ID: 1114490418

View in Genome Browser
Species Human (GRCh38)
Location 14:23097420-23097442
Sequence GGGAAGAATGGGTTTGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 430}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114490418 Original CRISPR GGGAAGAATGGGTTTGAAAA AGG Intronic
900737808 1:4310169-4310191 GGGAGGAAGGAGTTTCAAAAGGG - Intergenic
901121419 1:6897247-6897269 GGGAAGATGGGGGTGGAAAATGG + Intronic
901269029 1:7936046-7936068 TGGAAAAATGGGTTTGAACTGGG - Intronic
901460370 1:9387594-9387616 GGGAAGAATGGGGGTGAAGATGG + Intergenic
901988270 1:13092578-13092600 GGGAAGATAAGGTTTGAAAGGGG - Intergenic
901993542 1:13134189-13134211 GGGAAGATAAGGTTTGAAAGGGG + Intergenic
902520596 1:17013455-17013477 AGGAAGGCTGGGTTTGGAAATGG + Intergenic
902782527 1:18713767-18713789 GGGAAGACTGGATTTGCACAGGG + Intronic
904431232 1:30465833-30465855 GGGGAGAATGGGTGAGAAACGGG - Intergenic
906832511 1:49048059-49048081 GGGGAGAATGTCTGTGAAAATGG + Intronic
907225785 1:52944991-52945013 GGAAAGAATGAGTTACAAAAAGG - Intronic
907560873 1:55386177-55386199 GGGCCGAATGGGATTGAAACGGG + Intergenic
907573427 1:55504847-55504869 GGGAAGTAGAGGTTTGAAGAGGG + Intergenic
907752693 1:57278468-57278490 GGGAAGAAAGGGTTATAAAGCGG + Intronic
907936197 1:59044432-59044454 GTGAATAATGGGTTTTAAGAGGG - Intergenic
907992515 1:59596635-59596657 TGGAAGAATGTGTGTGAAACTGG + Intronic
908814633 1:68019211-68019233 AGGAAGAATAGGTTTGAAATAGG - Intergenic
910078951 1:83315816-83315838 GAGAAGAGAGAGTTTGAAAAAGG + Intergenic
910321467 1:85949873-85949895 GGAAAGAAAGGGTCTGAACAAGG - Intronic
910425512 1:87116635-87116657 GTGAAGAATGAGTTTGAATCAGG - Intronic
910928777 1:92422160-92422182 AGGAAGAATGGTTTGGAAGAGGG + Intergenic
911651540 1:100394426-100394448 AGGAAGAATAGGTGTTAAAAAGG - Intronic
911946584 1:104117303-104117325 TTGAACAATGGATTTGAAAAAGG - Intergenic
912237547 1:107867999-107868021 GGGTAGTATGGGGTTGAGAAGGG + Intronic
912468152 1:109888101-109888123 GGGAAGAATGGGCCAGAAACAGG + Intergenic
913125629 1:115785289-115785311 AGTAAGAATGGATTTTAAAAGGG + Intergenic
913489897 1:119369074-119369096 AGGAAGATTTGGTTTCAAAAAGG + Intronic
913579725 1:120214157-120214179 GGGTAGAATGGGGTAGAAAGGGG - Intergenic
913628449 1:120684231-120684253 GGGTAGAATGGGGTAGAAAGGGG + Intergenic
914341256 1:146762412-146762434 GGGATGAATGGGTTCCAACAAGG + Intergenic
914464181 1:147911312-147911334 GGGAGGAATAGTTTTGGAAAAGG - Intergenic
914561659 1:148825584-148825606 GGGTAGAATGGGGTAGAAAGGGG - Intronic
914611173 1:149304624-149304646 GGGTAGAATGGGGTAGAAAGGGG + Intergenic
916003530 1:160638635-160638657 AGGAAAAATGGGTCTGGAAATGG - Intronic
917030210 1:170682234-170682256 GGGGAGAAGGGGTTTGGAGAAGG - Intronic
917081410 1:171260161-171260183 AGGAAGAATGGGAGGGAAAAGGG + Intronic
917783942 1:178432157-178432179 GGGAGACATGGGTTTGAAACAGG - Intronic
918475339 1:184918336-184918358 GTGAAGAGTGGGTTTGAAAGGGG - Intronic
918731786 1:188006665-188006687 TGGAAGAACAGGTTTGAAACTGG + Intergenic
920831068 1:209466231-209466253 TGGGAGAATGGGTTTGGGAATGG + Intergenic
921854264 1:219964342-219964364 AGGAAGAATGTGTTTCAAAGAGG + Intergenic
922664166 1:227454732-227454754 GTGGAGAATGGATTTGAAAGGGG + Intergenic
923165093 1:231353345-231353367 GCGAAGAAAGTCTTTGAAAAAGG + Exonic
923251141 1:232180551-232180573 GGGAACAAAGGATTTGAAAAAGG - Intergenic
923434188 1:233953088-233953110 GGGAAGAATGAGCTCGAAATAGG + Intronic
923715015 1:236417743-236417765 GAGAAAAATGTGTTTGGAAAAGG + Intronic
924138799 1:241000286-241000308 AAGAAAAATGGGTTTCAAAAAGG + Intronic
1062784102 10:246829-246851 GCGCAGTATGGGTTGGAAAAAGG + Exonic
1063260387 10:4382241-4382263 GTAGAGAATGGGTTGGAAAACGG + Intergenic
1063812574 10:9729438-9729460 GGTAAGAATATTTTTGAAAATGG + Intergenic
1063822195 10:9849210-9849232 GGGAAGAATGGGGATGAAGCTGG + Intergenic
1064414520 10:15136779-15136801 GGGAATATTGGCTTTGAGAAAGG - Intronic
1065396001 10:25238698-25238720 ATCAAGAATGGGTTAGAAAATGG + Intronic
1068944856 10:62719664-62719686 GGGAAGAAAGTGTTTCAAAGAGG - Intergenic
1069077569 10:64053885-64053907 TGGAAGACTGGATGTGAAAAAGG - Intergenic
1069578001 10:69544461-69544483 AGGAAGAAGAGGATTGAAAAGGG + Intergenic
