ID: 1114505095

View in Genome Browser
Species Human (GRCh38)
Location 14:23204794-23204816
Sequence ATTTTGATGGGGATTGTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 246}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114505095 Original CRISPR ATTTTGATGGGGATTGTGTA TGG Intronic
901683068 1:10926790-10926812 AGTTTGATTAGGATTGTGTTAGG - Intergenic
906952549 1:50346701-50346723 ATGTAGAAGTGGATTGTGTAGGG - Intergenic
908906940 1:69025471-69025493 CTTTTTCTGTGGATTGTGTAAGG + Intergenic
910742210 1:90532161-90532183 CTTTCTATGGGGATTGGGTAGGG + Intergenic
911681031 1:100715854-100715876 ATTTTGATGTGGACAGTGAAGGG + Intergenic
911797283 1:102090951-102090973 ATTTTGCTGAGGATGGTGTAAGG + Intergenic
911930851 1:103901609-103901631 ATTATAATGAGGAATGTGTATGG + Intergenic
912745602 1:112243212-112243234 ATTTTGCTGGGGAGTGGGCAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914320158 1:146551454-146551476 TTTTTAATGGGTATTGTGAATGG - Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915649208 1:157295192-157295214 CTTTGGATGGGGATTCTGTGTGG - Intergenic
917075037 1:171196327-171196349 ATTATGATGGTCTTTGTGTAAGG + Intronic
917201763 1:172524774-172524796 CTTTTGCTGGGGATGGGGTAGGG + Intergenic
917418540 1:174837351-174837373 ATTATGATGTTTATTGTGTAAGG + Intronic
918430386 1:184453988-184454010 AGGTTAATGGGAATTGTGTAGGG + Intronic
921707778 1:218344174-218344196 AATTTGATGTGTGTTGTGTATGG - Intergenic
921793407 1:219315482-219315504 ATTTTGATGAGGTAAGTGTAAGG + Intergenic
921900629 1:220446603-220446625 ATTTTGATGGGCATTTGCTAGGG + Intergenic
924749643 1:246874049-246874071 ATATTAATGGTGATTGTGTCAGG - Intronic
1064637369 10:17382692-17382714 ATTTTGATTGGCATCTTGTACGG - Intronic
1065270826 10:24031841-24031863 CTTTTGATGGAGCTTGAGTAAGG - Intronic
1065469867 10:26066610-26066632 ATTTTGTTGGAGATAGTGTTAGG - Intronic
1065511753 10:26486272-26486294 ATATTGATGGGGAGTCTGGAAGG + Intronic
1068142063 10:53021606-53021628 ATTTATAGGGGAATTGTGTACGG + Intergenic
1070395009 10:76004642-76004664 ATTTTGTTGTCGATAGTGTAGGG + Intronic
1071688998 10:87795526-87795548 AGTTGGATGGGGAGTGTGTGGGG + Intronic
1071689437 10:87800776-87800798 ATTTTGATTGGCATTTTCTACGG - Intronic
1071841280 10:89474307-89474329 ATTTTGTTTGGGTTTGGGTAAGG - Intronic
1071999548 10:91181096-91181118 ATTTTTATGGCAATTGTGCATGG + Intronic
1074583140 10:114740413-114740435 ATTTTGCTTGGGACTGTGTAGGG + Intergenic
1076397710 10:130153467-130153489 ATTTGGATGGGGTTTCTGTGTGG + Intronic
1078254568 11:9646987-9647009 ATTTTGATGGAGAGAGTGGAGGG + Intergenic
1079583480 11:22095612-22095634 ATTGTGATGGCCTTTGTGTATGG + Intergenic
1079838031 11:25359261-25359283 CTTTTGAAGGGGAGTGTTTATGG - Intergenic
