ID: 1114481089

View in Genome Browser
Species Human (GRCh38)
Location 14:23034948-23034970
Sequence AATAGGAAGTGAAGCTGTGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 290}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114481089_1114481092 -5 Left 1114481089 14:23034948-23034970 CCGTCACAGCTTCACTTCCTATT 0: 1
1: 0
2: 2
3: 30
4: 290
Right 1114481092 14:23034966-23034988 CTATTAAATCTATTCCGGAATGG 0: 1
1: 0
2: 0
3: 11
4: 70
1114481089_1114481094 13 Left 1114481089 14:23034948-23034970 CCGTCACAGCTTCACTTCCTATT 0: 1
1: 0
2: 2
3: 30
4: 290
Right 1114481094 14:23034984-23035006 AATGGAGCCATTTTGACTGCTGG 0: 1
1: 0
2: 2
3: 11
4: 128
1114481089_1114481090 -10 Left 1114481089 14:23034948-23034970 CCGTCACAGCTTCACTTCCTATT 0: 1
1: 0
2: 2
3: 30
4: 290
Right 1114481090 14:23034961-23034983 ACTTCCTATTAAATCTATTCCGG 0: 1
1: 0
2: 0
3: 17
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114481089 Original CRISPR AATAGGAAGTGAAGCTGTGA CGG (reversed) Exonic
900570379 1:3355369-3355391 AATGGAAAGAGAAGCTGTGTTGG - Intronic
900721558 1:4179240-4179262 AATAGCAAGTGTGGCTGTGCTGG + Intergenic
902126825 1:14221139-14221161 AAAAGGAAGTGAATTAGTGAAGG - Intergenic
902827784 1:18988920-18988942 ATGAGGAAGTGAAGATGAGAAGG - Intergenic
904048581 1:27624128-27624150 AATGGGAAGAGAAGCACTGAGGG - Intronic
904589949 1:31607581-31607603 AGTAGGTAGTGAGGCTGTGACGG + Intergenic
904928115 1:34064123-34064145 AATGGGAGGTGCCGCTGTGAAGG + Intronic
905292685 1:36933512-36933534 AATAGGAAAAGCAGATGTGATGG - Intronic
905303587 1:37002394-37002416 AATATGAAGTAAAGGTGCGATGG + Intronic
905359725 1:37411039-37411061 GGTAGGAAGTGAAGCTGGGCAGG - Intergenic
906521903 1:46472176-46472198 AATAGGGAGAGACTCTGTGAAGG + Intergenic
908727936 1:67197022-67197044 AATAGCAGGTGAAGCTGAGAAGG + Intronic
912691964 1:111811453-111811475 AATACGCAGAAAAGCTGTGAGGG + Intronic
915911090 1:159915994-159916016 AGCAAGAAGTGAAGCTGTCAAGG - Intergenic
917991713 1:180387321-180387343 AATAGGGAGTGATGGTGTGGGGG - Intronic
918008306 1:180562667-180562689 AATATGAAGTGAGGCTGTCAAGG + Intergenic
918073346 1:181150144-181150166 AATGGGAACTGAAGCTGGGAGGG - Intergenic
918095308 1:181329452-181329474 AGTAGGCATTGAAGCTGTGGTGG - Intergenic
918118035 1:181513864-181513886 ACTAAGAAGGGAAGATGTGAGGG - Intronic
919518478 1:198556839-198556861 TATTGGAAGTGAAGATGGGATGG + Intergenic
919773079 1:201175375-201175397 AATAGGAACAGAAGCTGAAAGGG - Intergenic
921710641 1:218369764-218369786 AATAGAAAGTCAAGCTTGGAAGG + Intronic
921939245 1:220823115-220823137 GAAAGGGAGTGAAGCTCTGAAGG + Intergenic
922155315 1:223036473-223036495 AAAAGGAAGTAAAGCAGTAAAGG + Intergenic
922210693 1:223484208-223484230 ACTAGGAAGTGTACATGTGAAGG + Intergenic
923403992 1:233642649-233642671 CATGGGAAGTGATGCTGTGGGGG + Intronic
923649309 1:235858736-235858758 GATTGGAAGGGAAGATGTGATGG - Intronic
923889464 1:238196259-238196281 AATAGGAGGAAAAGCTGGGAAGG + Intergenic
