ID: 1114510505

View in Genome Browser
Species Human (GRCh38)
Location 14:23256052-23256074
Sequence GAGCCAGACTGGACTATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 162}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114510505_1114510516 23 Left 1114510505 14:23256052-23256074 CCTCCCATAGTCCAGTCTGGCTC 0: 1
1: 0
2: 0
3: 18
4: 162
Right 1114510516 14:23256098-23256120 GTTTATGCACTTACGACCCTTGG 0: 1
1: 0
2: 0
3: 2
4: 27
1114510505_1114510510 -5 Left 1114510505 14:23256052-23256074 CCTCCCATAGTCCAGTCTGGCTC 0: 1
1: 0
2: 0
3: 18
4: 162
Right 1114510510 14:23256070-23256092 GGCTCCCTGGAGTTCCACAGTGG 0: 1
1: 0
2: 1
3: 15
4: 188
1114510505_1114510511 -4 Left 1114510505 14:23256052-23256074 CCTCCCATAGTCCAGTCTGGCTC 0: 1
1: 0
2: 0
3: 18
4: 162
Right 1114510511 14:23256071-23256093 GCTCCCTGGAGTTCCACAGTGGG 0: 1
1: 0
2: 1
3: 15
4: 177
1114510505_1114510512 -3 Left 1114510505 14:23256052-23256074 CCTCCCATAGTCCAGTCTGGCTC 0: 1
1: 0
2: 0
3: 18
4: 162
Right 1114510512 14:23256072-23256094 CTCCCTGGAGTTCCACAGTGGGG 0: 1
1: 0
2: 1
3: 30
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114510505 Original CRISPR GAGCCAGACTGGACTATGGG AGG (reversed) Intronic
900353344 1:2247798-2247820 GAGCCAGACTGGACTCGGGCTGG - Intronic
901058564 1:6460987-6461009 GAGCCAGAGTGGACTCGGGAGGG + Intronic
903425594 1:23251821-23251843 GAGCAACTCTGGACCATGGGAGG + Intergenic
903770118 1:25758541-25758563 GAGCCAGCCTGGCCAAAGGGGGG + Intronic
906688721 1:47778926-47778948 GTCCCAGCCTGGACTGTGGGGGG - Intronic
915876158 1:159613838-159613860 GAACCAGAAGGGGCTATGGGAGG - Intergenic
916684325 1:167130947-167130969 GAGCCAAACTGGTCTATATGTGG - Intergenic
918267653 1:182860366-182860388 AAGCTAAACTGGACTATGTGAGG + Intronic
919774729 1:201187103-201187125 GAGCCAGACAGGACCATTGAGGG - Intergenic
922540440 1:226414865-226414887 GAGCCAGCAGGGACTGTGGGAGG - Intergenic
922566504 1:226604964-226604986 GAGCCAGAGTGAGCTGTGGGTGG + Exonic
923505722 1:234604886-234604908 GAGTCTGACTGGCCTTTGGGTGG - Exonic
923919697 1:238549533-238549555 GAGCCAAACTGGACCAGGGAAGG - Intergenic
1069851423 10:71407607-71407629 GAGCCAGCCTGGCCAATGGCGGG - Intronic
1069862490 10:71480348-71480370 AAGCCAGGCTGTACTCTGGGAGG + Intronic
1070713834 10:78703156-78703178 GAGCCAGACAGGACAAGGTGAGG - Intergenic
1072749583 10:97968114-97968136 GAGCCAGAATGGATTATGAAAGG + Intronic
1074531822 10:114303650-114303672 GACGCAGCCTGGACTAGGGGAGG - Intronic
1075619957 10:123919149-123919171 GACCCAGACTGGACCCTGGGTGG + Intronic
1077270685 11:1678208-1678230 GTGCCAGCCTGGGCCATGGGTGG + Intergenic
1079130913 11:17746473-17746495 GAGCCTGGCTGGCCTTTGGGAGG - Intronic
1079596494 11:22255404-22255426 AAGCCAGACTGGAATATGAATGG + Exonic
1081651091 11:44824585-44824607 AAGCCAGACAGGACAATGGGAGG + Intronic
1081691032 11:45078700-45078722 CAGCCAGACTGGCCCATGGCGGG + Intergenic
1083784005 11:64933637-64933659 GAGGGAGTCTGGACTGTGGGGGG + Intronic
