ID: 1114501536

View in Genome Browser
Species Human (GRCh38)
Location 14:23172687-23172709
Sequence ACCAAAAGTGTCTCCAGATA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 2, 2: 42, 3: 78, 4: 209}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114501536_1114501541 23 Left 1114501536 14:23172687-23172709 CCGTATCTGGAGACACTTTTGGT 0: 1
1: 2
2: 42
3: 78
4: 209
Right 1114501541 14:23172733-23172755 TACCAGCACCTCGTGTGCAGAGG 0: 1
1: 0
2: 1
3: 11
4: 138
1114501536_1114501538 -9 Left 1114501536 14:23172687-23172709 CCGTATCTGGAGACACTTTTGGT 0: 1
1: 2
2: 42
3: 78
4: 209
Right 1114501538 14:23172701-23172723 ACTTTTGGTTGTCACAATGAGGG 0: 1
1: 4
2: 35
3: 180
4: 623
1114501536_1114501540 -5 Left 1114501536 14:23172687-23172709 CCGTATCTGGAGACACTTTTGGT 0: 1
1: 2
2: 42
3: 78
4: 209
Right 1114501540 14:23172705-23172727 TTGGTTGTCACAATGAGGGTGGG 0: 1
1: 2
2: 9
3: 68
4: 319
1114501536_1114501537 -10 Left 1114501536 14:23172687-23172709 CCGTATCTGGAGACACTTTTGGT 0: 1
1: 2
2: 42
3: 78
4: 209
Right 1114501537 14:23172700-23172722 CACTTTTGGTTGTCACAATGAGG 0: 1
1: 11
2: 80
3: 358
4: 942
1114501536_1114501539 -6 Left 1114501536 14:23172687-23172709 CCGTATCTGGAGACACTTTTGGT 0: 1
1: 2
2: 42
3: 78
4: 209
Right 1114501539 14:23172704-23172726 TTTGGTTGTCACAATGAGGGTGG 0: 1
1: 4
2: 33
3: 169
4: 478

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114501536 Original CRISPR ACCAAAAGTGTCTCCAGATA CGG (reversed) Intronic
900195025 1:1371718-1371740 ACCACAGATGTCTCCAGATGCGG + Intergenic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901096129 1:6681763-6681785 ACCAAGAGGGTCTCTAGACAGGG + Intronic
901533245 1:9866730-9866752 TCCAAAAGTCTCTCCAGCTGTGG + Intronic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902110790 1:14076603-14076625 ACCCAAAATGCTTCCAGATATGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
903429786 1:23286521-23286543 AGCAAAAGCGTCTCCAGAGGAGG - Intergenic
904474335 1:30755207-30755229 ACCAAAAATGTCTCTAGTTATGG - Intronic
904929656 1:34076522-34076544 ACCACAAATTTCTCCAGATGTGG + Intronic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
907364616 1:53947576-53947598 ACCAAAAGTGTCTGCAGCCTTGG + Intronic
910368952 1:86495916-86495938 ATCAAAAATGTCTCCATATGTGG + Intronic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
913265802 1:117042670-117042692 TCCAAAAGTGTCTCCAAACAGGG + Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
917340328 1:173970078-173970100 ACCAGAAGTGTTTCAAGATTTGG + Intronic
917713871 1:177713847-177713869 AGCATAAGTGTCTTCAGACATGG - Intergenic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
921649168 1:217656401-217656423 ACCAAATGATTCTCCAGATTTGG + Intronic
922965604 1:229688546-229688568 ACCAATAATGTCTCCAGCTCTGG + Intergenic
923547834 1:234936674-234936696 AGCAAAACTGTTTCAAGATATGG - Intergenic
924164582 1:241268445-241268467 ATGAAAAATGTCTCTAGATATGG + Intronic
1067059312 10:43069800-43069822 AGCAGAAGACTCTCCAGATAGGG + Intergenic
1069025111 10:63531399-63531421 GCCAAAAATGGCTCCAGATATGG + Intronic
1071161870 10:82756123-82756145 GCCAAAGTTCTCTCCAGATATGG + Intronic
1071954683 10:90744683-90744705 ACCAAAAATCCCTCCAGAAATGG + Intronic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1075623596 10:123946180-123946202 GCCAAAGGTTTCTCCAGATTGGG - Intergenic
1075792428 10:125094612-125094634 ACCAGAGATGTCGCCAGATAGGG - Intronic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1086329275 11:85737574-85737596 ACCAAATGTGTCTCCAGAGAAGG - Exonic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1086968828 11:93058433-93058455 AACAAAAGTGGCACCAGATCAGG + Intergenic