1079915013 11:26358594-26358616 ATTTTTATGTGTATTGTGTTTGG + Intronic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1082576792 11:54816270-54816292 ATTTTGGTAGGGTCTGTGTAGGG - Intergenic
1083048968 11:59760088-59760110 AGAGTGATGGGGATTGAGTAGGG + Intronic
1083375673 11:62218330-62218352 ATTTTGTTGAGAATGGTGTATGG - Intergenic
1085968360 11:81556270-81556292 ATTTTGGTGGGGCTTTTGTGGGG - Intergenic
1086363356 11:86082270-86082292 ATTTTGATTGGGATTGCATTGGG + Intergenic
1086533672 11:87816350-87816372 ATTTTGGTGGGGCTTTTGTGGGG + Intergenic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1087068652 11:94052187-94052209 ATTTTGATAGGGATTGCTTTGGG + Intronic
1088799445 11:113291942-113291964 ATTTTGATCTTGATTATGTAGGG - Intergenic
1089267272 11:117273719-117273741 AGTTTTAAGGGGATTGTGGAAGG + Intronic
1091316795 11:134619721-134619743 ATTTTGGTGTGTATTGTCTAAGG + Intergenic
1092586687 12:9907914-9907936 ATTTTGCTGAGGATGGTGTAAGG + Intronic
1093480203 12:19596511-19596533 AATTTGATGGTGATTGTGCTTGG + Intronic
1097626279 12:62004582-62004604 AGTTTGATGGGGAATGTGATAGG + Intronic
1098187268 12:67910805-67910827 ATTGGGATAGGGATTATGTATGG + Intergenic
1099104281 12:78480286-78480308 ATTTTGCTGAGAATGGTGTAGGG - Intergenic
1099253614 12:80289067-80289089 CTTTGGATGGGGATTTTGTATGG + Intronic
1099413429 12:82359236-82359258 AATGTGGTAGGGATTGTGTAAGG + Intronic
1099620379 12:84996201-84996223 ATTTTTAAGGGGATTGTGAAGGG - Intergenic
1101259653 12:103015223-103015245 GTTTTGTTGGGCATTGTGGAAGG - Intergenic
1101776389 12:107798334-107798356 ATTTTGAGGGGGGTTGTTTTAGG - Intergenic
1102969387 12:117154263-117154285 AGTGTGATGGGGATGGTGTAAGG - Intronic
1103559119 12:121783155-121783177 ACTTAGATGAGGATGGTGTAGGG - Intronic
1105659045 13:22472624-22472646 GTTTTGATGGAGATTATGTTGGG + Intergenic
1108013210 13:46044141-46044163 ATTTTTTTGGGGGTAGTGTATGG - Intronic
1108073527 13:46654392-46654414 ATTTTGTTGGGTATGGTGAAGGG + Intronic
1112242263 13:97694058-97694080 ATTTTGAGGGGGATTATTTCAGG - Intergenic
1112650618 13:101393034-101393056 ATTTGGATAAGAATTGTGTATGG + Intronic
1114009866 14:18355214-18355236 ATCTTGCTGAGAATTGTGTAAGG - Intergenic
1114505095 14:23204794-23204816 ATTTTGATGGGGATTGTGTATGG + Intronic
1116733446 14:48656312-48656334 ATTTTCATGAGAATTGTATAAGG - Intergenic
1117830246 14:59742994-59743016 ATTTTGATGTGGGATGTATATGG + Intronic
1118416347 14:65540930-65540952 ATTTTGATGGATATTGGGGATGG + Intronic
1119339712 14:73866529-73866551 ATTTTGATAGGGATTTTGATAGG + Intronic
1121183970 14:91950550-91950572 ATTTTGGAGGGCATTGTGTAGGG - Intergenic
1127783179 15:62333453-62333475 ATTTTGAAGGCCATTGTATATGG - Intergenic
1128120232 15:65140648-65140670 ATTTTTAAGGGGGTTGTGGAGGG - Intergenic
1129003651 15:72354441-72354463 ATTTTCATGGGGCTTCTGCAGGG - Intronic
1130658807 15:85813638-85813660 ATTTTGTTTGGGATTTTTTATGG - Intergenic
