ID: 1114495480

View in Genome Browser
Species Human (GRCh38)
Location 14:23128699-23128721
Sequence GCTCCTTATGGGCCACATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114495469_1114495480 30 Left 1114495469 14:23128646-23128668 CCTTGCCCACTTCTGTGCAGGGC 0: 1
1: 0
2: 6
3: 17
4: 283
Right 1114495480 14:23128699-23128721 GCTCCTTATGGGCCACATGTGGG 0: 1
1: 0
2: 0
3: 9
4: 102
1114495475_1114495480 8 Left 1114495475 14:23128668-23128690 CCCTTATGTGGGCACAATATGGC 0: 1
1: 0
2: 0
3: 2
4: 77
Right 1114495480 14:23128699-23128721 GCTCCTTATGGGCCACATGTGGG 0: 1
1: 0
2: 0
3: 9
4: 102
1114495471_1114495480 24 Left 1114495471 14:23128652-23128674 CCACTTCTGTGCAGGGCCCTTAT 0: 1
1: 0
2: 0
3: 23
4: 177
Right 1114495480 14:23128699-23128721 GCTCCTTATGGGCCACATGTGGG 0: 1
1: 0
2: 0
3: 9
4: 102
1114495470_1114495480 25 Left 1114495470 14:23128651-23128673 CCCACTTCTGTGCAGGGCCCTTA 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1114495480 14:23128699-23128721 GCTCCTTATGGGCCACATGTGGG 0: 1
1: 0
2: 0
3: 9
4: 102
1114495476_1114495480 7 Left 1114495476 14:23128669-23128691 CCTTATGTGGGCACAATATGGCA 0: 1
1: 0
2: 1
3: 17
4: 86
Right 1114495480 14:23128699-23128721 GCTCCTTATGGGCCACATGTGGG 0: 1
1: 0
2: 0
3: 9
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114495480 Original CRISPR GCTCCTTATGGGCCACATGT GGG Intronic
900501778 1:3009424-3009446 GCTCCAGCAGGGCCACATGTGGG - Intergenic
909892050 1:81019780-81019802 CATCCTGATGGGTCACATGTGGG - Intergenic
911447328 1:98013891-98013913 GTTCCTTATGGGCCACTTTATGG - Intergenic
912810412 1:112789955-112789977 GCTCCTAATGGGGCACATCTAGG - Intergenic
913286404 1:117230747-117230769 ACTCCTTATGGGTCACAGTTTGG - Intergenic
915947070 1:160161097-160161119 CCACCTTCTTGGCCACATGTTGG - Intronic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
1064365158 10:14700926-14700948 GCACCCCAGGGGCCACATGTGGG - Intronic
1067232945 10:44424806-44424828 GGTCATTATGGGGCACATGTGGG - Intergenic
1070788853 10:79177988-79178010 GATCCTTAATGGCCACATGGTGG + Intronic
1070829928 10:79411933-79411955 GCTCTGTAAGGGGCACATGTGGG - Intronic
1070849205 10:79549950-79549972 GCTCCTTGTGCCCCTCATGTTGG - Intergenic
1073059707 10:100726140-100726162 GATCCTGATGGGCCACATGCAGG - Intergenic
1074321948 10:112411449-112411471 GCTCCTTTGGGGTCACCTGTAGG - Exonic
1076687927 10:132206469-132206491 GCTCCCTCTGGCCCAGATGTGGG + Intergenic
1076735245 10:132456046-132456068 GGTCCTTATGGAGCACAGGTGGG + Intergenic
1077058578 11:607856-607878 GCTCCTTATCGTCCACAGGCCGG - Exonic
1078789901 11:14531929-14531951 GCTCCATGTTGGCCACAGGTTGG + Intronic
1079881398 11:25931954-25931976 GGTGTTAATGGGCCACATGTAGG - Intergenic
1080466458 11:32502112-32502134 GCTCCTAATAGGCCACAGATGGG - Intergenic
1081074117 11:38647540-38647562 GCTCTTTATTGGCCTCATATAGG - Intergenic
1081487813 11:43545556-43545578 GAACCTTATGGGCCACATCATGG - Intergenic
1081617053 11:44597324-44597346 GCTCCTGATGGGTCCCATCTGGG + Intronic
1086018480 11:82196224-82196246 TCACTTTACGGGCCACATGTGGG + Intergenic