924546494 1:245032721-245032743 ATTAGGAAATGAATCTGTAAAGG + Intronic
1066432806 10:35368865-35368887 CAGAGGAAGTGAGGCTGGGAGGG + Intronic
1066574217 10:36807679-36807701 AAGAGTAAGTGGAGGTGTGATGG - Intergenic
1066986420 10:42472054-42472076 AACAGGCAGTGAAGATGTGGGGG - Intergenic
1068560629 10:58511601-58511623 AACAGGAATTGACCCTGTGATGG - Intergenic
1069332940 10:67315018-67315040 AATAGCAAGGGAATCTGAGAAGG - Intronic
1070537030 10:77386910-77386932 AATAGAAGGTGAGGCTATGATGG + Intronic
1072425826 10:95329702-95329724 AATAGAAAAGGAAGCTGTGATGG - Intronic
1073006219 10:100327055-100327077 AAAAGGAAGTGAGCCTCTGAGGG + Intronic
1074140541 10:110668317-110668339 CAAAGTAAGTGAAGCTGAGATGG - Intronic
1074390763 10:113056374-113056396 AATTGGAAGTGGGGCAGTGAGGG + Intronic
1074742707 10:116500365-116500387 AATAGGAAGGGGAGCTATGGGGG + Intergenic
1075621206 10:123929561-123929583 AAAAGGAAGTGAAACAGCGAGGG - Intronic
1075807223 10:125198362-125198384 AATTGGAAGTGAGGTTCTGAGGG + Intergenic
1076946590 10:133655974-133655996 AATGTGAAATGAAGATGTGATGG + Intergenic
1078598740 11:12712379-12712401 GATAGCAGGTGAAGCTGTGTAGG - Intronic
1078657379 11:13254243-13254265 AAAAGGAAGAAAAACTGTGAAGG - Intergenic
1079691123 11:23418243-23418265 AACAAGAAATGAAGCTGTCAGGG - Intergenic
1084879385 11:72159340-72159362 ATTTGGAAGTGAAGGTGTGTGGG + Intergenic
1085070228 11:73537224-73537246 AGTAGGAAGTGAGGCTGAAAAGG + Intronic
1085728382 11:78975139-78975161 AAGAGGGAGAAAAGCTGTGAGGG + Intronic
1085854860 11:80164642-80164664 AGAAGGCAGTGCAGCTGTGAAGG - Intergenic
1085947012 11:81284465-81284487 AATAGGATGGGAAGCTGGAAAGG - Intergenic
1086775176 11:90821983-90822005 AATAAGAAGAGAATCTGAGAAGG - Intergenic
1086994648 11:93342195-93342217 AATAGGAAGTGAAACAGGGAAGG + Intronic
1087195055 11:95296936-95296958 AATAGGAAGTGAAAGTGTGAGGG - Intergenic
1088142579 11:106635097-106635119 ACTAGAAAGTAAAACTGTGAGGG + Intergenic
1089511022 11:118997374-118997396 AACAGGAAGTGAAGATCTGAAGG + Intergenic
1091976238 12:4827822-4827844 AGTAGGAAGGAAAGCTGAGAGGG - Intronic
1093184931 12:16008791-16008813 AATAGGAAGAAAAGCAATGAAGG + Intronic
1093237460 12:16628960-16628982 CATAGGAAGAGAAGTTTTGAAGG - Intergenic
1094074790 12:26460581-26460603 AATAGGGAAGGAAGCTGAGAAGG + Intronic
1095430874 12:42133404-42133426 AATAGGATGTGGAGCTCTTAAGG - Intronic
1096873892 12:54612313-54612335 GGTAGGAAATGAGGCTGTGAAGG - Intergenic
1097778002 12:63669585-63669607 GATGGGAAGTGAAGCGGTGTGGG - Intergenic
1097907747 12:64937987-64938009 AATAAGAGGTTATGCTGTGATGG + Intergenic
1098503171 12:71218004-71218026 CATAGCAAGTGAAGATGTGAGGG - Intronic
1098794122 12:74866668-74866690 AATAGGAAGTTAAGAGGTCAGGG - Intergenic
1099146773 12:79056228-79056250 AAGAGGAAGGGAAAGTGTGAGGG + Intronic
1099163536 12:79274588-79274610 TAAAGGAGGTGAAGCTGTGTGGG - Intronic
1102844086 12:116159784-116159806 AAAAGCAAGAGAAGCTGTTATGG - Intronic
1103152026 12:118649114-118649136 ATTAGGAGGAGAAGCTGGGAGGG + Intergenic
