ID: 1114478817

View in Genome Browser
Species Human (GRCh38)
Location 14:23018087-23018109
Sequence CCTTATAAGAAGAGGGAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2887
Summary {0: 2, 1: 100, 2: 425, 3: 893, 4: 1467}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114478813_1114478817 -7 Left 1114478813 14:23018071-23018093 CCAGTCTGACTGGTGTCCTTATA 0: 8
1: 152
2: 663
3: 1499
4: 2121
Right 1114478817 14:23018087-23018109 CCTTATAAGAAGAGGGAATTTGG 0: 2
1: 100
2: 425
3: 893
4: 1467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114478817 Original CRISPR CCTTATAAGAAGAGGGAATT TGG Intronic
Too many off-targets to display for this crispr