1087823427 11:102737335-102737357 CCCAAGACTGTCTCCAGATGGGG - Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1088375391 11:109135234-109135256 AGCTAAAGTGTCCCCAGATTAGG + Intergenic
1089133183 11:116228398-116228420 ACCAGAAGGGACTCCAGATGGGG - Intergenic
1089179958 11:116576662-116576684 ACCACAAATGTCTCCAGAGTGGG - Intergenic
1089473976 11:118743502-118743524 ACCAAAAATATCTACAGATAAGG + Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1096541432 12:52309527-52309549 ACTAAAAATGTCTCTAGATGTGG + Intergenic
1099827909 12:87802271-87802293 AGCAAAAATGTTTCCAGAAATGG - Intergenic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101330789 12:103756259-103756281 ACCAAACCTTTCTCCAGATGAGG - Intronic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102401392 12:112632694-112632716 ATCAAAATTGTCTCCAGGCATGG - Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1106315339 13:28588581-28588603 TCCAAATGTCTCTCCAGAAAAGG - Intergenic
1106657645 13:31763379-31763401 ACCAAAAGTGTCTCCAGGCTGGG - Intronic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1107648943 13:42525026-42525048 ACCAAAAGAGTCTACTGCTAAGG - Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1109406709 13:61909718-61909740 ACCAAAAGTGTCACCAGCCTGGG - Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112614596 13:100990380-100990402 ACCAAACATATCTCCAGATGTGG - Intergenic
1112805040 13:103155465-103155487 ATCAGAAGGGTCTCCAGATATGG + Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1116940083 14:50782959-50782981 CCCAAAAGCGTCGTCAGATACGG + Intronic
1119252012 14:73164539-73164561 AAAAAAAGTATCTCCTGATAGGG - Intronic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1120335377 14:83148270-83148292 AACATAAGTGTGTCCAGATTTGG + Intergenic
1121520340 14:94581791-94581813 ACCAAATGTGTCTGCAGACATGG - Intronic
1122420822 14:101575996-101576018 TGCAGAAGTGTCTGCAGATATGG - Intergenic
1122432611 14:101665152-101665174 ACTAAAAGTGTCAATAGATAGGG - Intergenic
1126394830 15:48203752-48203774 ACCAAAAGTGTCTTCATCTGTGG + Exonic
1129888022 15:79052245-79052267 AAAGAAAGTGTCTCCAGAGAGGG - Intronic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131091927 15:89629975-89629997 ACCAAAAGTATCTCCAGCCATGG + Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131394191 15:92073795-92073817 AGCAAAACTGTCTTCAGACATGG + Intronic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133404347 16:5510867-5510889 ACCAGAAGTGTCTCTAGCTATGG + Intergenic
1133742794 16:8663986-8664008 ACCAAAACTGTCTCCAGCTGTGG + Intergenic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134135382 16:11673606-11673628 ACCAGAAGTGGCTCCAGACATGG + Intronic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134319921 16:13153510-13153532 ACCACAAGGTTCTCCAGAAATGG - Intronic
1134389906 16:13810076-13810098 ACCAAATGTTTTTCCAGAAATGG - Intergenic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135078653 16:19415386-19415408 ACCAAAAATGTCTTCAGGAATGG - Intronic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1137294064 16:47073409-47073431 AGCAAAACTGTCCCCAGACATGG - Intergenic
1137356205 16:47767589-47767611 ATCAAAAGTGTCTACATGTAGGG + Intergenic
1137952269 16:52794875-52794897 ACCAAAAGTGACTCCAGATGGGG + Intergenic
1140090245 16:71832332-71832354 AAAATAAGTGTCTCCAGAAATGG + Intergenic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1141178823 16:81738677-81738699 TCAAAAACTGTCTCCAGATAGGG + Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1141897151 16:86965382-86965404 TCAAACAGTGTCTCCAGAAACGG + Intergenic
