ID: 1114476606

View in Genome Browser
Species Human (GRCh38)
Location 14:22999449-22999471
Sequence CAGTAAAGATGGTGAGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 583
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 532}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114476606_1114476611 22 Left 1114476606 14:22999449-22999471 CCTCCTCCTCACCATCTTTACTG 0: 1
1: 0
2: 3
3: 47
4: 532
Right 1114476611 14:22999494-22999516 TGCTTTGACATTGTTCCTTAAGG 0: 1
1: 0
2: 0
3: 13
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114476606 Original CRISPR CAGTAAAGATGGTGAGGAGG AGG (reversed) Intronic
900474650 1:2870419-2870441 CAGGAATGATGGTGGGGTGGGGG - Intergenic
900644617 1:3703280-3703302 CAGTAACCCTGGGGAGGAGGGGG + Intronic
901656289 1:10771689-10771711 CAGTTGGGCTGGTGAGGAGGAGG - Intronic
901801071 1:11708239-11708261 GAGTTGATATGGTGAGGAGGAGG + Intronic
902076882 1:13794105-13794127 CAGAAGAGATGGTGAGGTGCAGG + Intronic
902275029 1:15333326-15333348 GAGGAAGGATGGGGAGGAGGAGG + Intronic
902317351 1:15632221-15632243 CACCAAAGATGGTGATGATGGGG + Intronic
902603229 1:17554224-17554246 CAGTGAGGATGGTGAGGGGCTGG + Intronic
902674544 1:17999602-17999624 CAGTTCACATGGTGAGGAAGTGG - Intergenic
902766410 1:18619110-18619132 CAGGGAAGATGCTGAGGGGGAGG - Intergenic
903499942 1:23795241-23795263 CAGGAGTGCTGGTGAGGAGGTGG + Exonic
904027624 1:27514317-27514339 CAGGACAGAGGGTGAGGAGCAGG + Intergenic
904236259 1:29119333-29119355 AGGTAGAAATGGTGAGGAGGGGG + Exonic
904782380 1:32960363-32960385 CAGTAAAGATGGTCAGGTATGGG + Intronic
905377979 1:37537777-37537799 CAGGAAAGATGACGAGGATGAGG - Exonic
905436337 1:37957884-37957906 TAGTAAAGTTGGTGAGGAAGAGG + Exonic
905787550 1:40770274-40770296 GAGAAAAGAAGGAGAGGAGGGGG + Intronic
905909542 1:41644291-41644313 CAGTACGTGTGGTGAGGAGGTGG + Intronic
906125440 1:43424409-43424431 CAGTGAGGATGGAGAGGAGCTGG - Exonic
906478324 1:46184605-46184627 CAGCAATGAAGATGAGGAGGAGG - Exonic
906514923 1:46433181-46433203 CAGGGCAGAGGGTGAGGAGGGGG + Intergenic
906900254 1:49828419-49828441 AAGTAAAGATGGTGTGGGGGAGG + Intronic
907342063 1:53742248-53742270 TAGTGAGGATGGAGAGGAGGAGG - Intergenic
907791079 1:57664196-57664218 CAGTAAAGATGTGGAGGCAGTGG - Intronic
909543648 1:76818900-76818922 CTATTAAGATGGAGAGGAGGAGG - Intergenic
909581683 1:77243117-77243139 CAAGAGAGTTGGTGAGGAGGGGG + Intergenic
909929247 1:81476359-81476381 CAGCAAAAATTGTGAGGAGTAGG + Intronic
910089479 1:83445405-83445427 CAGTAAAAATGGAGAGGAGGAGG + Intergenic
911251905 1:95585895-95585917 AAATGAAGATGGAGAGGAGGGGG - Intergenic
911514875 1:98855391-98855413 GAATAAGGATGGTGAAGAGGAGG - Intergenic
911593079 1:99770176-99770198 CAGTGGAGATGGAGAAGAGGGGG - Intergenic
912258352 1:108084014-108084036 CAGTAAATATGGTGGGGTGAGGG - Intergenic
912412845 1:109490038-109490060 CAGCGAAGAGAGTGAGGAGGAGG + Exonic
912731819 1:112113886-112113908 TAACACAGATGGTGAGGAGGAGG + Intergenic
913156894 1:116108457-116108479 CAGAGAAGATGGTGAGGGAGGGG + Intergenic
914266192 1:146040248-146040270 TAGAAAAGAAGTTGAGGAGGCGG + Intergenic
914784740 1:150818049-150818071 CAGTAAAGAGGGGGTGGAGAGGG + Intronic
915049701 1:153055695-153055717 GAGTGATGATGATGAGGAGGAGG + Intergenic
915482402 1:156195868-156195890 GAGTAGAGGTGGAGAGGAGGAGG + Intronic
916001527 1:160621121-160621143 CAGTAAGGATGGTGGGAAAGTGG + Intronic
916295371 1:163213435-163213457 CAGAAAGAATGGAGAGGAGGGGG - Intronic
917005296 1:170409119-170409141 CAGGAAGGGTAGTGAGGAGGGGG - Intergenic
917105592 1:171488039-171488061 CACTAAAGAGGGTGGGGTGGGGG - Intronic
917331676 1:173886562-173886584 TAGTCATGATGGTGATGAGGAGG + Exonic
917514645 1:175697570-175697592 CAGTAAAGAAGGAAAGGATGGGG - Intronic
917627652 1:176862344-176862366 CAGTCATGAGGGTGGGGAGGAGG + Exonic
918106353 1:181418552-181418574 AAGTAAAGATGGTGAATAAGTGG - Intronic
918255773 1:182745849-182745871 AAGTAAAGATGGTCAGGATAGGG - Intergenic
918395542 1:184110448-184110470 CAGGGAAGGTGGTGAGGTGGTGG + Intergenic
919631735 1:199966223-199966245 GAGAATAGATTGTGAGGAGGTGG - Intergenic
919659185 1:200226822-200226844 AAGTACAGATGATGAGGATGGGG - Intergenic
920106298 1:203555901-203555923 CAGGAGAGACGGAGAGGAGGGGG + Intergenic
922009741 1:221571015-221571037 CACTAAAGATGGAGAGGATTTGG - Intergenic
922076731 1:222252776-222252798 CAGAAAAGGTGGTGAGGACCAGG + Intergenic
923554629 1:234991004-234991026 GAGAGACGATGGTGAGGAGGTGG - Intergenic
924139402 1:241006375-241006397 CAGTAAAGCTCCTGAGGAGATGG - Intronic
924280738 1:242434489-242434511 CAATGAAGATGCTGGGGAGGGGG + Intronic
1063371708 10:5526584-5526606 CACTAGAGATGGTGAGGGGTTGG + Exonic
1063897985 10:10702216-10702238 CACTAAAAATGGGGAGAAGGGGG + Intergenic
1063953950 10:11248425-11248447 AAGGAAGGATGGAGAGGAGGAGG - Intronic
1064810247 10:19188855-19188877 CAGTAGAGATGGTCAGAAGTGGG + Intronic
1066451436 10:35533579-35533601 GAGCAAAGATGGGGAGGAGGAGG - Intronic
1066635706 10:37496878-37496900 CAGGAAAGAGAGTGAGAAGGGGG - Intergenic
1067208008 10:44236056-44236078 CAGGAAACATGATGAGAAGGAGG - Intergenic
1067220684 10:44342013-44342035 CAGGCAAAAAGGTGAGGAGGAGG + Intergenic
1067379176 10:45757129-45757151 CAGAAAAAAAGGTGAGCAGGAGG + Exonic