1084111077 11:67014609-67014631 GACCCAGACTGGACAATAAGGGG + Intronic
1084241817 11:67826455-67826477 TAGCCAGACAGGGCTGTGGGAGG - Intergenic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1086459920 11:86996178-86996200 GAGCCAGCATGGTCTTTGGGAGG - Intergenic
1087386164 11:97471533-97471555 GAGGCTGACTGGTCTGTGGGTGG - Intergenic
1089064913 11:115655423-115655445 AAGGCAGACTGGACCAGGGGAGG + Intergenic
1089366680 11:117924909-117924931 GAGGCAGACTGAACTCTGGAAGG + Intronic
1090462902 11:126907787-126907809 GAGCCAGAGGGGAGAATGGGAGG - Intronic
1090557770 11:127895430-127895452 GAGTCATACTGGACTATGCCTGG - Intergenic
1091750805 12:3020359-3020381 GAGCAAGACTGGATTCTGGAGGG - Intronic
1091826967 12:3520080-3520102 GAGCCAGGCTGGGCCAGGGGAGG + Intronic
1091971180 12:4788369-4788391 GAGCCAGACTAGCCTGTGGCTGG - Intronic
1097744409 12:63285539-63285561 GAGCCTGAGTGGACTAAGTGGGG + Intergenic
1097798578 12:63888933-63888955 CAGCCAGAATGGACCATGAGTGG + Intronic
1100572730 12:95858466-95858488 TAGCCAGACTAGACTAGGGGCGG - Intergenic
1102284032 12:111640674-111640696 GAGCCTGACTGTACTAGGAGAGG + Intergenic
1104958928 12:132479024-132479046 GGGCCAGAGTGGACTGTAGGAGG + Intergenic
1105275612 13:18921435-18921457 GAGCCAAACTGGAGTTTGTGTGG + Intergenic
1106779064 13:33038380-33038402 CAGCCAGAGTCCACTATGGGGGG + Intronic
1107676765 13:42805856-42805878 GAGCCTGAGTGGACTAAGTGGGG + Intergenic
1112288106 13:98121887-98121909 GAGCAAGACTGGACACTGAGGGG + Intergenic
1113808233 13:113122264-113122286 GTGCCAGCCTGGCCTGTGGGAGG + Intergenic
1114510505 14:23256052-23256074 GAGCCAGACTGGACTATGGGAGG - Intronic
1116396465 14:44452915-44452937 GGGGCAGAGTGGGCTATGGGTGG + Intergenic
1116618705 14:47172101-47172123 GAGCAAGCCTGGGCTATGGTGGG - Intronic
1118280881 14:64427478-64427500 TAGTGAGACTGGACCATGGGTGG + Intronic
1120918033 14:89727357-89727379 GCTCCAGACTGGAGTCTGGGAGG - Intergenic
1121846661 14:97178023-97178045 GAGACAGACTGGAGGATGAGAGG + Intergenic
1122302558 14:100739223-100739245 GAGCCAGAGAGGACCTTGGGTGG - Intergenic
1123008334 14:105335097-105335119 GACCCAGCCTGGACAATGGCCGG + Intronic
1123759756 15:23423128-23423150 GAGCCAGAAAGGAATCTGGGAGG - Intergenic
1129271383 15:74421057-74421079 GCACCAGACAGGACTCTGGGTGG + Intronic
1131375594 15:91920443-91920465 GAGCCAGAATGGAGTATTGGAGG + Intronic
1131904044 15:97121663-97121685 GAGACACTGTGGACTATGGGTGG + Intergenic
1133108063 16:3526987-3527009 GAGCCATTCTGGATTATGGGGGG - Intronic
1136222362 16:28836507-28836529 GGGCCAGACTGGGGTGTGGGGGG + Intronic
1138375542 16:56561289-56561311 GAGGCAGACAAGACTGTGGGAGG + Intergenic
1144370996 17:14591712-14591734 GACCCACACTGGACTTTGTGTGG - Intergenic
1146160543 17:30557158-30557180 GGGCCAGACTGGAACATGGGGGG + Exonic
1146328483 17:31907126-31907148 GAGCCAGTCTGGAAAATGAGAGG + Intergenic
1146843853 17:36171657-36171679 GGGCCAGACTGGAACATGTGGGG - Intronic
1146856159 17:36259592-36259614 GGGCCAGACTGGAACATGTGGGG - Intronic