1142575984 17:908006-908028 ACCACAGGTGTCTCTAGAGAGGG - Intronic
1142733941 17:1882709-1882731 AGCAAAAGTGTTTCCATAAAAGG - Intronic
1143965009 17:10750879-10750901 ATCAAAAATGTTTCCAGATGTGG + Intergenic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1151102530 17:71572328-71572350 GCCAAAAGTGTCTCCAAACATGG + Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1152751306 17:82063655-82063677 ACCAGCAGTGTCTCCAGTTGGGG + Intronic
1155785544 18:29895266-29895288 TCCAAAAATTGCTCCAGATATGG - Intergenic
1157315624 18:46587087-46587109 ACCAATATTGTCTCCTCATAGGG + Intronic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1159158252 18:64610535-64610557 AACAAAAATGTCTCCAGATGTGG + Intergenic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1163540205 19:17904336-17904358 ATCAAAATTGTTTCCAGACATGG + Intergenic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1168416948 19:56175344-56175366 AACAAAACTGTCTCCAGACTTGG + Intergenic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
927534939 2:23848003-23848025 AAAAAAAGTGTTTTCAGATATGG + Intronic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
931854147 2:66283850-66283872 CACAAAAGAGTCTCCAGTTAAGG - Intergenic
933055754 2:77662166-77662188 ACCAAAAGTTTGTCCAGCTATGG + Intergenic
935262318 2:101365897-101365919 ACCAAAAGGGTCTACTGGTAGGG - Intronic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
938663373 2:133509675-133509697 ATGAAAACTGTCTCCAGACATGG - Intronic
938828457 2:135030539-135030561 ACCAACAGTGTCTTCAGAGCTGG + Intronic
939530552 2:143355085-143355107 ACCTAAACTGTCTCCAGTTTTGG + Intronic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
940495995 2:154429375-154429397 ACTAAAACTGTCTCTATATACGG - Intronic
942264664 2:174210517-174210539 ACCAAAACTGTCTACTCATAAGG + Intronic
942773823 2:179556560-179556582 GCCAAAATTATCTCCAGACAGGG + Intronic
945018269 2:205543288-205543310 AGCAAAAGTGTTTCCTAATAAGG - Intronic
945939452 2:215933506-215933528 GCTAAGAATGTCTCCAGATATGG + Intergenic
946477647 2:220024082-220024104 ATCACAAGTGTCTTCAGAAAAGG - Intergenic
947071673 2:226294477-226294499 GCCAAAACTGTCTCCAGATTTGG - Intergenic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1173114321 20:40225587-40225609 GCCAAAACTGTCTCCACACATGG - Intergenic
1173925378 20:46777310-46777332 AACAAAATCTTCTCCAGATATGG - Intergenic
1174483770 20:50848855-50848877 AAGAAAAGAGTCTCCAGAAAGGG + Intronic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175261972 20:57680373-57680395 ACCACAAGTGTTTCCAGATATGG - Intronic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1177289645 21:19094642-19094664 AGCAAAAGTGTTTCTTGATAAGG - Intergenic
1178425337 21:32474521-32474543 AACAAAAGGGTCGCCAGAGAGGG - Intronic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179117972 21:38511889-38511911 ACCAAAACTGTCTTTAGACATGG + Intronic
1179389469 21:40974349-40974371 ACCAAAAGTGTATCCACACATGG + Intergenic
1180781861 22:18524976-18524998 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181238747 22:21464320-21464342 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1182792183 22:32962011-32962033 AACCAAAGTGTCTCAAAATATGG + Intronic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
950327547 3:12126039-12126061 ACCAAAATTGTTTACACATAAGG + Intronic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955740671 3:62088140-62088162 ACCTAAAGTGTTTCCAGACATGG - Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
