergenic
1006336616 6:33424390-33424412 GATTTGGGAGCTGGGTCAGCAGG + Intronic
1007635675 6:43298364-43298386 CTTTGAGGAGCTGCTGGAGCAGG + Exonic
1008292740 6:49737668-49737690 GACTGCGGAGCTGCGGAAGAAGG - Intronic
1013624608 6:111924991-111925013 GATTCAGGAGCTGATTCAGCAGG - Intergenic
1019170224 6:170129577-170129599 GATGGAGGGGCTGCTCCAGCAGG - Intergenic
1019951617 7:4377732-4377754 GATTGAGGGGCTGAGGGAGAAGG - Intergenic
1020217184 7:6202273-6202295 GGCTGAGGTGCTGCAGCAGCTGG - Intronic
1020275456 7:6622074-6622096 GCAGGAGGAGCTGCAGCAGCTGG + Exonic
1021565575 7:22013360-22013382 GATTGAAGAGCTTCAGCACCAGG - Intergenic
1023418127 7:39950770-39950792 GTTGCAGGAGCTGCGGCTGCAGG - Exonic
1023420056 7:39969642-39969664 TATTGAGGAGGTGAGGCATCTGG - Intronic
1024253155 7:47521360-47521382 TACTGAGCAGGTGCGGCAGCTGG - Intronic
1025144167 7:56490595-56490617 GAAAGAGGAGCTGGGGCTGCTGG + Intergenic
1025296191 7:57776721-57776743 GATGGCGGAGCGGCGGCTGCGGG - Intergenic
1026942501 7:74295336-74295358 AGTTGAGAAGCTGGGGCAGCAGG + Intronic
1027006950 7:74702840-74702862 TACTGAGAAGCTGAGGCAGCAGG - Intronic
1028582573 7:92422947-92422969 GAGTGTGGAGCTGCGTCTGCAGG + Intergenic
1028714445 7:93948611-93948633 GTTTGAGAAGCTGAGGCAGAAGG - Intergenic
1029189498 7:98761634-98761656 GATGGTGGAGCGGGGGCAGCGGG + Intergenic
1031960279 7:127983254-127983276 AATCGAGTAGCTGCAGCAGCAGG + Intronic
1032340978 7:131072782-131072804 GAAGGAGGAGCTGCAGCAGCAGG + Intergenic
1033055208 7:138046399-138046421 GAATGAGGAGATGCGGTATCAGG - Intronic
1033227854 7:139575136-139575158 GATTGAGTGGCTGCTGCTGCTGG + Exonic
1034447863 7:151122613-151122635 GCCTGGGGAGCGGCGGCAGCGGG - Intronic
1034501415 7:151453209-151453231 GCTCCAGGGGCTGCGGCAGCTGG + Intergenic
1034508939 7:151519256-151519278 GGTGGAGGAGCCGCGGTAGCTGG - Intronic
1037405185 8:18534948-18534970 CCTTGAGGAGCTGCAGCAGTAGG - Exonic
1037567602 8:20130654-20130676 GACTGAGGAGCTGGTGCAGGAGG - Intergenic
1037820719 8:22133474-22133496 GATGGAGGGGCTGGGGAAGCAGG - Intergenic
1038577301 8:28716326-28716348 GAGTGAAGAGCTCCTGCAGCTGG + Exonic
1038644318 8:29350248-29350270 GATGGAGGAGCTGCGGGAGATGG - Exonic
1039939466 8:42077033-42077055 GTTTTAGGAGCTGAGGCAGGAGG + Intergenic
1039944467 8:42117781-42117803 GCTTGAGGGGCTGAGGCAGGAGG - Intergenic
1041143660 8:54848201-54848223 GAGTGAGGAGCTGAGGCAGCAGG + Intergenic
1042474522 8:69232168-69232190 GATTGAGGAGGAATGGCAGCAGG - Intergenic
1047407670 8:124598838-124598860 GCCTGAGGAGCTGCATCAGCAGG + Intronic
1049109666 8:140635308-140635330 GCTCGAGGAGCGGCGGCGGCGGG - Intronic
1049405244 8:142449490-142449512 GATTGGGGAGCGCCGGCAGCCGG + Exonic
1049681790 8:143922092-143922114 GCAGGAGGAGCTGCAGCAGCTGG - Exonic
1049682290 8:143924828-143924850 GCTGGAGAAGCAGCGGCAGCTGG - Exonic
1049682377 8:143925296-143925318 CCTGGAGGAGCTGCGGCTGCAGG - Exonic
1049682478 8:143925803-143925825 GCTGGAGAAGCAGCGGCAGCTGG - Exonic
1049711127 8:144063853-144063875 GAACGAAGAGCTGCGGCGGCTGG - Intergenic
1049733838 8:144192827-144192849 GGCTGAGCAGCTGGGGCAGCTGG + Intronic
1050512933 9:6413562-6413584 GATTGAGGAGCTGCGCGAGCGGG + Exonic
1055595378 9:77860455-77860477 GATTGAGTAGGTGAGGCGGCGGG + Intronic
1057075913 9:92138068-92138090 CATGGAGCAGCTGCTGCAGCAGG + Intergenic
1057883103 9:98807959-98807981 GGGCGAGGAGCTGCGGCTGCAGG + Exonic
1059319120 9:113454055-113454077 CATTGAGCAGCTGAGGCAGGAGG - Intronic
1060053197 9:120391587-120391609 AAATGAGGACCTGAGGCAGCTGG + Intronic
1060879546 9:127108404-127108426 GATCGAGACGCTGCAGCAGCTGG - Exonic
1062360371 9:136185396-136185418 GACTGGGGAGCTGAGACAGCCGG - Intergenic
1186701107 X:12091179-12091201 GATCGAGAAGCTGAGGCACCAGG + Intergenic
1187174263 X:16882179-16882201 GATTGACGAGTTGCAGCTGCAGG + Intergenic
1191679790 X:63829379-63829401 GATTGAGGAGAGGCAGCAGAAGG - Intergenic
1191699755 X:64028047-64028069 GCTTGGGCAGCTGAGGCAGCAGG + Intergenic
1192185774 X:68946005-68946027 GGTTGAGGAATGGCGGCAGCCGG - Intergenic
1192882015 X:75295598-75295620 GATTGAGAATCTGCAACAGCAGG - Intronic
1195365848 X:104124643-104124665 GCTTGGGGAGCTGAGGCAGGAGG + Intronic
1195779015 X:108440097-108440119 GCTGAAGGAGCTGCGGGAGCCGG + Exonic
1195803210 X:108735310-108735332 GATGCTGTAGCTGCGGCAGCGGG + Exonic
1198734160 X:139767972-139767994 GATCTAGGAGCAGTGGCAGCAGG + Intronic
1202389847 Y:24358631-24358653 GTTTGAGGGGCTGAGGCAGGTGG + Intergenic
1202480937 Y:25311483-25311505 GTTTGAGGGGCTGAGGCAGGTGG - Intergenic