1088588912 11:111384883-111384905 TCTCCTTAAGGGCCACATTTTGG - Intronic
1092536866 12:9396617-9396639 GCTCCTCATGCTCCAGATGTAGG - Intergenic
1101059164 12:100953124-100953146 CATCATTATGTGCCACATGTGGG + Intronic
1101307432 12:103543149-103543171 GCTCCTTAAGAGCCACCTCTAGG - Intergenic
1101800661 12:108019248-108019270 GCTCCTTATGGGACATGTGCAGG - Intergenic
1102639988 12:114358595-114358617 ACTCTTTCTGGGCCACATATGGG + Intronic
1105965147 13:25376992-25377014 GGTGCTTATTGGCCACCTGTGGG - Intronic
1106008829 13:25798164-25798186 GCTCATTATGTGACACATGGTGG - Intronic
1107155539 13:37163042-37163064 GCTGCCCATGGGCCACAGGTTGG - Intergenic
1107803066 13:44128663-44128685 GCTGCATATTGGGCACATGTGGG - Intergenic
1110670182 13:78168767-78168789 GCTCCTTGCTGGCCACATCTTGG - Intergenic
1111001914 13:82195729-82195751 GCTCCCTATGCTCCACATGTTGG - Intergenic
1111171150 13:84528183-84528205 GCTCTCTATGTGCCACAGGTAGG + Intergenic
1114495480 14:23128699-23128721 GCTCCTTATGGGCCACATGTGGG + Intronic
1118749727 14:68796741-68796763 GCACTTTATGGGCCAAATGTAGG - Intergenic
1127233690 15:57024052-57024074 GTTCCTAATAGGCCACATATTGG + Intronic
1127716059 15:61650427-61650449 CCACCTTATGGCCCACATCTCGG + Intergenic
1128642414 15:69349355-69349377 GCTCCTCGTGGGTCACATTTTGG - Intronic
1129031004 15:72617673-72617695 GGTCCCAATGGGGCACATGTGGG + Intergenic
1136655794 16:31708464-31708486 GCTCCTTGTGGGGCACAGGCAGG - Intergenic
1141244014 16:82289925-82289947 CCTCCTGATGGGGCACAAGTTGG + Intergenic
1141904036 16:87011139-87011161 GCACCTTGTCGGCAACATGTTGG + Intergenic
1142501917 17:337797-337819 GCCCCTCATGGGGCACACGTAGG + Intronic
1146656964 17:34640108-34640130 GCTGCTTCTGGGACACATGCTGG - Intergenic
1148972945 17:51500154-51500176 CCTCCTGATGGGCCATCTGTAGG + Intergenic
1152756694 17:82090001-82090023 GAGCCCCATGGGCCACATGTGGG - Intronic
1153222034 18:2870430-2870452 ACTAGTTCTGGGCCACATGTAGG - Intronic
1158235661 18:55310437-55310459 ACTCCTTAGGTGCCACATTTTGG - Intronic
1164755689 19:30687299-30687321 GTTTCTCATGAGCCACATGTGGG - Intronic
928491906 2:31793073-31793095 GCTCCTAAAGGTCCACATGCAGG - Intergenic
928545427 2:32324991-32325013 GCCCCTTATTGGCCAAATCTGGG + Intergenic
929347800 2:40907840-40907862 GCTCCTTAGAGGGCACATTTTGG + Intergenic
936517972 2:113193964-113193986 TCTTCTTATGAGCCTCATGTAGG + Intronic
940001753 2:148973573-148973595 GCTCCCTATGGGGCTGATGTAGG + Intronic
941007353 2:160261611-160261633 CCTCCCTGTGGGCCACAGGTTGG - Intronic
946479534 2:220040802-220040824 GCTCCTTCTGGGTCTCCTGTGGG + Intergenic
1173475206 20:43353776-43353798 GCCCCTTCTGGGCCTCTTGTTGG - Intergenic
1174112912 20:48208453-48208475 GCTACTTCTGGGCCACTTGGGGG - Intergenic
1176161073 20:63649127-63649149 GCTCCTCATGGGCCACCAGCTGG - Intronic
1177928367 21:27248426-27248448 GCTCCTTTTGAGCCAGATTTTGG + Intergenic
1180231899 21:46431391-46431413 GCACCCTATTAGCCACATGTAGG - Intronic
1181441153 22:22935802-22935824 GCTCCTCCTGGGCCACACCTGGG - Intergenic
1181873406 22:25921337-25921359 GCTCCTTCTGGGCACCATGGAGG + Exonic
1183045987 22:35220658-35220680 GCACCTCATGGTCCAGATGTGGG + Intergenic
