ID: 1114476446

View in Genome Browser
Species Human (GRCh38)
Location 14:22998537-22998559
Sequence GATTGAGGAGCTGCGGCAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 286}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114476446_1114476454 23 Left 1114476446 14:22998537-22998559 CCAGCTGCCGCAGCTCCTCAATC 0: 1
1: 0
2: 4
3: 20
4: 286
Right 1114476454 14:22998583-22998605 GCTGTCACACTCCTCTTCCACGG 0: 1
1: 0
2: 0
3: 12
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114476446 Original CRISPR GATTGAGGAGCTGCGGCAGC TGG (reversed) Exonic