1105014901 12:132780593-132780615 AAATGGCAGTGCAGCTGTGAGGG - Intronic
1105592071 13:21801475-21801497 AAGATGAAGTGTGGCTGTGAGGG + Intergenic
1106596724 13:31148418-31148440 AAAAGGAACTGCATCTGTGACGG + Exonic
1107151550 13:37117396-37117418 AATGAGAAGTGTAGCTTTGAAGG + Intergenic
1108716363 13:53081994-53082016 AATAGGATATGAAGCTAGGAAGG + Intergenic
1108741138 13:53339494-53339516 AGTAGGCAGTGAAGCTGAGGAGG - Intergenic
1108887728 13:55208968-55208990 AATATCAACTTAAGCTGTGATGG + Intergenic
1111916631 13:94367763-94367785 AGTAGGAAGTGAATCTTTGAAGG - Intronic
1113341826 13:109433033-109433055 GATGGGAAGGGATGCTGTGAAGG + Intergenic
1114481089 14:23034948-23034970 AATAGGAAGTGAAGCTGTGACGG - Exonic
1114978877 14:28136672-28136694 GAAAGGAAGTGAAGTTCTGATGG - Intergenic
1115326152 14:32141398-32141420 GATGGGAAATGAAGCTGTAAAGG - Intronic
1115402478 14:32978095-32978117 ATGAGGAAGTGAAGATGTGGGGG + Intronic
1115862951 14:37710208-37710230 AAGAGATAGTGAAGCTGTGATGG + Intronic
1116178377 14:41503768-41503790 AGTAGGACATGAGGCTGTGAAGG + Intergenic
1118910029 14:70054086-70054108 AACAGGAAGAGAGGCTGGGAGGG + Intronic
1119939601 14:78626188-78626210 AAAGGGAAGTGAATCTGAGAAGG - Intronic
1120368440 14:83601278-83601300 AATAGGAAGAAAAACTGAGAAGG - Intergenic
1121140779 14:91539620-91539642 AATAGGAGGGGCTGCTGTGAAGG + Intergenic
1121825930 14:97009411-97009433 GCTTGGAAGTGAAGTTGTGAAGG + Intergenic
1122425643 14:101603676-101603698 AAATGGAAGGGAAACTGTGAGGG + Intergenic
1202834289 14_GL000009v2_random:66164-66186 ACTAGGAGGTGGAGCTGTGTTGG + Intergenic
1202920696 14_KI270723v1_random:28596-28618 AATGTGAAATGAAGATGTGATGG + Intergenic
1202924237 14_KI270724v1_random:9053-9075 AATGTGAAATGAAGATGTGATGG - Intergenic
1124511343 15:30328999-30329021 AATTGCAAGGGAAGCTGGGAAGG - Intergenic
1124731571 15:32201765-32201787 AATTGCAAGGGAAGCTGGGAAGG + Intergenic
1125605036 15:40935330-40935352 AATAGGAATGGAAGCTATGCAGG - Intronic
1127316391 15:57798076-57798098 AATAGAATGTTATGCTGTGAGGG - Intergenic
1127885106 15:63192007-63192029 AATAGGAAGTGAACATGAAAAGG + Intronic
1129120871 15:73395763-73395785 ATTAGGAACTGAAGCTGTGAGGG - Intergenic
1129826187 15:78636584-78636606 AACAGGAAGTGAGACAGTGAAGG - Intronic
1130553739 15:84908668-84908690 AACAGGCAGTGAGGCTGGGAAGG - Intronic
1131690104 15:94817535-94817557 AATGTGAAGGGAAGATGTGAAGG + Intergenic
1131898738 15:97064310-97064332 AATTAGATGTGAAGATGTGAAGG + Intergenic
1132779851 16:1617147-1617169 AATAATAAGCTAAGCTGTGATGG + Intronic
1133922853 16:10169553-10169575 GCTAGGAGGTGAAGGTGTGATGG + Intronic
1137037876 16:35581583-35581605 AATAGAAAATGAAACTGTCATGG + Intergenic
1137422801 16:48350399-48350421 AATAGTAATGAAAGCTGTGAGGG + Intronic
1137846768 16:51697618-51697640 AATAGGAAGTGAGCCAGGGAAGG - Intergenic
1138056444 16:53838882-53838904 AATATGTACTGAACCTGTGAGGG + Intronic
1138919009 16:61503922-61503944 AATAGCTAGTGAATCTTTGAGGG + Intergenic
1139776868 16:69321857-69321879 GACAGGAGGTGAAGGTGTGAGGG + Intronic