1183784374 22:40021155-40021177 GCTCCTTGTGGGCCACACGCTGG - Intronic
1184556900 22:45238342-45238364 GCTCCGTATGTGCCCCATGCTGG + Intronic
949942013 3:9162539-9162561 GCTCCTTCTGGTCCACTTGCAGG + Intronic
952276241 3:31880027-31880049 GCTCATAATGGGGCACTTGTGGG + Intronic
952953955 3:38545150-38545172 GTTTCTTATGGGCCAGAGGTGGG + Intergenic
953791914 3:45954123-45954145 GCGGCCTATGGGCCACAGGTTGG - Intronic
958753780 3:98225760-98225782 GCAGCCTGTGGGCCACATGTTGG + Intergenic
963390640 3:144659505-144659527 GCTCCTTGTGGAACAGATGTGGG - Intergenic
965964089 3:174466190-174466212 GCTGCATGTGGGCCACAGGTTGG - Intronic
970139538 4:12966837-12966859 GCTCTTTATGTCCCACATGGAGG - Intergenic
971246932 4:24937919-24937941 GCTCCTTATGGATGATATGTTGG + Intronic
979894631 4:126144852-126144874 GTGCTTTATGGGCCACATGAAGG - Intergenic
980680588 4:136155089-136155111 GCTCCATGTGGGCCCCATGGAGG + Intergenic
984474288 4:180216576-180216598 GCTGCTGCTGGCCCACATGTGGG - Intergenic
985608789 5:874353-874375 ATTTCTTATGGCCCACATGTTGG - Intronic
987970308 5:24934661-24934683 GCTACCCATGGGCCACAGGTTGG - Intergenic
1000256974 5:159548712-159548734 GCACGATATGAGCCACATGTAGG - Intergenic
1001005313 5:168044658-168044680 GCTCCTTAAGGGCCACAGAGAGG - Intronic
1001742750 5:174067660-174067682 GCTCCTTCTGGGCCCCATGAAGG + Intronic
1001884429 5:175276341-175276363 GATACTGATGGACCACATGTGGG + Intergenic
1006629271 6:35419698-35419720 TCTCCATATGGGCCACACGGTGG + Intronic
1015950551 6:138548397-138548419 GCTGCATGTGGGCCACAGGTTGG - Intronic
1018966635 6:168495237-168495259 GCTCCTTGTGGCCCAGGTGTAGG + Intronic
1019176110 6:170160329-170160351 GCTCCTTCTGGGACACCTGTTGG + Intergenic
1019614738 7:1954100-1954122 GGTTCTGATGGGCCACATGCGGG - Intronic
1024918458 7:54530783-54530805 GGTCCTTATGGGCCGAATTTAGG - Intergenic
1028247292 7:88495821-88495843 GCTCCAAATGGGCCAAATCTGGG + Intergenic
1029118490 7:98251003-98251025 GCTCCTCATGGGCCACTTTCTGG + Intronic
1029125034 7:98289664-98289686 GCTCCTTCTGGGCCTCCTGGGGG - Intronic
1035706301 8:1678129-1678151 GCTCCTGACAGGCGACATGTAGG + Intronic
1040444115 8:47476425-47476447 GCTGCTTATTGGCCGCATGCTGG - Intronic
1041547132 8:59058388-59058410 GCTCCTTCTGGACCACTTGAAGG - Intronic
1042146393 8:65734506-65734528 GCTCCACATGGGCTCCATGTGGG - Intronic
1042497396 8:69470550-69470572 GGTAGCTATGGGCCACATGTGGG - Intronic
1049238730 8:141525798-141525820 GCACCCTCTGGGCCTCATGTGGG + Intergenic
1049922648 9:379720-379742 GCTCCTTAAGGACCAGCTGTGGG + Intronic
1051596396 9:18828308-18828330 GCTCTTTTTGGGCCAATTGTTGG - Intronic
1055708405 9:79033346-79033368 GCTCCATGTGGGCCCCATGGTGG + Intergenic
1186309634 X:8303372-8303394 CTTCTTTATGGGCCACAGGTAGG + Intergenic
1187328315 X:18312639-18312661 TTTCCTTATGGACCAGATGTAGG + Intronic
1187674261 X:21700306-21700328 GCTTCTTATGGGCCAGAGCTTGG - Intergenic
1190976566 X:55408727-55408749 GCTGCTTAGTAGCCACATGTAGG - Intergenic
1194343895 X:92738703-92738725 ACTTCTTATAGGCCACATGAGGG - Intergenic
1200652246 Y:5855359-5855381 ACTTCTTATAGGCCACATGAGGG - Intergenic