956584549 3:70850627-70850649 ACCAAAAGAGTCACCATAAAAGG - Intergenic
957386656 3:79504260-79504282 ACCAAAAATGTTTCCACAAAAGG - Intronic
957526615 3:81386353-81386375 ACCAAAATTGTGTTCAGAAAGGG + Intergenic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
960683640 3:120274809-120274831 ATCAACAGTGCCTCCAGAAAAGG + Intronic
961739429 3:129023753-129023775 ACCAAAAATGTCTGCAGCTTAGG + Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
963711308 3:148750787-148750809 ACCAAAAGTGATTCCAGACATGG - Intergenic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964880710 3:161419652-161419674 ACCACAACTATCTCCAGACATGG + Intergenic
965171197 3:165266206-165266228 AACAAAAGTTTTGCCAGATATGG - Intergenic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
968984648 4:3868571-3868593 ACCAGATGTGCCTCCTGATAAGG + Intergenic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
971630378 4:28985350-28985372 ACGAAAAGCATCTCCAGACATGG - Intergenic
972385286 4:38559898-38559920 ACCCAAAGTTTCTCCAAAGATGG + Intergenic
972629279 4:40829346-40829368 CCCAAAAGTGGCTGCAGAGACGG + Intronic
973741362 4:53922454-53922476 TTCAAACGTATCTCCAGATATGG - Intronic
974784833 4:66606629-66606651 ACCAACAGTATCACTAGATATGG + Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
984385699 4:179054506-179054528 ACCAAGATTGTCTTCAGAGAGGG - Intergenic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
986670406 5:10138570-10138592 GCCAAGAGAGGCTCCAGATAAGG + Intergenic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
995434416 5:112119800-112119822 ACCACAAATCTCTCCAGAAAAGG + Intergenic
997149301 5:131475290-131475312 ACCAAAACAGTCTCCTGAGAAGG + Intronic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
1000497238 5:162000013-162000035 ATCAAAATTGTCTCCAGAAGTGG + Intergenic
1000915455 5:167075689-167075711 ACCAAAAATGTTTCCAATTATGG + Intergenic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1001673927 5:173497007-173497029 ACCAACAGTCTCTCCAGTTTTGG + Intergenic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1003967420 6:11266278-11266300 ATCCAAAATGTCTCCAGATATGG - Intronic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1004878853 6:19985312-19985334 ACCAAGTGTGTCTTCCGATAGGG - Intergenic
1004890688 6:20097663-20097685 ATGAAATGTGTCTCCAGCTATGG + Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1005648163 6:27862143-27862165 ACCAACAGTGACTACAGAAATGG + Intronic
1005880406 6:30053910-30053932 AACAAAAGGGTCCCCAGAGAAGG - Intergenic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1008232217 6:48996708-48996730 CCCCAAACTGTCCCCAGATAGGG + Intergenic
1009037698 6:58137809-58137831 AACAAAAATGTCCCCAGATATGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1010160159 6:72844359-72844381 ACCAAAGGTGACTACAGAAAAGG - Intronic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1012536382 6:100302894-100302916 TTCAAAAGTGTTTCGAGATAAGG + Intergenic
1013343243 6:109236048-109236070 ACCAGAAGTATCTCCAGACATGG + Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1014855613 6:126397054-126397076 ACCAAATGAGACACCAGATAAGG - Intergenic
1016138478 6:140577338-140577360 TCCAAAAGTATTTCCAGCTATGG + Intergenic
1018344740 6:162888660-162888682 ACCAAGTGTGTCTTCAGAAAGGG - Intronic
1019914586 7:4124567-4124589 AACAACTGTGTCTCCAAATAAGG + Intronic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1020812926 7:12867800-12867822 AAGAAAAGTGTCTGGAGATATGG + Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1024795386 7:53013290-53013312 AGCAAAAATGTCTCCACATAAGG + Intergenic