1146864460 17:36328783-36328805 GGGCCAGACTGGAACATGTGGGG + Intronic
1146872066 17:36383503-36383525 GGGCCAGACTGGAACATGTGGGG - Intronic
1146879428 17:36434588-36434610 GGGCCAGACTGGAACATGTGGGG - Intronic
1146883354 17:36455731-36455753 GGGCCAGACTGGAACATGTGGGG - Intergenic
1147067318 17:37929371-37929393 GGGCCAGACTGGAACATGTGGGG + Intronic
1147074952 17:37984127-37984149 GGGCCAGACTGGAACATGTGGGG - Intronic
1147078851 17:38008932-38008954 GGGCCAGACTGGAACATGTGGGG + Intronic
1147086477 17:38063673-38063695 GGGCCAGACTGGAACATGTGGGG - Intronic
1147094788 17:38132867-38132889 GGGCCAGACTGGAACATGTGGGG + Intergenic
1147102420 17:38187636-38187658 GGGCCAGACTGGAACATGTGGGG - Intergenic
1147239870 17:39083676-39083698 GGGCTAGACTGGACCAAGGGAGG - Intronic
1147962449 17:44176421-44176443 GAGACAGAGTAGACTGTGGGAGG + Intronic
1148795286 17:50194083-50194105 GAGGCAGACAGGACAATGGCAGG + Intronic
1148802510 17:50240080-50240102 GAGCCAGACTCAAATATGGCAGG - Intergenic
1148872762 17:50668420-50668442 GAGACACACTGGCCTACGGGAGG - Exonic
1149846996 17:60014112-60014134 GGGCCAGACTGGAACATGTGGGG - Intergenic
1150085352 17:62270719-62270741 GGGCCAGACTGGAACATGTGGGG - Intergenic
1154467235 18:14658565-14658587 GAGCCAAACTGGAGTTTGTGTGG + Intergenic
1157275199 18:46305284-46305306 GAGCAAGGCTGGAAAATGGGTGG - Intergenic
1158868431 18:61660728-61660750 GAGCCTCACTGGGCTTTGGGTGG + Intergenic
1159955989 18:74518960-74518982 GAGCCAGACTTGACCAGGGAAGG + Exonic
1165323882 19:35102846-35102868 GAGCCTGCCTGGAGTATGGGAGG - Intergenic
1166393819 19:42424626-42424648 AAGACAGACTGGCCTCTGGGCGG + Intronic
1167389868 19:49187904-49187926 GAGCCAGACTACAGTCTGGGTGG + Intronic
1168522150 19:57060910-57060932 GAACCAGACTGGAGCAGGGGAGG - Intergenic
925064931 2:922325-922347 CAGCCAGCCTGGACTCAGGGTGG + Intergenic
928219880 2:29394956-29394978 GAGGCAGACTGGACTGAAGGAGG - Intronic
931456616 2:62414526-62414548 TAGCCTGAGTGGACTCTGGGTGG + Intergenic
931769520 2:65485758-65485780 GAGGCAGCTTGCACTATGGGAGG - Intergenic
932692104 2:73921731-73921753 GAGTAAGACTGGAGTAGGGGTGG - Intergenic
933576202 2:84071208-84071230 GAGTCAGAGTGGACTAGGTGGGG + Intergenic
935250539 2:101256354-101256376 GAGGAAGTATGGACTATGGGTGG + Intronic
944524005 2:200599703-200599725 GATCCAGAGTGGGCTCTGGGTGG - Exonic
948462543 2:238137312-238137334 GAGCTGGACTGGGCTATGGCTGG + Intergenic
948462552 2:238137355-238137377 GAGCTGGACTGGGCTATGGCTGG + Intergenic
949050023 2:241892681-241892703 GTGTCAGACTGGACTTTTGGGGG - Intergenic
1172007104 20:31825038-31825060 CAGGCAGAGGGGACTATGGGAGG + Intronic
1172273656 20:33668234-33668256 GAGTCAGGCTGGACTGGGGGGGG + Exonic
1172880002 20:38193771-38193793 GAGCCAAACTCAGCTATGGGTGG - Intergenic
1175889461 20:62309909-62309931 GAGCCAGGCGGGACTCTGGGTGG - Intronic
1176237874 20:64062750-64062772 GACCCAAACTGGGCTCTGGGAGG + Intronic
1176807278 21:13499114-13499136 GAGCCAAACTGGAGTTTGTGTGG - Intergenic
1178939016 21:36889553-36889575 AAGGCAGACTGAACTCTGGGAGG + Intronic