1067882319 10:50056772-50056794 CAGAAAAAAAGGTGAGCAGGAGG - Intergenic
1067886879 10:50097792-50097814 CAGAAAAAAAGGTGAGCAGGAGG + Exonic
1068957583 10:62832954-62832976 CAGAAAAGATGAAGAGGAGATGG + Intronic
1069247570 10:66225721-66225743 CAGAAATGTTGGTGAGGATGTGG - Intronic
1069706263 10:70460575-70460597 CAGAAGAGATGGGGAGGAGCAGG - Intergenic
1070277567 10:75022063-75022085 CAGTGAAGAAGAAGAGGAGGAGG + Exonic
1070809978 10:79292853-79292875 CAGAACAGGAGGTGAGGAGGTGG + Intronic
1071474671 10:86015812-86015834 CAGTACAGAAGGTGAGGCAGGGG + Intronic
1071928436 10:90437889-90437911 CAGCAAAGACAGTGAGGAAGAGG - Intergenic
1073094801 10:100972933-100972955 CTGTGAGGATGCTGAGGAGGAGG - Exonic
1073256810 10:102157510-102157532 CAGTGATGATGATGATGAGGAGG + Exonic
1073328844 10:102657900-102657922 CTGGGAAGATGGTGAGGAGAAGG - Exonic
1073768269 10:106707370-106707392 TAGTAGAGATGGTGGGGGGGAGG + Intronic
1074421672 10:113314723-113314745 AGGTAAAGATGGTGAGCATGAGG + Intergenic
1074422139 10:113318442-113318464 CATTTTAGAGGGTGAGGAGGAGG + Intergenic
1074727980 10:116334189-116334211 TAGTAAAGACGGGGAGGAGCGGG - Intronic
1076040336 10:127242078-127242100 CAGGAAAGAGGGTGATGAGTGGG - Intronic
1076559184 10:131350015-131350037 CAGTGAAGGTGGTTAGAAGGAGG - Intergenic
1077528146 11:3081094-3081116 CTGGAGAGGTGGTGAGGAGGTGG + Intergenic
1077732258 11:4744512-4744534 CAGTGAAGAGGATGAGGAAGAGG + Intronic
1077881309 11:6352920-6352942 CTGGGAGGATGGTGAGGAGGAGG - Intergenic
1078045043 11:7905959-7905981 CAATAGAGATAGTGAGAAGGTGG + Intergenic
1078148444 11:8738590-8738612 CAGCAGGGATGGGGAGGAGGGGG - Intronic
1078160176 11:8833102-8833124 CAGCAAAGCTGGTGAGCAGATGG + Intronic
1078507013 11:11959769-11959791 CAGGTGAGCTGGTGAGGAGGTGG - Intergenic
1079131952 11:17751971-17751993 CAGAGAAGGTGCTGAGGAGGGGG + Intronic
1080251675 11:30240484-30240506 GACTAAAGAAGGGGAGGAGGTGG + Intergenic
1080429514 11:32185365-32185387 CTGTCAAGATGCTGATGAGGAGG - Intergenic
1080441223 11:32296501-32296523 CAATGAAGATGGTGAGCAAGTGG + Intergenic
1080546229 11:33321645-33321667 CAGTGAGGATGAGGAGGAGGTGG + Intronic
1080557368 11:33429919-33429941 CAGAAGAGATGGTGAGGGGTAGG - Intergenic
1080819068 11:35787961-35787983 CATCAAAGCTGGTGAGGAAGGGG - Intronic
1081742638 11:45451251-45451273 CAAGAAAGACAGTGAGGAGGAGG + Intergenic
1082076992 11:47981676-47981698 CAGAAAAGAGGGTGAGGGTGGGG - Intronic
1082881344 11:58041225-58041247 CAGTGAGGATGGTGCTGAGGAGG + Intronic
1083273766 11:61585649-61585671 AAGTATTGATGGTGATGAGGTGG - Intergenic
1083388573 11:62331315-62331337 AAGAAAAGATGAAGAGGAGGAGG + Intergenic
1083612766 11:64011990-64012012 CAGTGGAGGTGGTGGGGAGGGGG - Intronic
1083638252 11:64131882-64131904 AAGAAAAGAAGCTGAGGAGGGGG + Intronic
1083783478 11:64930469-64930491 CATTGATGATGCTGAGGAGGAGG - Exonic
1083940689 11:65893916-65893938 GAGCTAGGATGGTGAGGAGGGGG + Intronic
1083987091 11:66222631-66222653 CAGTAAAGCAGGTGAACAGGAGG - Intronic
1085554821 11:77410704-77410726 CAGGAAAAATGATCAGGAGGAGG + Intronic
1085950075 11:81319654-81319676 AAGTAAATATGGTGAGTTGGAGG - Intergenic
1086095258 11:83043858-83043880 CAGTAAAAAGGGTCAGGGGGTGG - Intronic
1086345619 11:85893006-85893028 CAGAAAAGGTGGTCAGGAGAGGG - Intronic
1087942430 11:104115043-104115065 CAGGGAAGAGGGTGGGGAGGGGG - Intronic
1088893064 11:114059608-114059630 CACTAAAGATGGAGAGGCGCCGG + Exonic
1089566939 11:119376575-119376597 CAGTGAAGATGGCCAGGAGGAGG - Intronic
1089663645 11:120002465-120002487 CAAAAAAGATGGTGTGGGGGAGG + Intergenic
1089690278 11:120182852-120182874 CAGGAAAGATGAGGAGGAGGAGG + Intronic
1090745630 11:129702686-129702708 CACTCAAGATGAAGAGGAGGGGG + Intergenic
1090888850 11:130904843-130904865 CTGTAAAGATGGTGGGGGGCAGG - Intronic
1091005204 11:131947067-131947089 CAGAAAAGCTGGTGAGTAGTGGG + Intronic
1091086826 11:132728968-132728990 CAATAATGATGATGAGGAGATGG + Intronic
1091158739 11:133399471-133399493 CACTGATGATGGTGATGAGGAGG - Intronic
1091263206 11:134250255-134250277 CAGGTAAGAGGGTAAGGAGGAGG - Exonic
1091632546 12:2172919-2172941 CAGCAGAGTTGGTGAGGAGCTGG + Intronic
1091952629 12:4607593-4607615 CAGTAAAAATGCTCAGGAGGAGG + Intronic
1092386158 12:8037238-8037260 AAGTGAAGAGGGTGAGGAAGTGG + Intronic
1093698058 12:22185160-22185182 CATTAATGCTGGTGAGGATGTGG + Intronic
1093822205 12:23635205-23635227 TAGTAAAGATGGTGAGTAATGGG + Intronic
1093886366 12:24466188-24466210 AAGAAAAGAAGATGAGGAGGAGG - Intergenic
1094087190 12:26607165-26607187 CAGTACAGATGGTGAGCAGAAGG - Intronic
1094624759 12:32113177-32113199 CAGTAGGGATCGTGAGGAGGGGG + Intronic
1096828241 12:54295411-54295433 GAGTGAGGATGGGGAGGAGGCGG - Exonic
1096863109 12:54544235-54544257 GAGTAAAGTTGATGAGGAAGAGG + Exonic
1096972079 12:55674895-55674917 CAGAAGATATGCTGAGGAGGAGG + Intergenic
1097033456 12:56105832-56105854 CAGCAAAGATGGTGGGGAACAGG + Intronic
1097722416 12:63037421-63037443 AAGGAAAGATGGTGAGTCGGGGG - Intergenic
1097902046 12:64882921-64882943 CAGACACCATGGTGAGGAGGAGG - Intergenic
1097919082 12:65052485-65052507 CAGGCATGATGGTGGGGAGGAGG - Intronic
1098055208 12:66497724-66497746 CAGCAAAAATGGAGAGGAGCAGG + Intronic
1099029370 12:77506158-77506180 CAGCTAAAATGGTAAGGAGGAGG - Intergenic