1070635109 10:78119306-78119328 GGGCAGAATGGGGGTGAAAAGGG - Intergenic
1071946638 10:90653281-90653303 GGAAAGAATGGATTGGAAGAAGG - Intergenic
1072485522 10:95850829-95850851 GGAAAGAATGGGAATGAAACTGG - Intronic
1073579160 10:104648338-104648360 GAGAAAAATGGGTGTGAAGAGGG - Intronic
1074242625 10:111654391-111654413 GGGAAGGCAGGGGTTGAAAAGGG - Intergenic
1074259523 10:111838051-111838073 AGGAACAATGGGTATGCAAATGG - Intergenic
1074766183 10:116701761-116701783 GGGAAGAGTGACTGTGAAAATGG + Intronic
1074921786 10:118021735-118021757 AGGAAGAGTGAGTTTCAAAAAGG - Intronic
1075299331 10:121307400-121307422 GGGAAGGATGGAGTGGAAAAGGG - Intergenic
1075975673 10:126691885-126691907 GGGCAGAGTGGTTTTGGAAAAGG + Intergenic
1076947405 10:133660622-133660644 TGGAAGAATGGCTTGGAAATGGG - Intergenic
1078186709 11:9058044-9058066 GGGAAGGATGTGTTTGAGAAGGG + Intronic
1078500330 11:11867854-11867876 GCCAAGAATTGCTTTGAAAATGG - Intronic
1078673163 11:13382964-13382986 GAGAAGAATGGATTATAAAATGG + Intronic
1078818256 11:14848879-14848901 AGGAAGAATCAGTATGAAAATGG + Intronic
1078914538 11:15766650-15766672 GGGAATAATGGGATAGAAGATGG + Intergenic
1078945955 11:16068993-16069015 GGCAAGAATGGATATGAAAGAGG - Intronic
1079168826 11:18072562-18072584 GGGAAGCATGTTTTTTAAAAAGG - Intronic
1079997224 11:27307042-27307064 GGAAAAAATGGTTTTGAAGATGG - Intergenic
1080385932 11:31811288-31811310 GTGATTAGTGGGTTTGAAAAGGG - Intronic
1080992570 11:37556773-37556795 GAGAATAATGGGTTTGAAGAAGG - Intergenic
1081000348 11:37662210-37662232 AGGAAAAATTGGTTTGAAATTGG - Intergenic
1081750517 11:45507814-45507836 GGGAAAGATGGGTTGGAAATGGG + Intergenic
1082841621 11:57694808-57694830 CAGAAGAAAGGGTTTAAAAAAGG - Intronic
1082976876 11:59081329-59081351 GGGAAGAAATGGGTAGAAAATGG - Intergenic
1083786083 11:64948309-64948331 AGCTAGAAAGGGTTTGAAAAGGG + Intronic
1083807261 11:65082157-65082179 GGGGAGAATGGTTTTGAGAAGGG - Intronic
1085513778 11:77100747-77100769 GGGTAGAATGGGCTGGAAAATGG - Intronic
1086158492 11:83694771-83694793 GGCAGGAATGGGTTTAACAACGG + Intronic
1087955909 11:104287849-104287871 GGGAGCAATGGGTTTAAAGAGGG + Intergenic
1088779774 11:113123084-113123106 GGGAAGAATAGGTTGGTTAATGG + Intronic
1089611661 11:119672740-119672762 GGGAAGCATGGGAAGGAAAATGG - Intronic
1090503661 11:127286409-127286431 GGAAAGAATAGGTATTAAAATGG - Intergenic
1091012223 11:132012789-132012811 GGGAAGAAGGGGCTAGAAGAAGG + Intronic
1091111225 11:132970329-132970351 GGGAAGGGTGTGTTTGAATATGG + Intronic
1091513837 12:1157729-1157751 GTGAAGAAAGGGTTTCAAAGAGG + Intronic
1091718716 12:2796920-2796942 AGCAAGACTTGGTTTGAAAAAGG - Intronic
1091908035 12:4205269-4205291 GGAAAGAAGGGATTTGAACAAGG + Intergenic
1092037474 12:5349626-5349648 GGCAGGAATTGATTTGAAAAGGG + Intergenic
1092514025 12:9188917-9188939 AGGAAGAATCAGTATGAAAATGG + Intronic
1093181880 12:15976164-15976186 GGGAAGAAGGGGTATAAATATGG - Intronic
1094485612 12:30924577-30924599 GGAAAGAGAGGGTTGGAAAACGG - Intergenic
1094830086 12:34296163-34296185 GGGAAGATAAGGCTTGAAAAGGG + Intergenic
1094835719 12:34321168-34321190 GGGAAGATAAGGCTTGAAAAGGG - Intergenic
1096669635 12:53190964-53190986 GTGGAGAAGGGGTTTTAAAATGG - Exonic
1096746169 12:53728261-53728283 GAGAAGAATGAAATTGAAAAGGG + Intergenic
1097326180 12:58279113-58279135 GGTAACAGTGGCTTTGAAAATGG - Intergenic
1097647474 12:62253617-62253639 TGGAAGAATGGCTTTGAAGATGG - Intronic
1099009554 12:77275934-77275956 ATGAAGAATGGATTTGAAGAAGG + Intergenic
1099122817 12:78712960-78712982 GGTAAAAATGGCTTTGAAACTGG - Intergenic
1099408153 12:82288295-82288317 GGGAAGAATAGATTTGAAATTGG - Intronic
1099609532 12:84850228-84850250 GGGAAGAAGACGTGTGAAAAGGG + Intergenic
1100917056 12:99436157-99436179 GAGAATAATAGTTTTGAAAAAGG - Intronic
1101951260 12:109177581-109177603 GGGAAGAATTGATATTAAAAGGG + Intronic
1104230490 12:126879493-126879515 GGGAAAAATTGGTCTGCAAAAGG - Intergenic
1105103762 13:16498223-16498245 GTGAAGAATTCGTTGGAAAAGGG + Intergenic
1105130886 13:16941149-16941171 GTGAAGAATTCGTTGGAAAAGGG + Intergenic
1107664836 13:42678019-42678041 AGGAACAATGGGGTTGCAAATGG + Intergenic
1107744349 13:43489210-43489232 GGGCAGAATGGTTTTGAGGAAGG + Intronic
1110509308 13:76330096-76330118 GGTAAGAATGGGCTTGAATATGG - Intergenic
