ID: 1114483249

View in Genome Browser
Species Human (GRCh38)
Location 14:23048048-23048070
Sequence CCCCGGCCCCGCGGAGCCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 437}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114483249_1114483259 8 Left 1114483249 14:23048048-23048070 CCAGCGGCTCCGCGGGGCCGGGG 0: 1
1: 0
2: 5
3: 46
4: 437
Right 1114483259 14:23048079-23048101 GGCTTCGCTGCCGGAGCCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 131
1114483249_1114483260 16 Left 1114483249 14:23048048-23048070 CCAGCGGCTCCGCGGGGCCGGGG 0: 1
1: 0
2: 5
3: 46
4: 437
Right 1114483260 14:23048087-23048109 TGCCGGAGCCCAGGGAGCTGAGG 0: 1
1: 0
2: 4
3: 142
4: 1561
1114483249_1114483265 29 Left 1114483249 14:23048048-23048070 CCAGCGGCTCCGCGGGGCCGGGG 0: 1
1: 0
2: 5
3: 46
4: 437
Right 1114483265 14:23048100-23048122 GGAGCTGAGGGAGCCGCAAGAGG 0: 1
1: 0
2: 0
3: 29
4: 292
1114483249_1114483255 -1 Left 1114483249 14:23048048-23048070 CCAGCGGCTCCGCGGGGCCGGGG 0: 1
1: 0
2: 5
3: 46
4: 437
Right 1114483255 14:23048070-23048092 GGCGCCGCCGGCTTCGCTGCCGG 0: 1
1: 0
2: 1
3: 13
4: 144
1114483249_1114483258 7 Left 1114483249 14:23048048-23048070 CCAGCGGCTCCGCGGGGCCGGGG 0: 1
1: 0
2: 5
3: 46
4: 437
Right 1114483258 14:23048078-23048100 CGGCTTCGCTGCCGGAGCCCAGG 0: 1
1: 0
2: 2
3: 8
4: 130
1114483249_1114483261 17 Left 1114483249 14:23048048-23048070 CCAGCGGCTCCGCGGGGCCGGGG 0: 1
1: 0
2: 5
3: 46
4: 437
Right 1114483261 14:23048088-23048110 GCCGGAGCCCAGGGAGCTGAGGG 0: 1
1: 1
2: 5
3: 77
4: 772

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114483249 Original CRISPR CCCCGGCCCCGCGGAGCCGC TGG (reversed) Exonic