1131360964 15:91790022-91790044 AATTTCATGGGGATTTTGTAAGG + Intergenic
1131986053 15:98043807-98043829 GTTTCCATGGTGATTGTGTAAGG - Intergenic
1134017825 16:10901638-10901660 AGTCTGATGGGGATGGTGCATGG + Intronic
1137875617 16:51993922-51993944 AATTTGCTGGGTACTGTGTAAGG + Intergenic
1139828032 16:69772990-69773012 ATTTTGATGGAGTTTGAGAAGGG + Intronic
1140013367 16:71158619-71158641 TTTTTAATGGGTATTGTGAATGG + Intronic
1140119089 16:72067870-72067892 ATTTTGCTGAGAATGGTGTAAGG - Intronic
1140494712 16:75374954-75374976 AATTTGGTGGGGTTTTTGTAAGG - Intronic
1140686668 16:77440382-77440404 ATTTTCATGAGGATTGAATAAGG + Intergenic
1141351153 16:83298406-83298428 ATTTTGATGCCTATTGTCTAAGG - Intronic
1142256610 16:89017130-89017152 ATTTTGATGTGAACTGTGGATGG - Intergenic
1145226743 17:21135942-21135964 ATTTTGATGGGCATCTTCTATGG + Intronic
1145714733 17:27009007-27009029 ATTTTCGTGGGCATTGTGCACGG - Intergenic
1145749805 17:27347335-27347357 ATTTTGATGAGTATTGTCTTTGG - Intergenic
1149184650 17:53983157-53983179 ATTTTGATGGGGACTCTGTGTGG - Intergenic
1149231980 17:54545023-54545045 CTTTGGATGGGGTTTCTGTAGGG - Intergenic
1156074871 18:33262333-33262355 TGTTTGATTGGGATTGTGTATGG - Intronic
1157349533 18:46872242-46872264 ATTTTGCTGAGGATAGTGTAAGG - Intronic
1157526019 18:48383194-48383216 TTTGTGAGGGGGATTCTGTAAGG - Intronic
1157890525 18:51412143-51412165 ATTTTTCTGGGTATTGTGTGTGG - Intergenic
1163241901 19:16069316-16069338 TTTCTGATGGGGTGTGTGTATGG + Intronic
1166513039 19:43423657-43423679 ATTTTGATTGGGATTGTTTGAGG + Intergenic
924967732 2:93264-93286 CTTTAGATGGGGTTTCTGTATGG - Intergenic
926329747 2:11814638-11814660 AATTTGATGGGGTGTGTGTAGGG + Intronic
927160093 2:20248858-20248880 CTTTTGATAGGGATTGTTTCTGG - Exonic
929848190 2:45555073-45555095 ATTTTTAAGGGGATCGTGGAGGG - Intronic
931581580 2:63781196-63781218 ATTTGGACTGGGATTGAGTATGG - Intronic
931944140 2:67286439-67286461 ATCTTGATGGGCTTTGTGTCTGG + Intergenic
932865777 2:75340266-75340288 ATAGTAATGGGGCTTGTGTAAGG + Intergenic
933126012 2:78607054-78607076 ATTTTGATGGCCTTTGTGCAAGG + Intergenic
933478060 2:82817903-82817925 ATTTTGCTGGGGCTTTTGTGGGG - Intergenic
933636025 2:84709764-84709786 ATTTTGATTGGTTTTGTTTAGGG + Intronic
934494035 2:94782076-94782098 ATTTTAATGGGGAATGTTAAAGG - Intergenic
935142845 2:100369149-100369171 ATTTTTAAGGGGATTATGAAGGG + Intergenic
935283537 2:101541943-101541965 TGTTTGATAGGGATTGTGTTAGG + Intergenic
938027606 2:127963954-127963976 ATCTTGATTGGGATAGTGTTAGG + Intronic
938774154 2:134526372-134526394 ATTTTGGTGGGGCTTCTGTGGGG - Intronic
939099607 2:137880692-137880714 CCTTGGATGGTGATTGTGTAAGG - Intergenic
939510085 2:143094363-143094385 ACTTTGATGGGGCTTTTGTGGGG + Intronic
940422305 2:153494234-153494256 ATTTGGATTGGAATTGTGTTGGG - Intergenic