1143071492 17:4298661-4298683 AATAGGAAAAAAAGCTGTAAAGG + Intronic
1144193814 17:12871430-12871452 TATAGGAAGTGTGGCTGGGAAGG + Intronic
1144347331 17:14360876-14360898 GATAGGAAGTGAATCTTTGCAGG - Intergenic
1144909175 17:18666766-18666788 TAGAGGAAGTGAAGTTCTGATGG - Intronic
1145268102 17:21390157-21390179 CATGGGGAGGGAAGCTGTGAGGG - Intronic
1146430062 17:32784740-32784762 AGTAGGAAGTCAAGATGAGAGGG + Intronic
1146636911 17:34513330-34513352 AAGACGGAGGGAAGCTGTGAGGG + Intergenic
1147634380 17:41954309-41954331 AAAATGAAATGAAGCTCTGAGGG + Intronic
1148281728 17:46353493-46353515 AATAGAGGGTGAAGATGTGAAGG - Intronic
1148303953 17:46571432-46571454 AATAGAGGGTGAAGATGTGAAGG - Intronic
1148909708 17:50934866-50934888 AAGAGGCAGGGAAGCTGTTATGG - Intergenic
1149775641 17:59354825-59354847 AATTCGAAGGGAAGCTGAGAAGG - Intronic
1150181810 17:63130110-63130132 AATAAGAAATAAAGCTGGGAAGG + Intronic
1150507137 17:65710675-65710697 AAGAGGAACTGAAGATATGAAGG + Intronic
1151179777 17:72318792-72318814 AATAGAAGGTGAAGCAGAGATGG + Intergenic
1152402484 17:80075934-80075956 AATGAGAAGTGGAGCTGAGATGG + Intronic
1153011512 18:543888-543910 CTTATGGAGTGAAGCTGTGACGG + Intergenic
1156060875 18:33074640-33074662 AATAGGAAGTCATGGTGTCATGG + Intronic
1156068773 18:33178179-33178201 AAGAGGAAGAGCACCTGTGACGG - Intronic
1158613059 18:58960838-58960860 TATAGGAAGAGAAGCTAGGAGGG + Intronic
1159163153 18:64670370-64670392 AGTAGGAAGGGAAGGAGTGAGGG + Intergenic
1159573734 18:70149851-70149873 GAAATGAAGAGAAGCTGTGAAGG - Intronic
1159625059 18:70683210-70683232 AATTGGAGGTGAGGCTATGAAGG + Intergenic
1159693790 18:71527393-71527415 AATAGGAATTGAATTTATGATGG - Intergenic
1160361092 18:78279795-78279817 ATTAGGCATTGAAGGTGTGAGGG - Intergenic
1161220454 19:3115856-3115878 CATAGGGACTGAGGCTGTGAGGG + Intronic
1164511581 19:28901470-28901492 AATAGCAAGTTAAACTTTGATGG + Intergenic
1165286185 19:34844339-34844361 AATAGGAAGGCAAGCAGTGGGGG + Intergenic
1165608289 19:37126387-37126409 AATAAGGAGCGAAGCTGAGAAGG + Intronic
1166768323 19:45265519-45265541 AAGAGGACGTGCAGGTGTGAGGG + Intronic
1166886362 19:45963388-45963410 ATGAGGAAGTGAAGCTGGAAAGG - Intronic
1166908391 19:46132556-46132578 AAGAGAAAGTGAAGTGGTGAGGG + Intergenic
1167822495 19:51941322-51941344 AACAGGTAGTGATGCTCTGATGG - Intronic
1202638394 1_KI270706v1_random:61528-61550 ACTAGGAGGTGGAGCTGTGTTGG - Intergenic
929365083 2:41144525-41144547 ATTAGGAAGTGAAAGTGTTATGG - Intergenic
930213835 2:48672318-48672340 ACTAGGAAGTGAAGCTGGGTGGG + Intronic
931044670 2:58337850-58337872 TATAGTAAGTAAAGTTGTGAGGG - Intergenic
931796681 2:65717469-65717491 AATAGGAAAGGAAACTTTGAAGG - Intergenic
933738938 2:85517732-85517754 AAAAGAAAATGAAGCTGTGGAGG + Intergenic
933741188 2:85535518-85535540 AAGAGCAAGTGAAGGTGTGGAGG - Intergenic
933951947 2:87338520-87338542 AGGAGGAAGAGAAGCTGTGCTGG - Intergenic
935461852 2:103345751-103345773 AAAAGGAAGGGCAGCTGAGAAGG - Intergenic