1099171034 12:79364225-79364247 CATTAAAGGGGGTGGGGAGGGGG - Intronic
1101022873 12:100571828-100571850 CAGAAGGGATGGTGAGGAAGAGG - Intergenic
1101068087 12:101044085-101044107 CAATAATGATGATGAAGAGGAGG - Intronic
1101409219 12:104455493-104455515 TAGTGATGATGGTGGGGAGGTGG + Intronic
1101735169 12:107458101-107458123 CAGCAATGATGATGAGGATGAGG - Intronic
1101825281 12:108215669-108215691 CATTAAAGATGCTGGTGAGGAGG - Intronic
1101878029 12:108608300-108608322 CAGTGAGGATGGGGATGAGGGGG - Intergenic
1102873592 12:116432729-116432751 CAGAAAAATTGGTGAGGGGGTGG + Intergenic
1103049109 12:117763852-117763874 CAGCAAAGATGGAGAGAAGTCGG + Intronic
1103896689 12:124277940-124277962 CAGTGAAGAAGAGGAGGAGGAGG - Intronic
1103909700 12:124345438-124345460 CAGAAAGGATGGTGAGGAAATGG + Intronic
1104147714 12:126051612-126051634 CAGTAAAGACAGGAAGGAGGTGG + Intergenic
1104489286 12:129180196-129180218 CAGCACAGATAGTGGGGAGGAGG + Intronic
1104489443 12:129181325-129181347 AAGTAGAGATGGAGAGAAGGAGG - Intronic
1104583198 12:130026105-130026127 GAGTAAACAGGGTGAGGAGAGGG - Intergenic
1104898878 12:132177195-132177217 CAGTCACGAGGGGGAGGAGGCGG + Intergenic
1105357387 13:19671074-19671096 AAGTCAAGATGTTGTGGAGGAGG - Intronic
1108482275 13:50885935-50885957 CACTAAAGGTGGTGAGGATGTGG + Intergenic
1108543382 13:51465883-51465905 CAGTAAAGGTGGTGAGAAATGGG + Intergenic
1110318624 13:74135639-74135661 CACCTAGGATGGTGAGGAGGCGG - Intergenic
1113927368 13:113949206-113949228 CAGTGAAGAGAGTGGGGAGGTGG - Intergenic
1114260603 14:21033579-21033601 GAGGAAGGATGATGAGGAGGTGG + Exonic
1114476606 14:22999449-22999471 CAGTAAAGATGGTGAGGAGGAGG - Intronic
1114551644 14:23535917-23535939 TAGGAAAGATGGGGAGGAGCAGG - Intronic
1115660856 14:35493333-35493355 AAATAGAGATGCTGAGGAGGAGG + Intergenic
1115688555 14:35821979-35822001 CAGGAAAGGTGGAAAGGAGGAGG - Intergenic
1115849859 14:37583081-37583103 CAGTAATGGGGGTGAAGAGGGGG + Intergenic
1115876386 14:37866477-37866499 CAGAAAATATGGAGAGGATGGGG - Intronic
1117201848 14:53398457-53398479 CAGTAAAGATGGTCTGGGGTGGG + Intergenic
1118343457 14:64915512-64915534 TAGAAAAGAAGGTGAGGAGCTGG + Intronic
1118437065 14:65781353-65781375 CAATGAAGAAGGGGAGGAGGAGG - Intergenic
1119319515 14:73721398-73721420 CAGGAAGGAGGGGGAGGAGGAGG - Exonic
1119662813 14:76463828-76463850 CAGTAGAGAAAGTGAGGAAGAGG - Intronic
1120212243 14:81644602-81644624 TAGTGATGATGGTTAGGAGGAGG + Intergenic
1120570760 14:86114137-86114159 GACTGATGATGGTGAGGAGGAGG - Intergenic
1120734488 14:88037847-88037869 CAGGAAAGATGAGGAGGAGGAGG - Intergenic
1120819074 14:88895243-88895265 TAAAAAAGAGGGTGAGGAGGAGG - Intergenic
1121420228 14:93808016-93808038 TAGCAATGATGGTGACGAGGAGG + Intergenic
1121568101 14:94925718-94925740 CAGTAATAATGAGGAGGAGGAGG - Intergenic
1202920032 14_KI270723v1_random:22883-22905 CAGAAGAGTTGGTGAGGACGTGG - Intergenic
1125677299 15:41509266-41509288 GAGTGAAGGAGGTGAGGAGGGGG + Intronic
1125758623 15:42082748-42082770 GAGCTAAGATGTTGAGGAGGAGG + Intronic
1125937246 15:43648137-43648159 GGGTAAAGAGGGTGGGGAGGAGG - Intronic
1125965692 15:43874028-43874050 CGGTAAGGATGATCAGGAGGAGG + Exonic
1126919827 15:53508949-53508971 CGGAAAAGATGGTAAGGAGGTGG - Intergenic
1127215921 15:56823021-56823043 AAGGAGTGATGGTGAGGAGGTGG - Intronic
1127507791 15:59611669-59611691 CACTAAAGAAGATGAGGAGAGGG - Intronic
1128340403 15:66818601-66818623 CACTGAAGATGGTGGGGTGGAGG + Intergenic
1129464259 15:75715142-75715164 CAGGGAAGATGGGGAGGGGGTGG - Intergenic
1129889386 15:79061108-79061130 CAGCTAAGAAGGGGAGGAGGGGG - Intronic
1129954737 15:79625512-79625534 CAGAGGAGATGGTGAGGATGGGG + Intergenic
1130121327 15:81050098-81050120 CAGTAAATAAGGGCAGGAGGAGG + Intronic
1130804571 15:87305836-87305858 CAGTAAAGAAGTTGCAGAGGTGG - Intergenic
1131145205 15:90006596-90006618 CAGTAATCATGGAGAGGGGGAGG + Intronic
1131438506 15:92441324-92441346 CAGTAAAAGTGGTGAGGAGGAGG + Intronic
1131709135 15:95033821-95033843 CAGTAGAGAGGAAGAGGAGGAGG - Intergenic
1133458936 16:5969765-5969787 AAGTGATGGTGGTGAGGAGGAGG - Intergenic
1133724844 16:8527853-8527875 CAGTCTAGGTGATGAGGAGGGGG - Intergenic
1134183670 16:12066667-12066689 GAGAAAAGATGGTGGGGAGGAGG + Intronic
1136012194 16:27371168-27371190 CAATAAAGAGGGAGAGGATGGGG - Intergenic
1136539901 16:30923511-30923533 GAGTAAAGAGGGGGAGGAGGAGG + Intronic
1136554836 16:31001573-31001595 CAGTGATGATGAAGAGGAGGTGG - Exonic
1137978572 16:53051185-53051207 CATTAAAGAGGGTGAGGATCAGG - Intergenic
1138123325 16:54418376-54418398 CAGTACAGATGGTGAGACGAGGG - Intergenic
1138521568 16:57574375-57574397 CTGCAGAGATGGTGATGAGGTGG + Intronic
1138911963 16:61411860-61411882 TAGTAAAAATGGGGAGGTGGTGG - Intergenic
1140475202 16:75236413-75236435 CAGTGATGGTGGTGATGAGGTGG - Intronic
1140974479 16:80045722-80045744 CAGTGAAGAGGGTGGGGAAGAGG + Intergenic
1141155489 16:81593986-81594008 GAGGAAAGAGGGGGAGGAGGGGG - Intronic
1141160908 16:81628497-81628519 CAGTAAAAAGGGAGAAGAGGAGG - Intronic
1141392432 16:83676067-83676089 CAGGAAAGAAGGAGAGGAGGAGG + Intronic
1141816163 16:86410594-86410616 GAGTGGAGATGGTGAGTAGGTGG + Intergenic
1141892461 16:86935496-86935518 CAATAAAGTTGGTGAGAAGGTGG - Intergenic