1111444013 13:88321247-88321269 GTGAAAAATAGGCTTGAAAAAGG + Intergenic
1111667377 13:91286099-91286121 AGGAAGAATTTGTTTTAAAATGG - Intergenic
1112211075 13:97377744-97377766 GTGAAGAATGGCTTTGCACAAGG + Intronic
1112469403 13:99674000-99674022 GGAAAGAGTGGCTTTCAAAATGG + Intronic
1113141703 13:107159486-107159508 GGGCAGAAGAGATTTGAAAAAGG - Intergenic
1114490418 14:23097420-23097442 GGGAAGAATGGGTTTGAAAAAGG + Intronic
1116043631 14:39716134-39716156 GGGAAGAAAATGTTTGAGAAGGG - Intergenic
1116046326 14:39747697-39747719 GTGAAGAATGGCATGGAAAAGGG + Intergenic
1116439911 14:44939484-44939506 GGGAAGAAATGATTTAAAAATGG - Intronic
1117063039 14:51982122-51982144 GTGAGGAAAGGGTGTGAAAATGG + Intergenic
1117088725 14:52227880-52227902 GGGAGGCAGGGGTTTAAAAAAGG - Intergenic
1117284953 14:54278183-54278205 GGGACAAATGGGTGTGACAATGG + Intergenic
1117872321 14:60213956-60213978 GTGAAGAATGGATTAGAAAAAGG - Intergenic
1118401400 14:65383061-65383083 AGGGAGAATGGATTTCAAAAGGG - Intergenic
1120226014 14:81791596-81791618 GGGAACAATGGGGATGCAAATGG - Intergenic
1120878698 14:89397909-89397931 GGGAAGACTGAGTGTGAAAGTGG - Intronic
1121065437 14:90959558-90959580 GGGAAGAACAGGTTTGGAAGGGG + Intronic
1121766771 14:96494624-96494646 GGGAAGAAAGTGTTTGAAGGAGG - Intergenic
1124028336 15:25987390-25987412 GGGAACAATGGGGTTGCAAATGG + Intergenic
1124943421 15:34239757-34239779 GGGAATAATGGTATGGAAAATGG + Intronic
1127215313 15:56817649-56817671 GGGAAGAAAGCCTTTGGAAAAGG - Intronic
1128645336 15:69374718-69374740 GGGAAGAATGGGAGGGAAAAGGG - Intronic
1128889372 15:71317260-71317282 GGGTAGAATGTTTTTGAAGATGG + Intronic
1128927197 15:71668478-71668500 GGGGAGAATGTGGCTGAAAATGG + Intronic
1130035899 15:80361249-80361271 GGGAAGACTGGGTCAGGAAAAGG + Intronic
1130157676 15:81366324-81366346 GGGAAGAGTGGCTTTCTAAAAGG + Intronic
1131035313 15:89218279-89218301 GAGAAGCATTGGTTTGGAAATGG - Intronic
1131413112 15:92227500-92227522 GGACAGAAGGGGTTTGAAAGAGG - Intergenic
1133253321 16:4499507-4499529 GGGAAGGGTGGGTGTGGAAAGGG + Intronic
1135428756 16:22363732-22363754 GGGAAGCATGGGTTGGGACATGG + Intronic
1135486191 16:22867215-22867237 GGGAAGAATTAGTTTCCAAATGG - Intronic
1135818943 16:25662222-25662244 GGGCAGACTGGGTAAGAAAATGG + Intergenic
1135824996 16:25718981-25719003 TGGAAGTAAGGGTTTTAAAAGGG + Intronic
1138215890 16:55205060-55205082 GGGAAGACTGGGTTGGAGAGGGG - Intergenic
1138977268 16:62222698-62222720 TGGAAGTTTGGTTTTGAAAAGGG - Intergenic
1139149072 16:64358772-64358794 GAGAAGGATGTGTGTGAAAAAGG - Intergenic
1139501394 16:67369339-67369361 GTGAAGAATGTGTTTCAAGAAGG + Intronic
1139799981 16:69514707-69514729 GGGAGGAATGGGTTTGGAGGAGG - Intergenic
1139819378 16:69708482-69708504 GCGAAGAAAGTGTTTGAAGATGG - Intronic
1139993025 16:70954996-70955018 GGGATGAATGGGTTCCAACAAGG - Intronic
1140127388 16:72129471-72129493 GGGAAGAATTGGTAAGAAAGTGG - Intronic
1140407425 16:74720033-74720055 GGGAAGCATGTGCTTGAAGATGG - Intronic
1140756278 16:78070229-78070251 GGAAGGCATGGGTTTTAAAAAGG - Intergenic
1141041129 16:80673642-80673664 GGGAAGAAAGGGTATGCATATGG - Intronic
1142315048 16:89338365-89338387 TTGAAACATGGGTTTGAAAAGGG + Intronic
1144002643 17:11070187-11070209 GGGAAGAAGGTGTTTTAAGAAGG + Intergenic
1144504050 17:15815118-15815140 AGGAAGAATGGAATTTAAAATGG - Intergenic
1145052338 17:19672694-19672716 GTGAAGAATGGGCTTGGAAAAGG + Intronic
1145167907 17:20630625-20630647 AGGAAGAATGGAATTTAAAATGG - Intergenic
1146464223 17:33073612-33073634 GGGAACAATGGGGTTGATAATGG + Intronic
1147260729 17:39208585-39208607 GGTAAGAATGGGGGTGAAGAAGG + Intergenic
1147906928 17:43829614-43829636 GGGAAGAGTGGGTTAGAGAGGGG + Intronic
1149179071 17:53912508-53912530 GGCAAGAATGGAGATGAAAAGGG + Intergenic
1149306669 17:55354304-55354326 GGGAAGAATGACCTTGATAATGG + Intergenic
1149512292 17:57253896-57253918 TGGAAGATTGAGTTTGAAGAAGG + Intergenic
1203171303 17_GL000205v2_random:149621-149643 TGGAAGAATGGCTTGGAAATGGG - Intergenic
1154023407 18:10684772-10684794 GGGGACAATGCCTTTGAAAAGGG - Intronic
1154364469 18:13694265-13694287 AGGAAGAATCGTTGTGAAAATGG + Intronic
1155722539 18:29035110-29035132 GGAGAGAATGGGGCTGAAAATGG - Intergenic