936961605 2:118080861-118080883 AATAGGAATTAAAGCGGTTAGGG - Intergenic
939725595 2:145717645-145717667 AATATGAAATGAAGTTTTGAGGG + Intergenic
940866597 2:158823589-158823611 AGTAGGATGTGAAGATGAGAAGG + Intronic
941667488 2:168257050-168257072 AAAAAGAAGTAAACCTGTGATGG + Intergenic
944105287 2:196073045-196073067 AACACAAAGTGAAGCAGTGAGGG + Intergenic
946296401 2:218787137-218787159 ATTGGGCTGTGAAGCTGTGAGGG + Intronic
946363440 2:219233670-219233692 AATAGCAAGTGAAGGTATGCAGG + Intronic
946426930 2:219603941-219603963 AATAGGAAGGGGAACTGTGAGGG + Intronic
946519154 2:220446773-220446795 AAAAGGAAGTGAAGAAGGGAGGG - Intergenic
946577026 2:221086745-221086767 AATAGGAGGGGCTGCTGTGAAGG + Intergenic
946937386 2:224736316-224736338 AATGGGAAGGGTTGCTGTGAAGG - Intergenic
947798673 2:232912037-232912059 AATAGGAATGGGAGCAGTGAAGG + Intronic
1169820529 20:9704718-9704740 GATAGGAAATGAAGCAGGGAAGG + Intronic
1170387885 20:15840289-15840311 CATGGGAAGTGAAGATGTGGTGG - Intronic
1173014548 20:39213207-39213229 AACAGGAAATGAAGCTGTTATGG - Intergenic
1173265352 20:41474303-41474325 AATAAGAAATGAAACTGTTAAGG + Intronic
1174770868 20:53298915-53298937 AATATGAAGTGCCTCTGTGAAGG + Intronic
1177648492 21:23930780-23930802 AAAGGGAAATGAAGCAGTGAAGG + Intergenic
1177986992 21:27988786-27988808 AAATGGAAGTGAATGTGTGAAGG + Intergenic
1179925887 21:44533832-44533854 AACAGGAAGTGCAGCTGGGCAGG + Exonic
1180363571 22:11920360-11920382 ACTAGGAGGTGGAGCTGTGTTGG + Intergenic
1183056356 22:35308728-35308750 GGTAAGAAGTGAGGCTGTGAAGG - Intronic
1184274573 22:43403002-43403024 AAGAGGAGGTCAAGGTGTGAGGG - Intergenic
951082632 3:18469704-18469726 AATAGGAAGTGATGAGTTGAGGG - Intergenic
951461117 3:22952922-22952944 AGTAGGAAGGGATGCTGGGAAGG - Intergenic
953273873 3:41475899-41475921 AAGAGGAAGGGAAGGAGTGAGGG + Intronic
953537924 3:43790013-43790035 TAGAGGAAGTGAAGCAGGGAAGG + Intergenic
955809539 3:62772313-62772335 AATAGCAAGCGAAACTGGGAAGG - Intronic
957080881 3:75634503-75634525 AATGTGAAATGAAGATGTGATGG - Intergenic
957340764 3:78893219-78893241 ATTAAGAAGCGAAGCTGTTATGG + Intronic
958193710 3:90215703-90215725 AATAGCTAAAGAAGCTGTGATGG - Intergenic
958417011 3:93886443-93886465 AATAGCTAAAGAAGCTGTGATGG - Exonic
959502204 3:107119275-107119297 AAGGGGAAGTCAAGCTGTGAAGG + Intergenic
959689865 3:109187327-109187349 AAAAAGAACTGAGGCTGTGATGG + Intergenic
960105746 3:113794733-113794755 AAGAGGAAGAGCAGCTTTGAGGG + Intronic
960931791 3:122859104-122859126 AATAGAAAGTGGAGGTGGGATGG + Intronic
962366990 3:134793427-134793449 AAAAGCAAGTGAAGCTGCCAAGG + Intronic
962819510 3:139034519-139034541 AATAGAAGGGGAAACTGTGAGGG - Intronic
964913985 3:161817294-161817316 GATAGGAAATGAAGAAGTGAAGG - Intergenic
965305955 3:167063308-167063330 TATAGGAAGGGAAGTTGTGTGGG - Intergenic
965958953 3:174405994-174406016 AATAGTAATTGCAGCTGTGTAGG + Intergenic
967852667 3:194093904-194093926 AAGAGGAAATGAGGCTGAGAAGG + Intergenic