1143352167 17:6296999-6297021 TAGTAGAGATGGGGAGGAGGTGG - Intergenic
1143632889 17:8148866-8148888 CAGCAAAGACGCTGGGGAGGGGG + Intronic
1143829886 17:9642851-9642873 CAGTAAATTTGAAGAGGAGGGGG - Intronic
1143968038 17:10770859-10770881 GAGTAAAGGTGGTTAGGAGGCGG - Intergenic
1143968906 17:10778230-10778252 GAAGAAAGATGGGGAGGAGGAGG + Intergenic
1146208947 17:30926972-30926994 CACCAAAGATGGAGAGGGGGAGG - Intronic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146706148 17:35002094-35002116 CAGCAAAGATGGTAAGGATAGGG + Exonic
1146910484 17:36645503-36645525 GAGGAAAGATGGGGAGGAAGGGG - Intergenic
1147412718 17:40265075-40265097 CAGTAAAGATGGGGAGGCCGAGG - Exonic
1147499158 17:40945659-40945681 GAGCAGAGAAGGTGAGGAGGAGG + Intergenic
1147899218 17:43773044-43773066 CAGTACAGCTGGAGTGGAGGAGG + Intronic
1147968417 17:44206761-44206783 CAGGGAACATGGGGAGGAGGAGG - Exonic
1148171073 17:45520327-45520349 AAGTAAAGATTGTGAGAAAGTGG + Intergenic
1148278606 17:46329478-46329500 AAGTAAAGATTGTGAGAAAGGGG - Intronic
1148300816 17:46547340-46547362 AAGTAAAGATTGTGAGAAAGGGG - Intronic
1148364949 17:47048225-47048247 AAGTAAAGATTGTGAGAAAGTGG - Intergenic
1148380473 17:47193173-47193195 GAGTAAACATGGTGAGGGTGGGG - Intergenic
1148482857 17:47971335-47971357 CGGGAAACACGGTGAGGAGGGGG - Intronic
1148554004 17:48566993-48567015 CACTGGAGATTGTGAGGAGGTGG - Intronic
1148559077 17:48595678-48595700 CAGGAAAGATGGAGAGGCTGGGG + Intronic
1148759174 17:49990642-49990664 GAGTAGAGAAGGTGAGGTGGGGG + Exonic
1149864755 17:60145134-60145156 CCCTAAAGAGGGTGATGAGGGGG - Intergenic
1150042109 17:61874215-61874237 CAGGAAAGATGCAGAGGAGATGG - Intronic
1150401687 17:64861923-64861945 AAGTAAAGATTGTGAGAAAGGGG + Intronic
1150703271 17:67466180-67466202 CTGTAGAGATGGTGGGGTGGGGG + Intronic
1151313086 17:73306086-73306108 CAGACAAGATGGTGAGGTGGAGG + Intronic
1151666130 17:75546105-75546127 CAGTAAAGAGGGAGGGGATGGGG + Intronic
1151688705 17:75666339-75666361 CAGTACGAAGGGTGAGGAGGAGG + Intronic
1151711383 17:75808964-75808986 CAGTGAAGGTTGGGAGGAGGCGG + Intronic
1151941915 17:77298010-77298032 CAGTAGAGCAGGCGAGGAGGAGG + Intronic
1152036418 17:77875823-77875845 CAGTGAAGCCGGGGAGGAGGGGG + Intergenic
1152295324 17:79463928-79463950 CAGTGGCGATGGTGGGGAGGTGG - Intronic
1152528193 17:80901772-80901794 CAGGAAAGATGGGGAGGCGCTGG - Intronic
1152703652 17:81832322-81832344 CAGGGGAGAGGGTGAGGAGGTGG - Intronic
1154197815 18:12279230-12279252 CAGGAGAGGAGGTGAGGAGGAGG + Intergenic
1154300100 18:13184968-13184990 CAGTACACGAGGTGAGGAGGTGG + Intergenic
1155080977 18:22409338-22409360 CAGCAAAGATGGAGAGAAAGTGG - Intergenic
1156112608 18:33745833-33745855 CATGAAAGAAGGTGATGAGGTGG + Exonic
1156439783 18:37173045-37173067 CTGTAATGATGGTGAGGCTGTGG - Exonic
1157068633 18:44380532-44380554 CCGTAATGCTGGTGAGGATGTGG + Intergenic
1157514682 18:48302371-48302393 CAGTAAAAAGGGAGAGAAGGTGG - Intronic
1158377662 18:56889172-56889194 CAGTCATGATGGGGAGGAGATGG + Intronic
1158524078 18:58196927-58196949 AAGAGGAGATGGTGAGGAGGAGG + Intronic
1159973752 18:74685350-74685372 CAGGATAGATGGTGAGCAGCTGG - Intronic
1160388842 18:78515082-78515104 CAGGAAAGATGTGGAGGAGGTGG + Intergenic
1161003727 19:1924313-1924335 CAGGAATGAAGGGGAGGAGGTGG - Exonic
1161351006 19:3791644-3791666 CACTCAAGAAGGGGAGGAGGTGG - Intronic
1162023321 19:7878908-7878930 CAGGAGTGCTGGTGAGGAGGTGG - Intergenic
1162768861 19:12937370-12937392 CAGGAAAGAGGGTGGGGAGGGGG - Intergenic
1163115170 19:15184862-15184884 CAGAGGAGATGGAGAGGAGGAGG + Intronic
1164542586 19:29132003-29132025 CAGTCAGGAAGCTGAGGAGGAGG - Intergenic
1165782110 19:38440968-38440990 CAGGAGAGAAAGTGAGGAGGGGG + Intronic
1166046536 19:40233748-40233770 CTGGAAAGGGGGTGAGGAGGTGG + Exonic
1166173363 19:41048054-41048076 CAGTGAAGCTGGGGAGGAGGTGG - Intergenic
1166898595 19:46040461-46040483 CATTAAGGTTGGTGGGGAGGTGG - Intronic
1167435220 19:49475073-49475095 GAGGGAAGATGGAGAGGAGGGGG + Intronic
1167608177 19:50492833-50492855 GAGGAAAGAGGGAGAGGAGGAGG + Intergenic
1167739409 19:51315260-51315282 GAGTGATGATGGTCAGGAGGGGG + Intronic
1168307543 19:55443452-55443474 GAGAAAAGAAGGGGAGGAGGAGG + Intergenic
1168593940 19:57659171-57659193 AAGTAAAGTTGGTAAGGATGGGG - Intergenic
925538732 2:4943354-4943376 AAGTGAAGATGATGAAGAGGAGG + Intergenic
926240376 2:11080717-11080739 CAGTGATCATGATGAGGAGGAGG - Intergenic
926665864 2:15522266-15522288 CACTAGAAATGGGGAGGAGGAGG + Intronic
926689875 2:15725783-15725805 CAGGAAGGATTGTGAAGAGGGGG + Intronic
927562248 2:24082373-24082395 GAGTAAAGATGGTGTGGACAAGG - Intronic
928791073 2:34954387-34954409 GAGAAAACATGGGGAGGAGGAGG + Intergenic
930104598 2:47630119-47630141 CAGGAGAGTCGGTGAGGAGGTGG - Intergenic
930358090 2:50346246-50346268 CAGGGAAGATGGGCAGGAGGTGG + Intronic
931343531 2:61425736-61425758 CAGTAGAGGTGGTGGGAAGGGGG + Intronic
931530074 2:63204193-63204215 AAGAAAAGCTGGTGAGGATGTGG - Intronic
931871847 2:66469308-66469330 CACAAAAGCTGGTGTGGAGGGGG - Intronic
932474662 2:71995213-71995235 CAGTAAAGTTTCTGAGGAAGGGG - Intergenic
933540626 2:83637241-83637263 CATAACAGATGGTGAGGAGATGG - Intergenic