1155844507 18:30688740-30688762 AGGAAGAACGGATTGGAAAAGGG - Intergenic
1156110846 18:33725361-33725383 GGGAAGAATGTGTTTGCAGAAGG - Intronic
1156184618 18:34647401-34647423 GGGAAAAATGGCATAGAAAAAGG + Intronic
1156469444 18:37368283-37368305 GGGAAGGATGGGGCTGAAGAGGG - Intronic
1156918320 18:42487906-42487928 GGAAAGAATGAATTTGAACAGGG + Intergenic
1157315237 18:46581417-46581439 GGGAAGGATAGGTTTGGAGATGG + Intronic
1158613837 18:58968019-58968041 GGCAATAATGGGTTAGAACATGG + Intronic
1158905139 18:62004360-62004382 GGGAAGGAAGGGTCTGAAAGGGG - Intergenic
1158969019 18:62649086-62649108 AGGAGGGATGGGTGTGAAAAAGG + Intergenic
1160153819 18:76416765-76416787 GGGGAGAATGTGTTTTAAATGGG - Intronic
1160320085 18:77882592-77882614 GGAAAGAAAGGGGTTGAAACAGG + Intergenic
1162320446 19:9968342-9968364 GGGAAGAATGCATTTGAAGGAGG - Intronic
1162959285 19:14116945-14116967 GGGCAGGATGGGTTTGGAAGGGG + Intronic
1164254641 19:23516696-23516718 GGGCAGACTGGGTTATAAAATGG + Intergenic
1164521576 19:28983877-28983899 GGGAAGAATGGGTTTGCCCAAGG + Intergenic
1164760570 19:30725547-30725569 AGGAAGGCTGGGTTTGAAACTGG - Intergenic
1164969434 19:32518730-32518752 GGGAAGAGGGGGTTTCAGAAAGG - Intergenic
1165408527 19:35644479-35644501 CGGGAGATTGGGTTTGAGAAGGG - Intronic
1165787759 19:38472566-38472588 GGAAAGCAAGGGTTTAAAAAGGG + Intronic
1166763178 19:45237131-45237153 GGGAAGAATGGGATATGAAACGG + Intronic
1167807302 19:51797084-51797106 AGGAAAAATGTGTTTGAAAAGGG + Intronic
924997192 2:373005-373027 AGGAAGACTGGGTTTGTCAAAGG - Intergenic
926551333 2:14305267-14305289 GGCAAAAGTGAGTTTGAAAATGG - Intergenic
926588303 2:14713351-14713373 GGGTAGTTTGGGTTTGAAAGTGG - Intergenic
926608484 2:14921920-14921942 AGAAGGTATGGGTTTGAAAAGGG - Intergenic
926809855 2:16746527-16746549 TGGCAGAATGGGTTTCATAAGGG - Intergenic
927192161 2:20524241-20524263 GGGAAGAGGGGGTTAAAAAAGGG + Intergenic
927229923 2:20811926-20811948 GGCAAGAGTGGGAATGAAAAAGG + Intronic
927503387 2:23597105-23597127 GGGAAGACTGTCTTTTAAAAAGG + Intronic
928024400 2:27728200-27728222 GGGAAGGAAGGGCTTGTAAAGGG + Intergenic
929316139 2:40481206-40481228 GGGAGGAATGGATATAAAAAAGG + Intronic
929801278 2:45105280-45105302 GAGAAAAAAGGGTTTCAAAAAGG - Intergenic
930384576 2:50677806-50677828 AGTAGGAATGGGTTTGGAAATGG - Intronic
930532660 2:52609402-52609424 GGTTAGATTGGTTTTGAAAAAGG + Intergenic
930667575 2:54115033-54115055 GGGATGAAAGGGGTTGGAAATGG + Intronic
930842742 2:55865318-55865340 GGGAAAAATGTGTTGGAAGAAGG + Intergenic
931086172 2:58832905-58832927 AGGCAGAATGTGTTTCAAAATGG - Intergenic
931280057 2:60782630-60782652 AAGAAGAATGATTTTGAAAAGGG - Intronic
931899604 2:66772865-66772887 AGGAAGAATGGGTCTCAGAAAGG + Intergenic
933195489 2:79384724-79384746 AGGAAGAAAGAGTTTCAAAAGGG - Intronic
933783065 2:85815080-85815102 GGGAGGAAAAGGTTTGAGAAAGG - Intergenic
933877246 2:86631614-86631636 GGGAGGAAAGGGCTAGAAAAGGG - Intronic
934913381 2:98278765-98278787 GGCCAGAGTGGTTTTGAAAAAGG + Intronic
936712213 2:115144262-115144284 GGGAAGCATGGGTCAGAATAAGG - Intronic
937698753 2:124839495-124839517 GGCAAGATTGGATTTAAAAAGGG - Intronic
938036940 2:128042591-128042613 TGGAAAAATGGTTTGGAAAATGG + Intergenic
938930663 2:136084001-136084023 GGGAAGAAAGTGTTTGAAGAAGG - Intergenic
939123541 2:138147643-138147665 GGAAAGACTGGGTTTCAAAGAGG - Intergenic
939175985 2:138747601-138747623 AGGAAGAGTGGGTGTCAAAAAGG + Intronic
939892611 2:147755412-147755434 GGGAAAAATGGGTTGGAATTAGG + Intergenic
939964758 2:148599393-148599415 GGGGAGAAAGGGATAGAAAAAGG - Intergenic
940986297 2:160055487-160055509 TGGAAGGAGGGGTTTGGAAAAGG + Intronic
941218882 2:162749157-162749179 GAGAAGAAAGGGGTGGAAAATGG - Intronic
941503362 2:166309115-166309137 GGGAAGAATGAGAGTGAAGAGGG + Intronic
941645792 2:168039655-168039677 GGGAGGAATGGATTGCAAAAGGG + Intronic
942966337 2:181897244-181897266 GGGAAGAATTGTCCTGAAAAAGG + Intronic
943734380 2:191338515-191338537 GGGTCAAATGTGTTTGAAAATGG - Intronic
943793639 2:191964884-191964906 GGGAAGAGAGGGCTTCAAAAAGG - Intronic
943838721 2:192550477-192550499 GGGCAGATTGTGTTTGGAAATGG + Intergenic
944036212 2:195297498-195297520 GGGAAGAGTGGGTCTTAAGAGGG + Intergenic