968001237 3:195208254-195208276 ACTAGAAAGTGAAGTTGTGAGGG + Intronic
968242499 3:197103236-197103258 AATATTAAGTGAAGTTGTGTGGG + Intronic
968715451 4:2155446-2155468 AAGAGGAAGAGAGGCTGGGATGG - Intronic
970743582 4:19267149-19267171 AAAAGGAAGTGAGGCTGAGAAGG - Intergenic
971484542 4:27145980-27146002 CTTGGCAAGTGAAGCTGTGAGGG - Intergenic
971835719 4:31760426-31760448 AAAAAGAAATGAAGCTATGAAGG + Intergenic
972425332 4:38927495-38927517 AATAGGAGGTGAGGCTTTGGGGG - Intronic
972630779 4:40840045-40840067 AATAGAAAGATAAGCTGGGAGGG - Intronic
973368629 4:49227871-49227893 ACTAGGAGGTGGAGCTGTGTTGG - Intergenic
973392420 4:49567554-49567576 ACTAGGAGGTGGAGCTGTGTTGG + Intergenic
974149202 4:57984061-57984083 AATGGTAAGTGAGACTGTGAAGG + Intergenic
974478620 4:62416780-62416802 AATAGGAAGTGAAGTTGTATTGG + Intergenic
975214930 4:71742480-71742502 CATAGGAACTGAGGCTGTGAGGG - Intronic
975276488 4:72507234-72507256 AAGAGGAAGGGAAGCTGGGCAGG - Intronic
975474795 4:74811341-74811363 AGTGGGAAGTCAGGCTGTGAAGG - Intergenic
975692587 4:76980412-76980434 GATAGGAAGTGGAACTGAGAAGG + Intronic
977257988 4:94761019-94761041 AATAGAAAGTGAGGCTAGGATGG + Intronic
978448379 4:108802747-108802769 CAGAGGAAGTGGAGCTGTGTGGG + Intergenic
978696167 4:111583313-111583335 AATAGGAAGAGAGGCTGGGATGG - Intergenic
978953110 4:114584997-114585019 AAGAGAAGGTGAAGATGTGATGG + Intergenic
980125887 4:128773775-128773797 AAAAGGAAGTAAAGATGGGAGGG + Intergenic
980283261 4:130750268-130750290 AATGGGATGTGAAAGTGTGAAGG - Intergenic
980707052 4:136511994-136512016 AATAGGAAGTGAAGCATTTAGGG + Intergenic
980788846 4:137592155-137592177 AAGAGGAAGTCAAGCTTTCATGG + Intergenic
982839222 4:160161013-160161035 AATAGTAGGGGAAACTGTGAGGG + Intergenic
983829556 4:172308273-172308295 AAAAGGAAGTGAAACTGTCATGG - Intronic
984090102 4:175362740-175362762 AAAATGAAGAGAAGCTGGGAGGG + Intergenic
984658302 4:182343893-182343915 AATAGAATGTGAAGCACTGAGGG + Intronic
984822075 4:183890768-183890790 AGTAGGAAGAGAAGCAGAGATGG + Intronic
985450006 4:190056635-190056657 AATGTGAAATGAAGATGTGATGG + Intergenic
1202765728 4_GL000008v2_random:147386-147408 ACTAGGAGGTGGAGCTGTGTTGG - Intergenic
986807880 5:11326105-11326127 AACAGGAATTGATGCTGGGAGGG - Intronic
986996018 5:13608254-13608276 AATTGGATGAGAACCTGTGAAGG - Intergenic
987663336 5:20905293-20905315 GATAGGAAGGGCTGCTGTGAAGG + Intergenic
988300910 5:29425137-29425159 AATAAAGAGTGAATCTGTGATGG - Intergenic
988759350 5:34296894-34296916 GATAGGAAGGGCTGCTGTGAAGG - Intergenic
990176697 5:53115870-53115892 AATAAGAACTGAGGCAGTGAAGG + Intergenic
991068488 5:62450718-62450740 AGTAGGAATTGAAAATGTGATGG - Intronic
992768818 5:80028232-80028254 AATAGGAAGTGGAGATGGTAAGG - Intronic
995027544 5:107441449-107441471 TGTAGGCAGTGAAGCTGTGCTGG + Intronic
996003283 5:118389116-118389138 AATAGTTAATGAAGCAGTGATGG - Intergenic
998145537 5:139725669-139725691 AGAAGGAAGAGAAGCAGTGAAGG - Intergenic
998364182 5:141618482-141618504 GAAAGGAAGTGAGGCTGAGAGGG + Intronic