933584276 2:84162660-84162682 CAGTAGAGACTGTGAGGAGGAGG - Intergenic
933676613 2:85063204-85063226 CAGTGAAGATGGTGGGAAGGGGG - Intergenic
934054143 2:88237836-88237858 TGATAAAGATGATGAGGAGGAGG + Intergenic
934087901 2:88525509-88525531 CAGGGAAGATGGGGAGGAGTGGG + Intronic
936959245 2:118056142-118056164 CAGTCAAGGTGGTGAAGAAGGGG + Intergenic
937660841 2:124428187-124428209 CAGTCAGGCTGGTGAGGTGGGGG - Intronic
937908117 2:127062201-127062223 CAGGAGAGACAGTGAGGAGGTGG + Intronic
938031420 2:127997635-127997657 CAGTGGGGATGGTGAGCAGGGGG + Intronic
938538253 2:132263706-132263728 CAGTAAGTATGGTGTTGAGGCGG - Intergenic
938640716 2:133276050-133276072 CAGTAAATGGGCTGAGGAGGAGG - Intronic
938759551 2:134411719-134411741 GAGGAAAGCTGGTGAGAAGGAGG + Intronic
939174018 2:138729120-138729142 CACTAAAGCTGTTGAGGAGAAGG - Intronic
939283158 2:140091100-140091122 CATTAAGTAGGGTGAGGAGGAGG - Intergenic
940026012 2:149209167-149209189 TTGTAAAGGTGGTGAGAAGGCGG + Intronic
940155109 2:150647729-150647751 CAATGATGATGATGAGGAGGAGG - Intergenic
940517966 2:154704922-154704944 CAGATAAAATGGTGGGGAGGTGG + Intronic
940553037 2:155185847-155185869 CAGATGAGCTGGTGAGGAGGTGG + Intergenic
940797741 2:158098408-158098430 CATCCAAGATGGTGAGGGGGAGG + Intronic
941128815 2:161620923-161620945 AAGTGAAGATGATGAGGATGAGG + Intronic
941359743 2:164537342-164537364 AAGTAAAGATGGACAGGAAGGGG + Intronic
942059554 2:172215643-172215665 CAGTAAGGATTGTTAGGAGTTGG - Intergenic
944269994 2:197771624-197771646 CAGGAAAGAGGGTAAGGAAGTGG + Intronic
944879169 2:203993943-203993965 AAGCAAAGATGTTGAGAAGGAGG + Intergenic
946384459 2:219374104-219374126 CAGAAAAGTTGGGGAGCAGGTGG - Exonic
946519857 2:220452777-220452799 CAGTAAAGCTTCTGAGGAGGAGG - Intergenic
946708802 2:222485769-222485791 CAGGAGAGCTGGTGAGGAGTTGG - Intronic
946867924 2:224059186-224059208 CAGTATAGATGCTGAGAAGTGGG + Intergenic
947383515 2:229567949-229567971 CAGTAAAGACTGTGAGGGAGAGG - Intronic
947614294 2:231545265-231545287 CAGAAAGCATGGTGAGGGGGTGG - Intergenic
947790435 2:232864089-232864111 CAGAAAACATGGCGAGGTGGGGG - Intronic
947973512 2:234344410-234344432 GAGGAAAGAAAGTGAGGAGGTGG - Intergenic
949043286 2:241859074-241859096 CAGAGGAGATGGGGAGGAGGTGG + Intergenic
1169394099 20:5214530-5214552 CAGCAAAGATGAGGAGGCGGCGG + Intergenic
1169590050 20:7130725-7130747 CAATCAAGGTGGTGAGGAGGGGG + Intergenic
1169812497 20:9622476-9622498 AAGTAAACATGAGGAGGAGGGGG + Intronic
1169876968 20:10308810-10308832 TGGTTAAGATGGTGTGGAGGTGG - Intergenic
1170203861 20:13776073-13776095 AAGTGAAGATGATGAAGAGGAGG - Exonic
1170447465 20:16443336-16443358 CAGTAAACTTGGTGAAAAGGAGG + Intronic
1170562647 20:17570201-17570223 CGGCGAAGATGGTGAGTAGGAGG + Exonic
1171422901 20:25030747-25030769 GATCAATGATGGTGAGGAGGTGG - Exonic
1172173985 20:32961326-32961348 CAAGGAAGATGGGGAGGAGGCGG - Intergenic
1172197356 20:33101052-33101074 CAGTGATGATGATGAGGAGGAGG + Intronic
1172436451 20:34931959-34931981 CAGCAAAGGTGGCGCGGAGGCGG + Exonic
1172624659 20:36340282-36340304 AAGTGGAGATGGTGAGGAAGGGG + Intronic
1172789598 20:37493702-37493724 CAGTGCAGATGGAGAGAAGGCGG - Intronic
1172852434 20:37976483-37976505 AATTATAGATGTTGAGGAGGTGG + Intergenic
1173009554 20:39169448-39169470 CAGTGCAAACGGTGAGGAGGTGG - Intergenic
1173310433 20:41892093-41892115 GCCTAAAGATGGGGAGGAGGAGG - Intergenic
1173934434 20:46848804-46848826 CACCAAAGATGGTGAGCATGTGG + Intergenic
1174116541 20:48230290-48230312 GAGTAAAGATGAGAAGGAGGCGG - Intergenic
1174147918 20:48464962-48464984 CAGCAGAGACTGTGAGGAGGTGG - Intergenic
1174362378 20:50037101-50037123 CACTAAAGCTTCTGAGGAGGTGG + Intergenic
1175254029 20:57628113-57628135 TAGGCAAGATGGTGAGGGGGAGG + Intergenic
1175317991 20:58065079-58065101 CAGGAAGCATGGTGAGGAGCCGG - Intergenic
1176110580 20:63408868-63408890 CAGGGAAGAGGGTGAGCAGGTGG - Intronic
1176993445 21:15525179-15525201 GAGTGAAAATGGGGAGGAGGAGG - Intergenic
1177925421 21:27208362-27208384 CAGAAAAGATGATGCGCAGGGGG - Intergenic
1177966736 21:27737152-27737174 CTGTAAAGATATTGAGGAGTTGG + Intergenic
1178412808 21:32379531-32379553 TAGTGATGATGATGAGGAGGAGG + Intronic
1178777071 21:35561982-35562004 AGGAAAAGAAGGTGAGGAGGGGG + Intronic
1179906030 21:44423825-44423847 GAGGAGTGATGGTGAGGAGGAGG + Intronic
1180235602 21:46457910-46457932 CATTAAAGCTGGTGAGAAGATGG - Intergenic
1181030086 22:20145459-20145481 CAGAGAAGTTGGTGGGGAGGGGG - Intronic
1181735964 22:24881708-24881730 TAGTGATGATGATGAGGAGGAGG - Intronic
1182159840 22:28110637-28110659 CATTAAAAATGGTGAGGGGCTGG + Intronic
1182300514 22:29334414-29334436 CAGGGAAGAGGGTGCGGAGGGGG + Intronic
1182699235 22:32220587-32220609 AAGTAAAGTTGGAGAGAAGGTGG + Intronic
1183294781 22:37023047-37023069 CAGGAAAGATAGAGAGGAGAGGG + Exonic
1183549690 22:38474613-38474635 CAGTAATGAAGGTGAGGGGCTGG + Exonic
1185003453 22:48261291-48261313 TGGTAATGATGGTGATGAGGAGG - Intergenic
1185206432 22:49541630-49541652 CAGAAAAGATGGTGGGAAGGGGG - Intronic
949524186 3:4887130-4887152 AGGTAAAAATGATGAGGAGGTGG - Intronic
949564854 3:5235226-5235248 GACTACAGAGGGTGAGGAGGAGG - Intergenic
949818085 3:8083544-8083566 AAGTAAAAATGGGGAGGTGGTGG - Intergenic