941146201 2:161849153-161849175 ATTTTCATGGCTATTGTGAATGG + Intronic
941255512 2:163226225-163226247 AATTTCATGGGTATTATGTATGG + Intergenic
941404098 2:165068059-165068081 ATTATGTTGGGGTTTGTGTGTGG + Intergenic
942618044 2:177815046-177815068 ATTTAGATGGGACTAGTGTATGG + Intronic
943836937 2:192525448-192525470 CTTTGGATGGGGTTTCTGTATGG - Intergenic
944074307 2:195710817-195710839 ATTTTGAAGGGGCTTGTGGAAGG + Intronic
944093826 2:195944460-195944482 ATTGTAATGGTGCTTGTGTAGGG - Intronic
944170359 2:196769520-196769542 AGTTTGTTGGTGATGGTGTAAGG + Intronic
944171524 2:196784190-196784212 ATTTTGATGGAATTTGTGGAAGG - Intronic
944657670 2:201891939-201891961 ATATTGTTGGGGGGTGTGTAGGG - Intronic
944764470 2:202850116-202850138 CTTTGGATGGGGTTTTTGTATGG - Intronic
946390731 2:219415525-219415547 ATTTGGATGGGTAGTGTATATGG - Intergenic
947552742 2:231058007-231058029 ATTTTTATGAGGATTGGTTAAGG + Intronic
1169176752 20:3522886-3522908 CTTTGGATGGGGTTTCTGTATGG - Intronic
1169421222 20:5462555-5462577 CTTTTGATGGGGTTTTTGTGTGG + Intergenic
1169500319 20:6153640-6153662 ATTTTGGTGGCTATTGTGAATGG + Intergenic
1170496449 20:16929757-16929779 ATTGTGAAGGGGATTGTGAAGGG + Intergenic
1170525018 20:17228168-17228190 ATTTTGAGGGGGATTCCCTACGG + Intronic
1171413336 20:24960939-24960961 ATCTTGATGGAGTTTCTGTAAGG + Intergenic
1173041351 20:39466569-39466591 ATTTTGACGGGTATTGTTTGTGG - Intergenic
1173109321 20:40170788-40170810 ATTTTAAGATGGATTGTGTAGGG + Intergenic
1173633421 20:44533460-44533482 ATTGTGATGAGAATTGTGAAAGG + Intronic
1174347056 20:49937743-49937765 ATTTAGATGGGGATGGTATTTGG - Intronic
1177179211 21:17726684-17726706 GTTTTGAAGGGGAATCTGTACGG + Intergenic
1177552498 21:22643856-22643878 ATGTGGATGGGTATTGAGTAAGG - Intergenic
1179633216 21:42691404-42691426 ACTTTGATGGTGATGGTGAAAGG - Intronic
1180434364 22:15286023-15286045 ATCTTGCTGAGAATTGTGTAAGG - Intergenic
1183738160 22:39655228-39655250 ATTATGATGGGGATGGTGCTGGG + Intronic
1184064739 22:42111762-42111784 ATTTTGCTGAGAATGGTGTATGG + Intergenic
1184757324 22:46524426-46524448 GTTGTCATGGGGATTGTGCAGGG - Intronic
949371715 3:3341852-3341874 ATTCTAATGAGGATTGAGTATGG + Intergenic
952594934 3:35005789-35005811 ACTTTTAAGGGGATTGTGGAGGG + Intergenic
955069663 3:55561588-55561610 ATTTTGATGGGGAATGAATGTGG + Intronic
955119030 3:56037019-56037041 CTTTGGATGGGGTTTTTGTAGGG - Intronic
955921006 3:63955317-63955339 ATTCTGCTGGGAAATGTGTAAGG + Intronic
956162062 3:66365715-66365737 ATTTTAATAGAGATTGTGTCAGG - Intronic
957731285 3:84140803-84140825 ATTTTGTTGGCGAGTGTGTAGGG + Intergenic
957790334 3:84932562-84932584 ATTTTGCTGGGGATTGGGAGTGG - Intergenic
958618015 3:96521067-96521089 ATTTTGGTAGGGATGGTGAATGG + Intergenic