944137974 2:196420872-196420894 TGGAAGAAGGGGTTTAAAATAGG + Intronic
946266562 2:218548187-218548209 GGGAAGAATTAGTGGGAAAAGGG - Intronic
946561642 2:220920669-220920691 GGCAAGCTTTGGTTTGAAAATGG - Intergenic
946581831 2:221137235-221137257 GGGGACAATGGATTAGAAAAAGG - Intergenic
948249987 2:236519582-236519604 GGATAGAATGGGTTTGGAAGGGG - Intergenic
1169791943 20:9420210-9420232 GGGAGGAATGGGTTACAAAAGGG + Intronic
1170839851 20:19915737-19915759 GAGCAGAGTGGGTATGAAAAGGG - Intronic
1171373148 20:24674549-24674571 GGGCATGATGGGTCTGAAAAGGG - Intergenic
1171517635 20:25750559-25750581 GGGAAGTATGGGTTAGAGGAGGG - Intergenic
1171891315 20:30719517-30719539 GGGAAAAATGGGTAGGGAAAAGG - Intergenic
1172689994 20:36783631-36783653 GGGGAGAACGGGTTCGAGAAGGG + Exonic
1173277780 20:41599395-41599417 TGGAAAAATGGTTTAGAAAATGG + Intronic
1173395850 20:42678610-42678632 GGCATGAATGGGATTTAAAAGGG - Intronic
1173735744 20:45360142-45360164 GGGAGGAAAGGCTTAGAAAAGGG - Intergenic
1174150159 20:48480733-48480755 GGGAAGAATGTTTTAGCAAAGGG - Intergenic
1174603642 20:51744621-51744643 GGGAACAATGTTTCTGAAAAAGG + Intronic
1174851857 20:54003385-54003407 GTGAAGAATAGATTTCAAAAGGG - Intronic
1175410664 20:58765963-58765985 GGTAAACATGGCTTTGAAAAAGG + Intergenic
1176327284 21:5511449-5511471 TGGAAGAATGGCTTGGAAATGGG - Intergenic
1176330424 21:5544782-5544804 TGGAAGAATGGCTTGGAAATGGG + Intergenic
1176397333 21:6276169-6276191 TGGAAGAATGGCTTGGAAATGGG - Intergenic
1176400473 21:6309502-6309524 TGGAAGAATGGCTTGGAAATGGG + Intergenic
1176436684 21:6679602-6679624 TGGAAGAATGGCTTGGAAATGGG - Intergenic
1176439824 21:6712935-6712957 TGGAAGAATGGCTTGGAAATGGG + Intergenic
1176460946 21:7006672-7006694 TGGAAGAATGGCTTGGAAATGGG - Intergenic
1176464086 21:7040004-7040026 TGGAAGAATGGCTTGGAAATGGG + Intergenic
1176484507 21:7388450-7388472 TGGAAGAATGGCTTGGAAATGGG - Intergenic
1176487647 21:7421783-7421805 TGGAAGAATGGCTTGGAAATGGG + Intergenic
1177210078 21:18060033-18060055 TGGAAGAAAGTGTTTGAAATGGG - Intronic
1178936914 21:36870838-36870860 GGGCAGAAGGGTTTGGAAAATGG + Intronic
1180684338 22:17653345-17653367 GGGAAGGATGGATAGGAAAAAGG - Intronic
1183816733 22:40308106-40308128 GGGAGGAAAGGGTTTGCAGAAGG - Intronic
1184434669 22:44463227-44463249 GGGAAAACTGGGCTGGAAAAAGG + Intergenic
1185264346 22:49891689-49891711 AGTAAGAATCAGTTTGAAAAGGG - Intergenic
949617130 3:5766212-5766234 GGGGAGCATGGGTTGAAAAATGG + Intergenic
950601517 3:14039701-14039723 TGGAAAAATGGTTTGGAAAATGG - Intronic
950749059 3:15114480-15114502 AGGAACAATGGGTTTGCAAATGG - Intergenic
950853394 3:16083704-16083726 GACAAGTATGGGTTTGACAAGGG - Intergenic
951152784 3:19312010-19312032 CGGAAGAAAGAGTTTGAGAAAGG - Intronic
952235938 3:31480274-31480296 GGGCAGAATGGGATTGGATAAGG - Intergenic
952265647 3:31783951-31783973 GAGAAGAATGTTTTTAAAAATGG - Intronic
952559343 3:34572472-34572494 GGGAAGAATGAGATTAAAAATGG - Intergenic
953082143 3:39630874-39630896 GGGAAGAATGCTTCTGTAAAAGG + Intergenic
953872681 3:46641172-46641194 GGGAAGGCAGGGTTTAAAAAGGG - Intergenic
956583619 3:70841082-70841104 GGGATTAAAGGGTTTGCAAAAGG - Intergenic
957766605 3:84633395-84633417 GGGAAAAATAGGTTTTTAAAGGG - Intergenic
958010166 3:87867154-87867176 GGAAGGAATGAGTTTGAAGAGGG - Intergenic
958259121 3:91359013-91359035 AGGAAGAATGGTGTTGAAGATGG + Intergenic
958268330 3:91466547-91466569 GGAAAGAATGTGTATCAAAAGGG - Intergenic
959957977 3:112260921-112260943 GGGAAGAATTGTGTAGAAAAAGG - Intronic
960038046 3:113121393-113121415 GGTAAGAGTGAGTTGGAAAAGGG + Intergenic
963918257 3:150880792-150880814 GCCAAGACTTGGTTTGAAAATGG - Intronic
963963959 3:151344352-151344374 AGGAAGAATGGGTGTGCACATGG - Intronic
964392093 3:156208328-156208350 GGGAAGCATGGCCGTGAAAAAGG - Intronic
964852187 3:161106318-161106340 GTGAAGAATGGCTGTGATAAAGG - Intronic
966095565 3:176196832-176196854 GGCCAGAGTGGTTTTGAAAAAGG + Intergenic
966481897 3:180418856-180418878 GTGAATAATGGGTTTCAAAAAGG + Intergenic
968937274 4:3617703-3617725 GGGAGGAATGGGAGGGAAAAAGG - Intergenic
970690790 4:18618246-18618268 TGGAAGAAAGGGTTTGAAGTGGG + Intergenic
971496805 4:27275091-27275113 GGGGATAATTGGTTTCAAAAAGG + Intergenic
971513075 4:27451978-27452000 GGGAAGAAATGTTTTGAAATGGG + Intergenic