949986493 3:9545264-9545286 GAGGAAAGAGGGAGAGGAGGAGG + Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950528291 3:13537410-13537432 CACAAGAGTTGGTGAGGAGGTGG + Intergenic
954147548 3:48641774-48641796 CAGGAAAGATGGGGAGCTGGAGG + Intronic
954396421 3:50295704-50295726 CTGTAAGGATGGGGAGGAGCTGG - Intronic
955075158 3:55606823-55606845 CTGTAAAGAAGAAGAGGAGGAGG - Intronic
955187186 3:56725770-56725792 CAAAAAAGATGAGGAGGAGGAGG + Intergenic
956181953 3:66525362-66525384 CTCTAAAGAAGGGGAGGAGGAGG - Intergenic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
956878644 3:73488863-73488885 CAGCAGAGATGGGGAGGAGGGGG - Intronic
958494832 3:94831079-94831101 TACTAAACATGGAGAGGAGGGGG - Intergenic
959551411 3:107663501-107663523 CATTAAGGATTGTGATGAGGGGG - Intronic
959631873 3:108516021-108516043 CAATAAATATGGGGATGAGGGGG + Intronic
960677918 3:120214801-120214823 CAGTTAAGTGGGTGAGGGGGTGG + Intronic
961655667 3:128440359-128440381 CAGAAGAGGTGGTGAGGTGGGGG - Intergenic
962084807 3:132179520-132179542 CAGAAAAGGTGGGGAGAAGGGGG + Intronic
963016140 3:140826002-140826024 CAGTAAAGAAGGAGTTGAGGGGG + Intergenic
963135249 3:141897211-141897233 CACCAAAGATGGAGAGGAGGAGG - Intronic
963141690 3:141950997-141951019 CACTGAGCATGGTGAGGAGGAGG - Intergenic
963376634 3:144474896-144474918 GAGTCAAGATGGTGAGCAGTGGG - Intergenic
964010982 3:151891266-151891288 CTGTAGACATGCTGAGGAGGTGG + Intergenic
964090606 3:152872039-152872061 CAGTGAGGATGGTGAGGATGTGG + Intergenic
964282734 3:155084272-155084294 CAGCTATGATGGTGAGGAGCAGG - Exonic
964398588 3:156273801-156273823 CAGAAAAGATCTGGAGGAGGTGG - Intronic
964667616 3:159191292-159191314 CAGTTAAGATGATGAAGATGAGG + Intronic
965180906 3:165402164-165402186 AAGTAAAGATTATGAGAAGGAGG - Intergenic
968088827 3:195886961-195886983 GAGTAAGGTGGGTGAGGAGGTGG - Exonic
968195379 3:196702174-196702196 CAGGGGAGATGGTGAGGATGGGG + Intronic
969410142 4:7022630-7022652 CAGTAAGCATGGCCAGGAGGTGG + Intronic
969465548 4:7354223-7354245 CAGTAGAGAGGGTCAGTAGGAGG + Intronic
970205026 4:13647016-13647038 GAGAAAAGATGGGGAGGAGAAGG - Intergenic
971143643 4:23951985-23952007 CAGTAAATATGATGGGGAAGTGG - Intergenic
971920759 4:32936473-32936495 CAGTAAAGATGATGTGCTGGAGG + Intergenic
971954765 4:33401654-33401676 GAGTAGTGGTGGTGAGGAGGTGG + Intergenic
973609246 4:52618629-52618651 CAGTAGAAAAGGTGATGAGGTGG + Intronic
973657997 4:53071079-53071101 CAATAAAGATGAAGTGGAGGAGG - Intronic
974047008 4:56907177-56907199 AAGAAAAGGTGGTGAGGACGGGG - Intergenic
974178169 4:58351356-58351378 CAATAGAGATGGGGAGGAGGAGG + Intergenic
974180438 4:58378095-58378117 CAGAAAAGATGGTAAGTTGGGGG - Intergenic
975055511 4:69924562-69924584 TAGTTAATCTGGTGAGGAGGTGG + Intergenic
975690208 4:76955482-76955504 CAGACAAGAGGCTGAGGAGGTGG + Intronic
976540443 4:86268289-86268311 CAGTAAAGATGGTGAGAAGATGG - Intronic
976915492 4:90369147-90369169 CAGGAAGGAAGGAGAGGAGGAGG + Intronic
977807265 4:101315841-101315863 CAGAAAAGGGGGTGAGGAAGGGG - Intronic
979296854 4:119042857-119042879 CAGAAAAGATGGTGACGTGTTGG + Intronic
979856522 4:125639522-125639544 CAGTAAGGAAGGGGAGAAGGGGG - Intergenic
981663971 4:147200436-147200458 AAGTAGTGATGGGGAGGAGGGGG + Intergenic
981756083 4:148142895-148142917 CAAGAGAGATGGTGGGGAGGGGG - Intronic
983896618 4:173087893-173087915 CAGTAAGGGTAGTGGGGAGGTGG - Intergenic
984580497 4:181504471-181504493 AGGTAAAGAGGGGGAGGAGGAGG - Intergenic
985818682 5:2145508-2145530 AGGTCATGATGGTGAGGAGGTGG - Intergenic
985818951 5:2147001-2147023 AGGTCATGATGGTGAGGAGGTGG - Intergenic
986384421 5:7217750-7217772 CAACAAAAATGGTGAGGAAGGGG - Intergenic
987240026 5:15986775-15986797 CAGTAAAGATGGGGGGAAGACGG - Intergenic
987695731 5:21328957-21328979 CAGTAAAGATGGAGAGAAATAGG + Intergenic
988816844 5:34842573-34842595 CAAAAGAGATGGTGAGAAGGGGG + Intronic
989478826 5:41904457-41904479 CGGTGAAGATGGTGAGGGAGCGG + Exonic
990066371 5:51720515-51720537 CTGTAATGATGGCGAGGAAGAGG - Intergenic
991744670 5:69723135-69723157 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991753033 5:69832098-69832120 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991796241 5:70302859-70302881 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991802651 5:70388825-70388847 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991824052 5:70598449-70598471 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991832353 5:70707217-70707239 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991888619 5:71302418-71302440 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991994581 5:72374688-72374710 AAGTCCAGATGGTGAGGAGCTGG + Intergenic
992994372 5:82318053-82318075 CAGAAAAGCTGGCGAGAAGGAGG - Exonic
993173081 5:84445780-84445802 CAGTAAAGATGGTAAGAAATAGG - Intergenic
995350695 5:111172144-111172166 CAGAAAAGAGGGTTAGGAGAAGG - Intergenic
995730026 5:115229081-115229103 TAGTATAGATGGTGATGAGAAGG + Intronic
995807751 5:116072772-116072794 CAGAGAAGAAGGTGAGTAGGTGG + Intergenic
995959132 5:117817990-117818012 CACTAATGATGGTGAGGTTGTGG - Intergenic
997122030 5:131184669-131184691 CAGAGAAGATGAGGAGGAGGTGG - Intronic
998061982 5:139126055-139126077 CAGTGAAAATGGGGTGGAGGTGG - Intronic