960827984 3:121812245-121812267 CTTTGGATGGGGATTTTGTGTGG - Intronic
961198322 3:125022880-125022902 ATTTTGATGGGAATGTTGAATGG - Intronic
962772755 3:138628403-138628425 ATATTGAAGGGCATTTTGTATGG + Intronic
962991726 3:140583501-140583523 AGTTGGATGGGGATCCTGTATGG - Intergenic
963584455 3:147166678-147166700 ATTCTGATGGGAAATGAGTATGG - Intergenic
964327226 3:155560770-155560792 ATTTTGGTGGGGAATGTGCTGGG - Intronic
965729374 3:171754549-171754571 ATTTTGATGAGGATAGTTTATGG - Intronic
966060775 3:175751852-175751874 GTTTTTATGGGGTTTTTGTAGGG + Intronic
967347808 3:188477963-188477985 ATTTTGATGCAGATTGAGGATGG + Intronic
969831761 4:9803296-9803318 ATTTTGATGGTGATGATATACGG + Intronic
970689360 4:18604390-18604412 ATTCTGATGGGGGATGTGTGGGG - Intergenic
970760075 4:19474790-19474812 TTTTTGATTGCCATTGTGTATGG + Intergenic
971516747 4:27496783-27496805 CTTTGGATGGGGTTTGTGTAGGG - Intergenic
971883352 4:32410339-32410361 CTTCGGATGGGGATTTTGTATGG - Intergenic
972372345 4:38437367-38437389 TTTTGGATGGGGTTTTTGTAGGG + Intergenic
972379128 4:38502732-38502754 ATTGTGTTGGGTATTTTGTATGG + Intergenic
972762988 4:42124987-42125009 ATTCTCATGGGGATTGTCCATGG + Intronic
973545025 4:51972895-51972917 CTTTGGATGGGGTTTGTGTGGGG + Intergenic
975355348 4:73396099-73396121 AATTAGATGGGGGTTGTGGAGGG + Intergenic
975479433 4:74860787-74860809 CTTTGGATGAGGATTTTGTATGG - Intergenic
978816571 4:112912930-112912952 ATGTTGATGGGGGTGGTGTGGGG + Intronic
980200697 4:129652481-129652503 CTTTGGATGGGTTTTGTGTATGG - Intergenic
981002004 4:139837183-139837205 ATTTTGATAGGGATGGTGTTGGG - Intronic
984458500 4:180002128-180002150 AATTTAATGGGGATTATGTTGGG - Intergenic
985083218 4:186287626-186287648 ATGTTTATGTGTATTGTGTATGG + Intronic
985397351 4:189558016-189558038 ATTTGGGTGGGGATGGTGGAAGG - Intergenic
985581630 5:699104-699126 AATTTGATAGAGATTGTGTTGGG - Intergenic
986044579 5:4024872-4024894 ATATTGATGGGGATTATGAGAGG + Intergenic
986430412 5:7675203-7675225 ATTTTGTTAGGTATTGTATAGGG + Intronic
986920421 5:12673434-12673456 CTTTGGATGGGGTTTGTGTGTGG + Intergenic
988719317 5:33859984-33860006 ATTTGGATGGGGTTTTTGTTTGG - Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
990377167 5:55182784-55182806 AATTTGATGAGGATTGAGAAAGG - Intergenic
991242439 5:64475029-64475051 CTTTTGATGGGGTTTTTGTGTGG - Intergenic
994426017 5:99587967-99587989 TTTTTGATCGGGGTTGGGTAGGG - Intergenic
994798480 5:104338318-104338340 ATTTTTCAGGGGATTGTGTTAGG - Intergenic
995464519 5:112436903-112436925 CTTTGGATGGGGTTTTTGTATGG - Intergenic
996198981 5:120646598-120646620 AGTTGGATGGTGATTGAGTAAGG + Intronic
997902737 5:137782665-137782687 ATTTTGATGGCCTTTGTGCAAGG - Intergenic
999058483 5:148607953-148607975 ATTCTGATTGGGATTCTCTAGGG - Intronic
999352327 5:150885665-150885687 ATTTTTATGGCAATTGTGAAAGG + Intronic