999945463 5:156590805-156590827 AATAGGGAGAGAAGCACTGAAGG - Intronic
1000871613 5:166584085-166584107 AATAAGCAGAGAAGCTGTGGTGG - Intergenic
1001779643 5:174356841-174356863 AGAAGGAAGTGAGGATGTGAGGG + Intergenic
1002822642 6:740787-740809 AAAAGGAACTGCAGATGTGATGG - Intergenic
1003537068 6:6984716-6984738 AAAAGGAGATGAAGCTGAGAAGG + Intergenic
1005197243 6:23301781-23301803 AATAGGAAGTGAATTTGAAATGG + Intergenic
1005229568 6:23684619-23684641 AATGCGTAGTGAAGCTGTGGCGG - Intergenic
1005750151 6:28874742-28874764 AACAGGTAGTGAAGATGTGGGGG + Intergenic
1006609274 6:35283840-35283862 AATAGGAAAGGCAGCTGAGATGG - Intronic
1006790835 6:36700102-36700124 AAGAGAAAGTGAAGCTGGAAAGG + Intronic
1006814797 6:36842780-36842802 AAAAGGAAGTGATACTGAGATGG + Intergenic
1009004143 6:57761042-57761064 AATAAAGAGTGAATCTGTGATGG - Intergenic
1010040634 6:71378740-71378762 AATAGGAAGAGAAGTGGAGAAGG + Intergenic
1010273062 6:73936946-73936968 AATTGGCAGGGAAGCTGTCAAGG + Intergenic
1013173075 6:107654888-107654910 AAGAGGAATTGAGGCTCTGAGGG + Intronic
1013286199 6:108683906-108683928 TAGAGGAAGTGAAGTTCTGATGG + Exonic
1014266447 6:119283543-119283565 AAAAGGAAGTGAAGGTGGGGAGG + Intronic
1014425155 6:121295429-121295451 AATAGGAAGTGAAAAAGTAAAGG + Intronic
1017938144 6:159025193-159025215 AATAGGAAGGGCTGCTATGAAGG + Intergenic
1018217162 6:161539723-161539745 TAGAGGAAGTGATGATGTGAGGG - Intronic
1018358039 6:163038330-163038352 ATTTGGAACTGAAGATGTGAGGG + Intronic
1019388676 7:773300-773322 AAGAGGAAGGGACGCTGTGCAGG + Intronic
1020899836 7:13990648-13990670 ACTAGGACGTTAAGCAGTGAGGG + Intronic
1021288146 7:18808164-18808186 AAAAGCACGTGAAGCAGTGAAGG + Intronic
1021454155 7:20811246-20811268 ATAAGGTAGTGTAGCTGTGAGGG + Intergenic
1022508851 7:30922706-30922728 AACAGGAAGGGACACTGTGAGGG - Intronic
1022701429 7:32763480-32763502 GATGGGAAGTGAAGCGGTGTGGG - Intergenic
1024116823 7:46202182-46202204 AGGAGGAAGTGAAGAGGTGACGG - Intergenic
1024311169 7:47970450-47970472 AATAGTAAGAGAAACTGGGATGG + Intronic
1026095361 7:67342243-67342265 CATAGACAGAGAAGCTGTGAAGG + Intergenic
1026874238 7:73870483-73870505 AAAAAGAAGTGCAGCTGAGAAGG - Intergenic
1027145581 7:75691888-75691910 AATAGGGAGTGACTGTGTGATGG + Intronic
1027361310 7:77413341-77413363 AAAAGGAAGTGAAGTTGGGTAGG + Intronic
1028977157 7:96926858-96926880 AATAGGGTGTGATGCTGTCAGGG - Intergenic
1029211566 7:98912921-98912943 TATAGGAAGAGTAACTGTGAGGG + Intronic
1029491728 7:100874420-100874442 AATAGGAAGACCAGCTGAGATGG - Intergenic
1031100009 7:117468222-117468244 AATAGTAAGAGAAACTGGGAGGG - Intronic
1032323956 7:130909322-130909344 AAGAGGAAGCCCAGCTGTGAGGG - Intergenic
1032785524 7:135196826-135196848 AATTGGATGTGAAGCTGGGTGGG + Intronic
1032809553 7:135397754-135397776 AATAAGAAGGGAAACTGTTAGGG + Intronic
1033234120 7:139624665-139624687 GAAAGGAAGTGAAGATGGGAGGG - Intronic
1033721700 7:144066525-144066547 AAGAGGAAGTCAAACTGTCACGG + Intergenic