971712559 4:30134762-30134784 TGGAAGAAAGTATTTGAAAAAGG - Intergenic
973680497 4:53313296-53313318 GGGAAGAATGGGGGAAAAAAGGG + Intronic
974142401 4:57903769-57903791 GAGAGGAAGGGGTTAGAAAATGG + Intergenic
974742804 4:66029138-66029160 GGGCAGAATGGTGTAGAAAAAGG + Intergenic
975247021 4:72131165-72131187 GGGCAGGATGGTTTTGAAAAAGG + Intronic
976688717 4:87845232-87845254 GGGAATAAAGGGTTTGAGGATGG + Exonic
976978855 4:91198960-91198982 GGGAAGAGTGTGTATGAAGATGG - Intronic
977189867 4:93986253-93986275 GGGAAGAATGACTTTGGAAGTGG + Intergenic
977795099 4:101155357-101155379 GGGGAAAAGGGGTTTGATAAAGG - Intronic
978147557 4:105393751-105393773 GAGAAAAATGGGTTTCAAAAAGG + Intronic
978202388 4:106037275-106037297 GGTAAAACTGGGTTTGGAAAGGG + Intergenic
978350320 4:107814237-107814259 GGGTTAAATGGGTTTGAAATGGG + Intergenic
979372276 4:119903267-119903289 ATGAAGAATGTCTTTGAAAATGG - Intergenic
979793661 4:124817150-124817172 AAGAAGAATGTGTTTGAATAAGG - Intergenic
979867289 4:125772261-125772283 GAGAATATTGGGTATGAAAAAGG - Intergenic
980114578 4:128666885-128666907 AGGAAGCATGGGATAGAAAATGG + Intergenic
980813919 4:137918576-137918598 GGAAGGAATGGATTTTAAAATGG + Intergenic
981073789 4:140571032-140571054 GGAAAGAATGGCTTTGTCAAAGG + Intergenic
981296144 4:143134016-143134038 GAGAAGAAAGGGTTTGCCAAAGG - Intergenic
981429504 4:144644153-144644175 GGGAAGAAAGGGTTAGATAGTGG + Intergenic
982049315 4:151484604-151484626 GTGGAAAATGGGTTTGAAGATGG + Intronic
983070915 4:163266471-163266493 GAGAAGAAAGGATTTGAACAGGG - Intergenic
983278062 4:165643144-165643166 GGGACTAATGAGTGTGAAAATGG - Intergenic
983356221 4:166660879-166660901 GGGAAGAAAGAATTTGAAAAAGG + Intergenic
983505195 4:168545948-168545970 GAAAATAAAGGGTTTGAAAATGG - Intronic
983553189 4:169036806-169036828 GGGAAGAAAGAGATAGAAAAAGG - Intergenic
983643472 4:169965914-169965936 GGGAAGAAAGGTATTGCAAATGG + Intergenic
983975208 4:173925613-173925635 CAGAAGAAAAGGTTTGAAAAGGG - Intergenic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
984291208 4:177796726-177796748 AGGAAGAATGTGTTTGAAAATGG - Intronic
985187092 4:187329413-187329435 GAGCAGAATGAGATTGAAAAGGG - Intergenic
985450862 4:190061422-190061444 TGGAAGAATGGCTTGGGAAATGG - Intergenic
985477514 5:86557-86579 AGGAAGAAAGTGTTTTAAAAGGG - Intergenic
987282652 5:16426517-16426539 GAGAAGAGTGGGTTGGAAAGGGG - Intergenic
988383313 5:30527838-30527860 GGGGAGAGTGGATTTGACAAGGG + Intergenic
989304942 5:39943515-39943537 TGTAAGAGTGGGTATGAAAAAGG - Intergenic
990532864 5:56691026-56691048 GGGAAGAATAGGGATGAAAAAGG + Intergenic
992761039 5:79951033-79951055 TGGAAAACTGGGTTTGAAAAAGG - Intergenic
992846921 5:80759697-80759719 GTGGAGAATGAGTTGGAAAAAGG + Intronic
993509813 5:88757560-88757582 GGGAAGCAGGTGATTGAAAAAGG - Intronic
993557974 5:89365907-89365929 AGGCCGAATGAGTTTGAAAAGGG - Intergenic
994300516 5:98141566-98141588 GGGAAGCAAGGGTATGAAAGGGG - Intergenic
994575117 5:101567908-101567930 AGGAAGTATGGGTTTAAAAAGGG - Intergenic
995598304 5:113770014-113770036 GGGCAGAATTGTTTTTAAAAAGG + Intergenic
995614144 5:113942131-113942153 GGGAAGGATGGATGTCAAAAGGG + Intergenic
995828524 5:116328834-116328856 GGCATGAATGGATTTGAAATGGG - Intronic
995976108 5:118036581-118036603 GGAAAGAATGGGTTATATAAAGG + Intergenic
996209163 5:120783840-120783862 GGGAAAAAGGGGTTGGTAAATGG - Intergenic
996259089 5:121443682-121443704 GGGTAGAGTGAGTTAGAAAATGG + Intergenic
997615759 5:135245119-135245141 GGGAAAGATGGGCCTGAAAATGG + Intronic
998061456 5:139121959-139121981 TGCAAGAACGGGTTTAAAAATGG - Intronic
998194929 5:140060499-140060521 GGGAGGAATAAGTTTGAAGATGG - Intergenic
999146922 5:149402387-149402409 GGGAAGAATGGTTATGGGAAGGG - Intronic
999380514 5:151117951-151117973 GGGATGAAAGGGTTTGTAACTGG + Intronic
1001210093 5:169802858-169802880 GGGTAGGAAGGGTTAGAAAAGGG + Intronic
1001539497 5:172527381-172527403 GGGAAGAAGGGGCTTGATATGGG + Intergenic
1001848870 5:174945409-174945431 GGCAAGAATGTATTTGAAAAAGG + Intergenic
1004649764 6:17598234-17598256 GGGAAGAATGGGATTGAGACAGG - Intergenic
1005861275 6:29904035-29904057 GGTAGGAATGGATTTTAAAATGG + Intergenic
1005917489 6:30365936-30365958 GGGCAGAATGGGAGTGAACAAGG - Intergenic