1000051272 5:157564868-157564890 AATTTGATGGGGATCTTGTAAGG + Intronic
1000874573 5:166620109-166620131 ATTTGGATGGGGAAAGTGAAGGG + Intergenic
1003350029 6:5307998-5308020 ATTTATATGGGGATTTTTTAAGG + Intronic
1003625479 6:7737459-7737481 ATTTTTATGGGGTCTGTTTAGGG + Intronic
1005659343 6:27979008-27979030 ATTTGGATGGGGAGTTTGCATGG - Intergenic
1007664587 6:43506768-43506790 ATCTTTATGGGGCTAGTGTAAGG + Intergenic
1007815767 6:44524578-44524600 ATTTTGATAGGGATTGTGAAAGG + Intergenic
1008789542 6:55213715-55213737 ATTCTGATGGGGATGGGGTGTGG + Intronic
1008853791 6:56056319-56056341 ATTTTGATGAGGACTTTGGAGGG - Intergenic
1009975406 6:70666508-70666530 ATTTAGATGGGGACTGGGGAGGG - Intergenic
1010454070 6:76034830-76034852 ACTTTGCTTGGGATTGGGTACGG - Intronic
1010547038 6:77171805-77171827 ATTTTCATGGCAATTGTGAATGG + Intergenic
1010566786 6:77425425-77425447 AGTTTGAAGGGGAATGTCTATGG + Intergenic
1011870971 6:91892221-91892243 ATGTTTAAGGGGATTGTGGAGGG - Intergenic
1012195105 6:96331921-96331943 ATTTTGGTGGAGATACTGTAAGG + Intergenic
1012778120 6:103522866-103522888 ATTTGGATGGGGTTTCTGTGTGG - Intergenic
1014092528 6:117420204-117420226 ATTTTGGTGGAGATTATGGAAGG - Intronic
1014298728 6:119653051-119653073 ATTATGATGGGGAGTGGGGAAGG + Intergenic
1014426533 6:121313507-121313529 ATTTGGAAGAGGAATGTGTAGGG - Intronic
1014660102 6:124159322-124159344 ATTTTGATTGCGATGGGGTATGG + Intronic
1014960434 6:127677090-127677112 ATTTTGCTGAGGATTGTCTTGGG + Intergenic
1017526682 6:155247280-155247302 ATTTTTGTGGGTATGGTGTAGGG + Intronic
1018556544 6:165056966-165056988 CTTTTGAAGGGTAATGTGTAGGG - Intergenic
1019771330 7:2885422-2885444 GTTTTGATGGGGACTGTGGCTGG + Intergenic
1020102864 7:5404717-5404739 GTTTTGATGGGGATTGCATATGG - Intronic
1021322413 7:19227833-19227855 CTTTGGATGGGGATTTTGTGTGG - Intergenic
1026376330 7:69754593-69754615 TTTCAGATGGGGATTGTGTGGGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027171837 7:75878355-75878377 ATTTTAAAGGGCATTGTGAAGGG + Intronic
1028218088 7:88160145-88160167 ATTTTTATGGCAATTGTGAATGG - Intronic
1029744979 7:102511827-102511849 ATTTTGTTGTGAATTTTGTACGG - Intronic
1029762971 7:102610988-102611010 ATTTTGTTGTGAATTTTGTACGG - Intronic
1030427480 7:109397591-109397613 ATGCTGTTGGGGATTGTGTTAGG + Intergenic
1030857147 7:114573581-114573603 ACTTTGATAGGCATTATGTAGGG - Intronic
1030941982 7:115662470-115662492 ATTTTGATGGAAATTATGAAGGG - Intergenic
1031455268 7:121971428-121971450 ATTTTTATGGGGAGTGTTGAGGG + Intronic
1031881876 7:127207534-127207556 ATTATGATGGGGATTGTCAATGG - Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1035988628 8:4462796-4462818 ATTTTTTTGTGGATAGTGTAAGG - Intronic
1037847171 8:22293962-22293984 ATTTTGATGGGCATTGACTAGGG + Intronic