1027656747 7:80940153-80940175 ACAAAAAATGTCTCTAGATATGG + Intergenic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1028156791 7:87439071-87439093 CCCAAAAGTGTACCAAGATAAGG + Intronic
1028612991 7:92732999-92733021 ATGAAAAGTGGATCCAGATAAGG - Intronic
1029168132 7:98610486-98610508 TCCAGATCTGTCTCCAGATATGG + Intergenic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1032572123 7:133011572-133011594 ACCTAAAAGGTCTCCAGGTATGG + Intronic
1032744419 7:134771410-134771432 ATCAAGAGTGTCTCCTGTTATGG - Intronic
1034384312 7:150726005-150726027 TCCAATAGTGTCTCAAGATTTGG + Intronic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1036931357 8:12959438-12959460 ACCAGAAGTGTTTCCAGTTGTGG - Intronic
1038387604 8:27163941-27163963 ACCAAAAATGTCTTCAAATCTGG + Intergenic
1040345642 8:46490204-46490226 TCCTAAAGTCTCTCCAGCTATGG + Intergenic
1043561966 8:81503470-81503492 ACCAAAAATGCCTCAAGATTTGG - Intergenic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1047043762 8:121028237-121028259 ACCAAAAATATCTGGAGATATGG - Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1048269377 8:133016402-133016424 GCCAAAAATGTCTCCAGATGTGG + Intronic
1048503370 8:134998766-134998788 ACCAAAAGTCTTTCCAGACAGGG - Intergenic
1048823526 8:138400841-138400863 AGAAATAGTGTCTCCAAATAAGG + Intronic
1049370659 8:142263399-142263421 ACCAGAAGTGTTTGGAGATACGG - Intronic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050176975 9:2878394-2878416 CCCAACCCTGTCTCCAGATAAGG + Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1052344712 9:27397922-27397944 CCAAAAAGTGTCTCTAGACATGG + Intronic
1052883608 9:33622304-33622326 TCCAAAAATGGCACCAGATAGGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1056417018 9:86386593-86386615 ATCAAATATGTCTCCAGATCTGG + Intergenic
1057665898 9:97045235-97045257 ACCAGAAGTGTCTCAGGAAAAGG - Intergenic
1059604779 9:115822743-115822765 ATCAATAGTGTCTCCAGATAAGG - Intergenic
1059759143 9:117321875-117321897 ACCAAAACTGGCTCCAAATATGG + Intronic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060130792 9:121096904-121096926 ACAAAATGTGACTCTAGATAAGG - Intronic
1060637943 9:125214262-125214284 ACCCAAAATGTTTCCAGATATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061068952 9:128296798-128296820 GCCAAAGGTTTCACCAGATAAGG + Intergenic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1185539293 X:889336-889358 ACCAACAGTGTCTCCAAACATGG - Intergenic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186159257 X:6759578-6759600 ACCAAAAATGATTCCAGATATGG + Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186714545 X:12236889-12236911 TCCAAAAGTATCTCCAGAACTGG - Intronic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1187735366 X:22297788-22297810 ACCAAACGTGTCTCGGGATCAGG - Intergenic
1188761795 X:34041485-34041507 ACCAAAACTATTTCCAGATATGG - Intergenic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1191252813 X:58267484-58267506 ACCAAAAGTGCCCCTAGAGAGGG - Intergenic
1194613397 X:96071921-96071943 ATCAAAATTATCTCCAGAAAGGG - Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195645690 X:107228578-107228600 ACCAAAAATGCCTCCACCTAGGG - Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1198142522 X:133818943-133818965 ACCAAAAGGGTCTCCAGTCTAGG - Intronic
1198313715 X:135445529-135445551 ACTAAAAACGTCTCCAGATCTGG - Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG + Intergenic
1200801619 Y:7392443-7392465 ACCTAAACTTTGTCCAGATAGGG - Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201552963 Y:15238043-15238065 ACCAAAAATGATTCCAGATATGG + Intergenic