ID: 1114476454

View in Genome Browser
Species Human (GRCh38)
Location 14:22998583-22998605
Sequence GCTGTCACACTCCTCTTCCA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 162}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114476446_1114476454 23 Left 1114476446 14:22998537-22998559 CCAGCTGCCGCAGCTCCTCAATC 0: 1
1: 0
2: 4
3: 20
4: 286
Right 1114476454 14:22998583-22998605 GCTGTCACACTCCTCTTCCACGG 0: 1
1: 0
2: 0
3: 12
4: 162
1114476447_1114476454 16 Left 1114476447 14:22998544-22998566 CCGCAGCTCCTCAATCACCACCT 0: 1
1: 0
2: 6
3: 51
4: 510
Right 1114476454 14:22998583-22998605 GCTGTCACACTCCTCTTCCACGG 0: 1
1: 0
2: 0
3: 12
4: 162
1114476450_1114476454 -4 Left 1114476450 14:22998564-22998586 CCTGCACGCCGCTGCCCACGCTG 0: 1
1: 0
2: 1
3: 18
4: 219
Right 1114476454 14:22998583-22998605 GCTGTCACACTCCTCTTCCACGG 0: 1
1: 0
2: 0
3: 12
4: 162
1114476449_1114476454 -1 Left 1114476449 14:22998561-22998583 CCACCTGCACGCCGCTGCCCACG 0: 1
1: 0
2: 2
3: 20
4: 215
Right 1114476454 14:22998583-22998605 GCTGTCACACTCCTCTTCCACGG 0: 1
1: 0
2: 0
3: 12
4: 162
1114476445_1114476454 24 Left 1114476445 14:22998536-22998558 CCCAGCTGCCGCAGCTCCTCAAT 0: 1
1: 0
2: 0
3: 21
4: 156
Right 1114476454 14:22998583-22998605 GCTGTCACACTCCTCTTCCACGG 0: 1
1: 0
2: 0
3: 12
4: 162
1114476448_1114476454 8 Left 1114476448 14:22998552-22998574 CCTCAATCACCACCTGCACGCCG 0: 1
1: 0
2: 0
3: 3
4: 105
Right 1114476454 14:22998583-22998605 GCTGTCACACTCCTCTTCCACGG 0: 1
1: 0
2: 0
3: 12
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114476454 Original CRISPR GCTGTCACACTCCTCTTCCA CGG Exonic