1005942586 6:30571711-30571733 GGGAGGAGTGGGTTTGGAATCGG + Intronic
1006997074 6:38270996-38271018 GGGAAAAATAGACTTGAAAAAGG - Intronic
1007160827 6:39790736-39790758 AGGGAGAATGGGTTTGTCAATGG + Intergenic
1007626609 6:43250068-43250090 GGGAAGAAGGGGTGTAAAGAAGG + Intronic
1008077557 6:47161199-47161221 GGAAAGAAAGGAGTTGAAAAGGG - Intergenic
1008456928 6:51721906-51721928 GTGAAGAATGGGTTGGAGCATGG - Intronic
1008479692 6:51972701-51972723 GGGAACAATGCATTTGAAACTGG - Intronic
1008986872 6:57555040-57555062 GGAAAGAATGTGTATCAAAAGGG + Intronic
1008996136 6:57661578-57661600 AGGAAGAATGGTTTTGAAGATGG - Intergenic
1009174830 6:60447600-60447622 GGGAAGAATGTGTATCAAAAGGG + Intergenic
1009184662 6:60560357-60560379 AGGAAGAATGGTGTTGAAGATGG - Intergenic
1010109222 6:72204876-72204898 AGGATGATTGGGTTTGAAAAAGG + Intronic
1012956508 6:105576568-105576590 GGGAAGAGAGTGTTTCAAAAAGG - Intergenic
1013170545 6:107634118-107634140 GGGAAGCATGGGGTTGGACAGGG - Exonic
1013596882 6:111668635-111668657 GGGGAGAATGCGTGTGAAGAGGG - Intronic
1013789576 6:113821754-113821776 GGGAAGAATGTGGCTGACAATGG + Intergenic
1014197651 6:118577806-118577828 CGGAAAAATGGTTTAGAAAATGG + Intronic
1017270434 6:152497071-152497093 AGGCAGACTGAGTTTGAAAAAGG - Intronic
1017444272 6:154493197-154493219 GGGAAGAATGTTCTTGACAAAGG - Intronic
1017941432 6:159056650-159056672 GAGAAGACAGGGTTTTAAAAAGG + Intergenic
1018078953 6:160242346-160242368 GGGAAGAATGGGGATCACAATGG - Exonic
1018249874 6:161858702-161858724 GGGGAGCATGGGTTAGAATAAGG - Intronic
1019201805 6:170322714-170322736 GTGAAGGATGGGTTGGAAAGGGG + Intronic
1019549234 7:1593972-1593994 GGGAAGAAGGGGGAAGAAAAGGG - Intergenic
1019841489 7:3450580-3450602 GGGAGGAATGAGTTTGGGAATGG + Intronic
1020343038 7:7133259-7133281 GGGAAGAAAGGGATAGAATAAGG + Intergenic
1020352211 7:7233377-7233399 GGGAAGAATTGGTAAGAATAAGG - Intronic
1020784240 7:12555137-12555159 TGGAAGAATGTATTTGCAAATGG - Intergenic
1021095232 7:16527877-16527899 GGGAAAAAAATGTTTGAAAATGG - Intronic
1022060624 7:26790229-26790251 GGGTAGATTGGGTCTGAAACAGG - Intronic
1022431273 7:30324222-30324244 GGAGAGAATGGGAATGAAAAAGG + Intronic
1022473341 7:30694903-30694925 GAGAAGAAGGGGTCAGAAAAGGG + Intronic
1024800841 7:53076261-53076283 GCCAAGAATGGGTTTGAAAGAGG + Intergenic
1025833178 7:65072376-65072398 GGGAAGTCTGGGTTCTAAAATGG + Intergenic
1025902940 7:65761876-65761898 GGGAAGTCTGGGTTCTAAAATGG + Intergenic
1026148735 7:67770701-67770723 AGGTAGAAAGGGTTTGAACAAGG - Intergenic
1027296725 7:76781091-76781113 GAGAAGAGAGAGTTTGAAAAAGG + Intergenic
1028591613 7:92502215-92502237 GGGAGGAATGGGTAGTAAAAGGG + Intronic
1028619120 7:92804280-92804302 GGGAATCAGGGGTTTAAAAAAGG - Intronic
1030233344 7:107231561-107231583 GTAAAGAATGGTTTAGAAAATGG + Intronic
1031353080 7:120759389-120759411 TTGAAGAATGAGTTTGGAAAAGG + Intergenic
1031595191 7:123641980-123642002 GGGAAGAAAGGGTTTCTCAAGGG + Intergenic
1031775387 7:125902449-125902471 GGGAAGAAGTTATTTGAAAATGG + Intergenic
1031978546 7:128109063-128109085 GAGAGGAATGGCATTGAAAAAGG + Intergenic
1033806319 7:144958305-144958327 GAGAAGAATAGGATTGAAAGAGG - Intergenic
1033830264 7:145242822-145242844 GTGAAGAATGGATTTGGGAAGGG - Intergenic
1034279466 7:149842668-149842690 GGGAAGGATGGGCATGAAGAGGG + Intronic
1034634902 7:152559506-152559528 GTGAAGAATGAGTTTGGGAAAGG - Intergenic
1035589346 8:801377-801399 AGGAAGATTGGGTTTGCATAAGG + Intergenic
1036595138 8:10205194-10205216 GGGAAGAATGAATTGGACAAGGG + Intronic
1037420658 8:18698485-18698507 GGGAAGAAGAGGTTTGAAGGTGG + Intronic
1037726171 8:21484225-21484247 GGGAAAGATGGGTTTGAGATAGG + Intergenic
1038653197 8:29424565-29424587 AGGAACAATGGGGATGAAAATGG - Intergenic
1040898728 8:52394843-52394865 CAGAAGACTGGTTTTGAAAAAGG - Intronic
1041946583 8:63450431-63450453 GGAAAGAATAGGTCTGAACATGG - Intergenic
1041970242 8:63732962-63732984 GTGAAGAATGGGTTTGAAGAAGG - Intergenic
1042013824 8:64284409-64284431 GGGGAGAAGGGCTTGGAAAAGGG - Intergenic
1042363557 8:67909876-67909898 GGAGAGAAGGGGTTAGAAAATGG + Intergenic
1043544227 8:81297113-81297135 GATAAGAATGTGTTTTAAAAGGG + Intergenic
1044065857 8:87699556-87699578 GGGAGAAGGGGGTTTGAAAAGGG - Intergenic