998190137 5:140016756-140016778 CAGTGAACTAGGTGAGGAGGAGG + Intronic
999996838 5:157100390-157100412 AAGGAAAGATGGTGAGTGGGTGG - Intronic
1001042688 5:168348310-168348332 CAGTAGAGAGGGTGAGGGTGAGG - Intronic
1001465906 5:171965973-171965995 CAGGAGAGAGGGTGAGAAGGGGG - Intronic
1001727760 5:173921423-173921445 CAGAGGAAATGGTGAGGAGGAGG + Intronic
1002164498 5:177336118-177336140 CAGCAAAGATGCTGGGGAGTGGG + Intronic
1002227535 5:177734880-177734902 CAGTTACAACGGTGAGGAGGAGG - Exonic
1002706974 5:181168018-181168040 CAGTAGAGGTGGGGAGTAGGGGG - Intergenic
1003236834 6:4302422-4302444 CAGTTCATATGGTGAGGTGGAGG + Intergenic
1003545307 6:7052953-7052975 AAGGAAAGCTGGGGAGGAGGTGG + Intergenic
1003658632 6:8039282-8039304 CAGGAAGTATAGTGAGGAGGAGG + Intronic
1004065871 6:12243281-12243303 GAGTAAAGAGGAGGAGGAGGAGG + Intergenic
1004489028 6:16096295-16096317 CTAGAAAGGTGGTGAGGAGGCGG + Intergenic
1004523659 6:16385420-16385442 CAGTAAGCATGGAGAAGAGGAGG + Intronic
1004560959 6:16750084-16750106 CAGGAAAGACTTTGAGGAGGAGG - Intronic
1005555054 6:26969109-26969131 CAGTAAAGATGGAGAGAAATAGG - Intergenic
1005774350 6:29114444-29114466 TAATAAAGATGGGGAGGGGGGGG - Intergenic
1005926490 6:30449739-30449761 CAGAAAGGATGGTGTTGAGGGGG - Intergenic
1005928207 6:30462311-30462333 CAGAAAGGATGGTGTGGAAGGGG - Intergenic
1006044681 6:31284347-31284369 CAGAAAAGAAGATGGGGAGGAGG + Intronic
1006327422 6:33365013-33365035 CAGGAGTGCTGGTGAGGAGGTGG - Intergenic
1007021201 6:38523246-38523268 CAGTAAAAATGGAGAAGAAGAGG - Intronic
1007053604 6:38859187-38859209 CTGTTAAGATGGTAAGGAGGAGG - Intronic
1008126245 6:47672676-47672698 GAGGAAAGATGGAGGGGAGGTGG - Intronic
1008616943 6:53235664-53235686 AAATGAAGAGGGTGAGGAGGGGG - Intergenic
1008664007 6:53697894-53697916 CAGTGAGGATGGAGAGGAAGAGG + Intergenic
1008698503 6:54070328-54070350 CATTAAACATGGGGGGGAGGTGG - Intronic
1008875782 6:56324825-56324847 TAAGATAGATGGTGAGGAGGAGG - Intronic
1010116174 6:72315273-72315295 TAGTGAAGATGGTGAGAAGAGGG + Intronic
1010364836 6:75038637-75038659 CAGTAAAGATGGTCAGAAAAAGG + Intergenic
1010529383 6:76948396-76948418 TAGAAATGATGGTGAGGATGCGG + Intergenic
1011987002 6:93459804-93459826 CAGTAACAATAGGGAGGAGGTGG - Intergenic
1012359404 6:98358662-98358684 CAGCAAGGATGGTGGGAAGGAGG + Intergenic
1013580021 6:111524493-111524515 AAGCAGAGATGGGGAGGAGGTGG - Intergenic
1014223987 6:118826930-118826952 AAATACAAATGGTGAGGAGGAGG - Intronic
1015718258 6:136214128-136214150 CAGTAATGATGATGAAGAAGAGG + Intergenic
1016758304 6:147710965-147710987 AAGGAAAGAAGGTGGGGAGGAGG + Intronic
1016767292 6:147809346-147809368 CATTTAAGCTGGGGAGGAGGTGG - Intergenic
1016912598 6:149214158-149214180 CAGTGAAGATGGAGAAGAGCAGG - Intergenic
1018613140 6:165662464-165662486 AAAGAAAGATGGAGAGGAGGAGG + Intronic
1019517423 7:1446184-1446206 GAGTGAAGAGGGAGAGGAGGGGG + Intronic
1019517480 7:1446328-1446350 GAGTGAAGAGGGAGAGGAGGGGG + Intronic
1019517519 7:1446434-1446456 GAGTGAAGAGGGAGAGGAGGGGG + Intronic
1022160453 7:27705420-27705442 CATCGAAGATGATGAGGAGGAGG - Intergenic
1022174478 7:27860492-27860514 CAGTGAGGAGGATGAGGAGGAGG - Intronic
1022190260 7:28010534-28010556 CAGAAAAGCAGGTGAGGACGAGG - Intronic
1022837061 7:34128247-34128269 TAGGAAAGATTTTGAGGAGGTGG - Intronic
1023045169 7:36204407-36204429 CAGCAATGATGATGAGGAGGAGG + Intronic
1023398966 7:39777850-39777872 CAGTGAAGATGTGGAGGAGTTGG - Intergenic
1023516004 7:41002375-41002397 CAGTAAATATGGTGGAGAAGAGG + Intergenic
1024313877 7:47995218-47995240 GAAGAAAGATGGTGAGGTGGTGG + Intronic
1024445481 7:49473386-49473408 AAGTAAATATGGTGGGGAAGAGG + Intergenic
1024520030 7:50297427-50297449 AAGTAAAGGTGTTAAGGAGGTGG + Intergenic
1024599030 7:50963333-50963355 CAGCAAAGATGAGGAGGAGGAGG - Intergenic
1024651475 7:51406840-51406862 CAGTGAAGATGTGGAGGAGTTGG + Intergenic
1024982190 7:55166833-55166855 CAGTGTTGGTGGTGAGGAGGTGG + Intronic
1025041164 7:55646924-55646946 CAGTAAGGAGGCTGAAGAGGAGG + Intergenic
1025133680 7:56392650-56392672 CAGTGAAGATGTGGAGGAGTTGG + Intergenic
1026483216 7:70796584-70796606 CAGTCAGGAGGCTGAGGAGGAGG - Intergenic
1026887080 7:73956971-73956993 TTGTAAAGATGGGGAGCAGGGGG - Intergenic
1027043546 7:74976561-74976583 TTGTGATGATGGTGAGGAGGAGG - Intronic
1027226309 7:76246044-76246066 CAGAGAACATGGTGAGGGGGAGG - Intronic
1027234363 7:76289273-76289295 CAAGAAAGAGGGGGAGGAGGAGG - Intergenic
1027306339 7:76901843-76901865 CACTAAAAATGGAGAGGAGGAGG + Intergenic
1027658000 7:80955227-80955249 AAGTAAAGATTGTGGGGAGTTGG - Intergenic
1029936533 7:104430833-104430855 CTGCAAAGATGGGGTGGAGGAGG - Intronic
1030516749 7:110548576-110548598 CAGTAAGAATGGAGAGCAGGAGG - Intergenic
1032525951 7:132578119-132578141 CAGTGAAGATGGGGAGTGGGTGG + Intronic
1032688236 7:134257289-134257311 CAGCAAATATGGTGGGGATGAGG + Intronic
1032791331 7:135245348-135245370 CAGGAAGGATGCTGAGGAGGAGG + Intronic
1033032822 7:137844284-137844306 GAGGAAAGATGGTGAAAAGGAGG - Intronic
1033409765 7:141106704-141106726 GAGTGAAGATGGTGATGATGGGG - Intronic
1033588938 7:142794960-142794982 CAGTAAAGAGTCTGAGAAGGTGG + Intergenic
1033595883 7:142857329-142857351 CAGGACAGACAGTGAGGAGGTGG - Intronic