1034296535 7:149977734-149977756 ATTAGGAAATGTAGCTGTGATGG - Intergenic
1034809496 7:154119083-154119105 ATTAGGAAATGTAGCTGTGATGG + Intronic
1034926838 7:155129461-155129483 AGCAGGCAGTGAAGCGGTGAGGG + Intergenic
1035349009 7:158230495-158230517 AATAGGAAGTCAAAGTGTGGGGG + Intronic
1037180750 8:16003115-16003137 AACAGGAAGTGGACATGTGAAGG + Intergenic
1038311595 8:26449627-26449649 AAAAGGGAGAGAAGCTGAGAGGG + Intronic
1038672600 8:29594622-29594644 AAGAGGAAGTGAAAATGTCAAGG - Intergenic
1039975549 8:42361332-42361354 ATTCTGAAGTGAAGCTGGGATGG - Exonic
1040676509 8:49757184-49757206 AATAGGCAGGGAAACTGTAATGG - Intergenic
1043147308 8:76674343-76674365 AAGAGGAAGTGTTGCTGTAACGG - Intergenic
1046200385 8:110919900-110919922 AATAGGAAGTGTAGTAGTAAGGG + Intergenic
1047023496 8:120802927-120802949 AATAGGAATTGAAGCCCAGACGG + Intronic
1047054322 8:121147196-121147218 AAAAGGATGGGAAGCTGGGAAGG + Intergenic
1047345923 8:124028519-124028541 AATAGGAAGTGAAGGTGGGCGGG + Intronic
1047670085 8:127136598-127136620 AATAGGAAGTGAAGCTGAAGAGG - Intergenic
1048046545 8:130778304-130778326 AAAAGGTAGTTAGGCTGTGAAGG - Intergenic
1051226787 9:14907883-14907905 ATGAGGAAGTGAAGCTTTGAGGG + Intronic
1053393048 9:37750066-37750088 GATAGGAGATGAAGCTGGGAGGG + Intronic
1053809677 9:41839472-41839494 AATAGGAAGGGGAGCTGAAAAGG + Intergenic
1054620916 9:67347956-67347978 AATAGGAAGGGGAGCTGAAAAGG - Intergenic
1055259547 9:74416932-74416954 AAAAGGAAGAGAAGCTGTTCAGG + Intergenic
1055270979 9:74558197-74558219 AAAAGGAAGGGTAGCTCTGAGGG - Intronic
1056252428 9:84763349-84763371 AATAGGAAGAGAGTCAGTGAGGG - Intronic
1059214289 9:112546435-112546457 CATAGGAAGAGCAGCTGTGATGG - Intronic
1203546478 Un_KI270743v1:132276-132298 ACTAGGAGGTGGAGCTGTGTTGG - Intergenic
1186421868 X:9433006-9433028 AAGAGGAAGGGAAGATGGGAGGG + Intergenic
1189138029 X:38570053-38570075 AAATGGAAATGAAGCTCTGAAGG + Intronic
1191661963 X:63660792-63660814 ACAAGGAAGGGAAGTTGTGAGGG - Intronic
1191841951 X:65519485-65519507 GGGAGGGAGTGAAGCTGTGAAGG + Intronic
1192090583 X:68151763-68151785 ACAAGGAAGTAAAGATGTGAGGG - Intronic
1193272306 X:79543963-79543985 AATAGTTAGTGAAGCTGTCCTGG - Intergenic
1194585910 X:95734155-95734177 ATTTGGAAGAGAAGCTGTGTTGG - Intergenic
1194950016 X:100114610-100114632 AACAGGAAGTTAAAATGTGAGGG + Intergenic
1195134450 X:101890377-101890399 AACAGTAAGAGAAGTTGTGATGG + Intronic
1197014729 X:121609732-121609754 AACAGGAAGTGAAGGAGGGAAGG + Intergenic
1197111948 X:122786230-122786252 AAGAAGAAGAGAAGCTGAGAAGG - Intergenic
1197604817 X:128573332-128573354 AAAAGGAAGAGAATCTGTGAAGG - Intergenic
1198229986 X:134679831-134679853 AAAAGGAAGTGAATCTCTGAAGG - Intronic
1199111679 X:143942750-143942772 AATAAGAACAGCAGCTGTGAAGG - Intergenic
1199731514 X:150637610-150637632 AATAGGGAGTGCTGTTGTGAGGG + Intronic
1201530464 Y:14985534-14985556 AATAGGAAGGGGAGCTGTTAGGG - Intergenic
1202134293 Y:21645767-21645789 GACAAGAAGTGGAGCTGTGATGG - Intergenic