1044074980 8:87809483-87809505 GGGAAGAATTGCTTTGCAAAAGG + Intergenic
1044587314 8:93879748-93879770 AGGAAGAATGGGAATGCAAATGG + Intronic
1044957889 8:97500543-97500565 GGGAAGGATGGGTGTGGCAAGGG - Intergenic
1045092863 8:98764915-98764937 GGGAACCATGGGTTTTAAACAGG + Intronic
1045409731 8:101904823-101904845 GGGCAGAGTGGGTTTCAGAAGGG - Intronic
1045999740 8:108405451-108405473 GTGAAGAATGGATTCTAAAATGG - Intronic
1046133009 8:109991968-109991990 GCAAAGAATGGGTTAGAAATTGG - Intergenic
1046396098 8:113641630-113641652 GGGAAAAATGGGTTACAGAATGG + Intergenic
1046555520 8:115768574-115768596 GGGAAGAAGGGATGGGAAAAGGG - Intronic
1046615050 8:116467398-116467420 GGAAAGACTGGGCTTGAAAATGG - Intergenic
1046809327 8:118515692-118515714 GGAAAGGTTGGGATTGAAAAAGG - Intronic
1049877211 8:145032497-145032519 GGGAGGAAGGGGTGGGAAAAAGG - Intergenic
1050092763 9:2032221-2032243 ATGAAGCATGTGTTTGAAAAAGG - Intronic
1050658800 9:7859956-7859978 GAGAAGTATGCTTTTGAAAAGGG + Intronic
1050984058 9:12059609-12059631 GGGAAGAGTGGGGCTGAAAAGGG + Intergenic
1051074859 9:13221182-13221204 GGGAGGAATACCTTTGAAAAGGG - Intronic
1052545093 9:29866202-29866224 GGGTAGCAGGGGTTTGCAAAGGG + Intergenic
1054708083 9:68483346-68483368 GGTGACAGTGGGTTTGAAAATGG + Intronic
1055834466 9:80421889-80421911 GGAAAAAAGGGGTTTGACAAAGG - Intergenic
1056068383 9:82960711-82960733 GGGAAGGATGGCTTAGAAGAAGG + Intergenic
1056086453 9:83154371-83154393 GGGAAGAAAGGGTTCTAGAAAGG - Intergenic
1057665561 9:97042340-97042362 GGGCACACTTGGTTTGAAAAGGG - Intergenic
1057744248 9:97738996-97739018 GGGAGGAATGGATTTGAGAGAGG + Intergenic
1058160740 9:101568055-101568077 GGAAAGAATGTGTGTGAAGAAGG + Intergenic
1058334228 9:103805606-103805628 GGAAAGAATGGGGTTTATAAGGG + Intergenic
1058716292 9:107724915-107724937 GGGTAGTAGGGGTTGGAAAATGG + Intergenic
1059068101 9:111106225-111106247 AGGAAGAATGGGTTGTAATAGGG - Intergenic
1059867460 9:118531975-118531997 GAGTAGAATGGATTTGAAATGGG - Intergenic
1060078744 9:120620633-120620655 GGGAAGAATGTGATTTAATAAGG + Intronic
1060136329 9:121158817-121158839 GGGAAGAGTAAGTTTGACAAAGG - Intronic
1060471022 9:123948301-123948323 GGAAAGAATGAGTTGGGAAATGG - Intergenic
1061364998 9:130168041-130168063 GGGAAGAATGTGTTTTAGGAAGG - Intergenic
1062240955 9:135537770-135537792 GGGAAGAATGGGGGTGAGAGCGG - Intergenic
1062479379 9:136744376-136744398 GGCAAGACTGGCTGTGAAAAAGG + Intronic
1203431671 Un_GL000195v1:95544-95566 TGGAAGAATGGCTTGGAAATGGG - Intergenic
1203434829 Un_GL000195v1:129057-129079 TGGAAGAATGGCTTGGAAATGGG + Intergenic
1185564845 X:1087235-1087257 GCGTAGAATGGGTTTTAAACTGG + Intergenic
1185979046 X:4755946-4755968 GGAAGGAAGGGGTTTAAAAAGGG - Intergenic
1185979047 X:4755947-4755969 GGGAAGGAAGGGGTTTAAAAAGG - Intergenic
1187612307 X:20955673-20955695 GGGCAGAATGGCTTTGAGAGAGG - Intergenic
1189144602 X:38643000-38643022 GGGAAGAATGGGATGGAGAGTGG + Intronic
1189221587 X:39376709-39376731 GGGGAGAAAGGGATTGGAAAGGG + Intergenic
1189557042 X:42155825-42155847 GGGAAGAACGTGTTTGCAAGAGG - Intergenic
1189755616 X:44268752-44268774 GGCAAGAATGCATTAGAAAATGG - Intronic
1191219218 X:57968858-57968880 GGGAAGGATGGGTGTGTGAAAGG - Intergenic
1191626793 X:63278696-63278718 GGGAAGAATGTGGTTCAAAAGGG - Intergenic
1194339587 X:92692505-92692527 GGGAAGAATGTGGTCCAAAAGGG + Intergenic
1194912679 X:99666321-99666343 AGGAAGAATCAGTATGAAAATGG - Intergenic
1195502565 X:105619203-105619225 GGGAAAAAAGGGTATGGAAAAGG + Intronic
1195694439 X:107656236-107656258 GTGAAGAATGGGTTGGGAAGGGG + Intergenic
1195865101 X:109424343-109424365 GTGAAGAATGGATTTGAGAGTGG + Intronic
1195878966 X:109572949-109572971 GGGAAGTAGGGGTTTCCAAAAGG - Intergenic
1195945534 X:110206773-110206795 GGGAAGAATGGGACTGACCATGG - Intronic
1196087236 X:111697196-111697218 GGGAAGAAGGTGTTTGATAAAGG + Intronic
1198132562 X:133712102-133712124 TGGATGATTGGCTTTGAAAAAGG + Intronic
1198229934 X:134679211-134679233 GGCAAGAATGAGTTGGAGAAAGG + Intronic
1198427047 X:136530865-136530887 GGGATGAATGGTTTAGAAAGGGG + Intergenic
1198964977 X:142217804-142217826 GAGCAGAATGGGTTTTACAAGGG - Intergenic
1200647971 Y:5809285-5809307 GGGAAGAATGTGGTCCAAAAGGG + Intergenic