1037847271 8:22294686-22294708 ATTTTGATGGTCATTGACTAGGG + Intronic
1038205706 8:25462911-25462933 ACTTTGATAGGGATTGCTTAGGG - Intronic
1039627774 8:39072493-39072515 TTTTTTTTGGTGATTGTGTAGGG + Intronic
1043458449 8:80435765-80435787 ATTTTGATGTGGAAAGTGTTTGG + Intergenic
1043510088 8:80942203-80942225 ATTTTGATGAGGATTGCATTAGG + Intergenic
1044599180 8:93986466-93986488 TTTTTACTGGGGAATGTGTATGG + Intergenic
1044923121 8:97186554-97186576 ATTTAGTTGGGGATAGTGAAGGG - Intergenic
1045723994 8:105149522-105149544 ATTGTGATGATGATTGTGGATGG - Intronic
1046014728 8:108591041-108591063 CTTTGGATGGGGTTTTTGTATGG - Intergenic
1048260443 8:132940590-132940612 AGCTTGATGGGGAGGGTGTAAGG + Intronic
1048265933 8:132985938-132985960 ATTTTGCAGGGGGTTGTGGAGGG + Intronic
1052577437 9:30307712-30307734 ATTTTGTTGCTGATAGTGTATGG - Intergenic
1052583847 9:30398211-30398233 ATTACCATTGGGATTGTGTAGGG - Intergenic
1052628435 9:31005709-31005731 CTTTGGATGGGGATTTTGTGTGG - Intergenic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1053663034 9:40297928-40297950 ATTTTAATGGGGAATGTTAAAGG + Intronic
1053664480 9:40307999-40308021 ATTTTAATGGGGAATGTTAAAGG + Intronic
1054375159 9:64444152-64444174 ATTTTAATGGGGAATGTTAAAGG + Intergenic
1054520134 9:66068285-66068307 ATTTTAATGGGGAATGTTAAAGG - Intergenic
1054521582 9:66078356-66078378 ATTTTAATGGGGAATGTTAAAGG - Intergenic
1054858987 9:69930535-69930557 ATTTTGCTGAGAATGGTGTATGG + Intergenic
1054884805 9:70185047-70185069 TTTTGGATGGGGATTTTGTGTGG + Intronic
1055692136 9:78844507-78844529 ATTTTGATAGGGATTGCATTAGG + Intergenic
1055902053 9:81251529-81251551 ATTTGTATGTGGATAGTGTAAGG + Intergenic
1059529370 9:115021688-115021710 ATTTTGATAGGGGTTTGGTATGG + Intronic
1061787257 9:133037252-133037274 ATTTTGCTGAGGAGGGTGTAAGG + Intronic
1061905994 9:133698361-133698383 ATTTTGATAGGGACTGTGTTAGG - Intronic
1203663322 Un_KI270754v1:3272-3294 ATTTGGGTGGGGATGGTGGAAGG + Intergenic
1185747101 X:2582569-2582591 ATTTTAATGGAGAATGTGGAGGG + Intergenic
1187152666 X:16695194-16695216 GTTTTGATGGGGATTCTCTGGGG + Intronic
1189083193 X:37995353-37995375 ATTTACATGGAGATTGTGTTGGG + Intronic
1192724551 X:73734680-73734702 ATTTTGGTGGGTATTGTAAATGG + Intergenic
1192865190 X:75123569-75123591 ATTTTTATAGGGATTGTGTTGGG + Intronic
1193113655 X:77755502-77755524 CTTTTGATGGGGTTTTTGTGTGG + Intronic
1194886930 X:99327677-99327699 ATTTTGATGGGCATTTTCTATGG - Intergenic
1197332824 X:125175381-125175403 ATTTTAAAGAGGACTGTGTATGG - Intergenic
1197801103 X:130349923-130349945 CTTTTTTTGGGGATTGTGAAGGG + Intronic
1199516161 X:148677816-148677838 ATTTTGGTGGAGTTGGTGTAGGG + Intronic
1202050999 Y:20780749-20780771 ATTTTGTTGGGAATTTTGTTTGG + Intronic
1202087291 Y:21152323-21152345 CTTTTGATGAGGTTTGTGAAGGG + Intergenic