1033927498 7:146481553-146481575 CAATGATGATGATGAGGAGGTGG - Intronic
1034606226 7:152318440-152318462 TAGTAGAGATGGGGAGGGGGTGG - Intronic
1035041784 7:155934263-155934285 CAGTGATGATGATGAGGAGGAGG - Intergenic
1035041789 7:155934315-155934337 CAGTGATGATGAGGAGGAGGAGG - Intergenic
1035041809 7:155934452-155934474 CAGTGACGATGAGGAGGAGGAGG - Intergenic
1035041813 7:155934481-155934503 CAGTGATGATGAGGAGGAGGAGG - Intergenic
1035041829 7:155934606-155934628 CAGTGATGATGATGAGGAGGAGG - Intergenic
1035063908 7:156091673-156091695 CAAGAAAGCTGGTGAGGACGGGG + Intergenic
1035816993 8:2551806-2551828 CAGTAGTGATGGTGGGTAGGGGG + Intergenic
1036178048 8:6557967-6557989 CAGTCAAGATGAGGAAGAGGGGG - Intronic
1037351113 8:17957586-17957608 AGGTGAAGATGATGAGGAGGAGG + Exonic
1037701183 8:21275098-21275120 CAGGAAATATAATGAGGAGGGGG - Intergenic
1038048180 8:23784858-23784880 CAGTCAAGAGGATGAGAAGGAGG + Intergenic
1038324350 8:26561325-26561347 AGGTAAAGATGGAGAGGAGAGGG - Intronic
1039255794 8:35717756-35717778 TGTTAAAGATGGTGAAGAGGTGG + Intronic
1041126532 8:54646294-54646316 CAGAAAAGAGGGGGAGGGGGAGG - Intergenic
1041487187 8:58392189-58392211 CAGAGAAGATGGGGAGGAGTAGG - Intergenic
1041811430 8:61914707-61914729 GAATAAAGATGGTGAGGCTGAGG - Intergenic
1042220373 8:66467392-66467414 TAGTGAAGATGGTGGGGAGGGGG - Intronic
1043677910 8:82982879-82982901 CAGAAAGGATGCTGAGGAGATGG + Intergenic
1044217749 8:89632774-89632796 CAGTAAAGCTTGTGGGGTGGAGG - Intergenic
1044278638 8:90331106-90331128 CAGTGATGATGGTGAGGATGTGG - Intergenic
1044290478 8:90463082-90463104 CAGTGATGATGATGAGGAGGAGG - Intergenic
1045218544 8:100174379-100174401 CATTAAATAGGTTGAGGAGGAGG + Intronic
1045622551 8:103998021-103998043 CAGTGAACATTGGGAGGAGGGGG + Intronic
1045652133 8:104351133-104351155 CAGAGAAGATGGTGGGGATGGGG + Intronic
1047322239 8:123797486-123797508 CAGTAAATAGGCTGAAGAGGAGG - Intronic
1048304080 8:133271400-133271422 ATGAAAAGATGGTGGGGAGGGGG - Intronic
1049253722 8:141603069-141603091 CACTGAAAATGGTGAGGATGGGG - Intergenic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1049695859 8:143984020-143984042 CAGTACAGGTGGTGACCAGGAGG - Exonic
1049822299 8:144643121-144643143 CAGGAAGGCTGGTGGGGAGGGGG - Intergenic
1051752828 9:20361661-20361683 AAGAAAAAATGGGGAGGAGGTGG - Intronic
1053025012 9:34722217-34722239 CAGTAGAGAGGGTGAGAAGTGGG + Intergenic
1054957758 9:70932933-70932955 CAGAAGAGATGGTGAGAAGTAGG + Intronic
1055108223 9:72534381-72534403 CAGAAAAAGTGGTGGGGAGGTGG + Intronic
1055676933 9:78672848-78672870 AAGTAAAGATGTCAAGGAGGTGG - Intergenic
1056090852 9:83204160-83204182 AAGTATGGATGGTGAGGAAGAGG + Intergenic
1056469314 9:86889993-86890015 CAGTATAAATTGTGGGGAGGTGG - Intergenic
1057723080 9:97548460-97548482 CAGGAGAGAAGGTGAGGACGAGG + Intronic
1058955307 9:109941368-109941390 CAGAAATGGTGGTGAGGAGATGG + Intronic
1059365819 9:113785772-113785794 CAGCTATGATGGTGAGGAGGAGG + Intergenic
1059627526 9:116083357-116083379 CATTAAAAATGGTGAAAAGGAGG + Intergenic
1059747432 9:117216855-117216877 CAGTAAAGGTGTTAAGGAGAGGG - Intronic
1059914325 9:119082121-119082143 CAGCAAAGATGAAGAGGGGGTGG + Intergenic
1060668375 9:125447231-125447253 GAGTGAAGCAGGTGAGGAGGAGG + Intronic
1060739937 9:126091395-126091417 CAGTAAAGGTGCTGAGGACTTGG + Intergenic
1061257321 9:129460355-129460377 GGGGAAAGATGGAGAGGAGGAGG - Intergenic
1061374786 9:130217435-130217457 CAGCAGAGAAGGTGGGGAGGTGG + Intronic
1062012767 9:134275822-134275844 CAGAAAAGATGGGGAGGGGAGGG + Intergenic
1187291140 X:17954384-17954406 CAATAAACATGGTGTGGTGGGGG - Intergenic
1188449037 X:30289696-30289718 CTGTTATGATGTTGAGGAGGAGG - Intergenic
1188458545 X:30395509-30395531 CAATAAAGAGGATGAGGAAGAGG + Intergenic
1188465058 X:30470367-30470389 CAGTAGAAATGGTGAGTAGTGGG - Intergenic
1190283176 X:48944655-48944677 TAGGAAAGGTGGTGAAGAGGGGG + Intronic
1190432065 X:50387735-50387757 CAGGAAAGAGAGAGAGGAGGAGG - Intronic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1192088580 X:68127903-68127925 CAGCAAAGGTGGTGAGGAACTGG + Intronic
1192163193 X:68803982-68804004 CAGTGAGAATGGAGAGGAGGGGG + Intergenic
1192188364 X:68973546-68973568 CAGTAAAGTTGGGGAGGGGGCGG + Intergenic
1192359371 X:70429419-70429441 GAGTGAAGATAGTGAGGATGGGG + Intronic
1194978165 X:100413375-100413397 CTCTAAAGAGGCTGAGGAGGCGG - Intergenic
1195410489 X:104564609-104564631 CAGTAAAGTAGGTGCGGAGGGGG + Intergenic
1195791592 X:108594105-108594127 CAGCAACTATGGGGAGGAGGTGG - Intronic
1196018487 X:110964803-110964825 AAGGCAAGATGGGGAGGAGGGGG + Intronic
1196714026 X:118794017-118794039 CAGTAAAAATGGCTAGGGGGAGG - Exonic
1197146163 X:123175023-123175045 CAATGATGATGATGAGGAGGAGG - Intergenic
1197705937 X:129634515-129634537 CAGGGAAGAGGCTGAGGAGGAGG + Intergenic
1197770663 X:130087136-130087158 CACTAGAGATGGTGATGTGGTGG - Intronic
1197902779 X:131392147-131392169 CAGGAAAGAGAGTGGGGAGGGGG - Intronic
1198372520 X:136004702-136004724 CAATAAATATGGTGGGGAGGGGG - Intronic
1198936544 X:141906120-141906142 CAGTAAAGTGGAGGAGGAGGAGG - Exonic
1198959978 X:142173807-142173829 CAGAGAAGAGGATGAGGAGGAGG + Intergenic
1199784519 X:151092353-151092375 GAGCAATGATGGTGAGGTGGTGG + Intergenic