1179630940 21:42678407-42678429 GAGCCAGGCAGGAGTGTGGGAGG - Intronic
1181452274 22:23031475-23031497 GAGCCAGACAGGAATAAAGGTGG - Intergenic
1181956024 22:26588878-26588900 CTGCCAGACTGGGCTGTGGGTGG - Intronic
1182253481 22:29020683-29020705 GAGCCCACCTGGACTCTGGGAGG - Intronic
1183274687 22:36886329-36886351 GAGGTAGACAGGACTATGTGTGG - Intergenic
1183401442 22:37607366-37607388 GAGCCAGACTGGAATCGGGGAGG - Intergenic
1183489803 22:38110333-38110355 GAGCCAGGCTGGGCCAGGGGTGG - Intronic
1184534875 22:45079598-45079620 GAGCAAGGCTGGACTGTGGAGGG - Intergenic
1185281733 22:49972584-49972606 GAGCCAGACTGGAGGAGGTGGGG - Intergenic
1185379721 22:50502858-50502880 GAGCCTGACTGTGCTCTGGGCGG + Intergenic
950154013 3:10708602-10708624 GGGCCAGACTGGAGGCTGGGGGG - Intergenic
952461937 3:33536654-33536676 GAGTGAGAGTGGACTATAGGAGG + Intronic
953563301 3:44011600-44011622 GGACCAAACTGGACTGTGGGAGG - Intergenic
954146397 3:48636383-48636405 AAGCCAGACTGACCTTTGGGAGG - Intergenic
954458938 3:50615466-50615488 GAGCCAGAAAGGACTAGGAGAGG + Intronic
956839038 3:73120245-73120267 CACCCAGGCTGGACTATAGGAGG + Intergenic
961168658 3:124780524-124780546 GAGCCAGAATGGACTCCCGGAGG - Intronic
962551831 3:136501398-136501420 CAGCCATACTGGAGTAGGGGAGG + Intronic
962625227 3:137219545-137219567 GAGCCAGAAAGGACTCTGAGAGG + Intergenic
963037124 3:141040431-141040453 CAGGCAGAGTGGACTTTGGGTGG + Intergenic
963806359 3:149726924-149726946 GACCCATACTGGGCCATGGGAGG - Intronic
963923787 3:150930237-150930259 GAGGGAGGCTGGACTGTGGGGGG + Intronic
967962706 3:194938825-194938847 CAGCCAGTCTGGACGATGGGTGG - Intergenic
968972182 4:3801756-3801778 GTTCCCGACTGGACAATGGGCGG + Intergenic
969265194 4:6059842-6059864 GAGCCAGAGAGGGCTCTGGGTGG - Intronic
971519927 4:27536707-27536729 AAGCCATACTGGACTAGGGTGGG + Intergenic
975405738 4:73987353-73987375 GAGCCACACTGAAGGATGGGAGG - Exonic
982381491 4:154753904-154753926 CTGCCAGACTTGACTATGTGTGG + Intergenic
982546199 4:156736316-156736338 CACTCAGGCTGGACTATGGGAGG + Intergenic
990446666 5:55899543-55899565 GAGCCAGACCAGACTTTGGATGG + Intronic
991164421 5:63547003-63547025 GAGGATGACTGGACTATGGGAGG - Intergenic
992367935 5:76112430-76112452 CAGCCAGACTGGCCTCTGAGAGG - Intronic
992586307 5:78243776-78243798 GAGCCAGACTGGAGTAAGTGAGG + Intronic
994646150 5:102471260-102471282 GAGCAAGACTGGAAAATAGGTGG - Intronic
995411352 5:111860545-111860567 GAGAGAGACTGGACTCTGGGAGG - Intronic
998199441 5:140107928-140107950 GAGCCGGACTTGCCCATGGGAGG + Intronic
999863714 5:155678125-155678147 TAGCTAGACTGAACTAGGGGAGG + Intergenic
1000523463 5:162326815-162326837 GAGCCAATCTGAACTCTGGGAGG + Intergenic
1002107674 5:176888185-176888207 GGGCCAGACTGAGCTATGGGAGG - Intronic
1007647716 6:43395774-43395796 GAGCCAGGCTGGGCCAGGGGAGG + Intergenic
1014392347 6:120878122-120878144 AAGCCAGACTGGAATAGGTGAGG - Intergenic
1018854052 6:167662923-167662945 GAGCCAGCCTGGGTTCTGGGTGG + Intergenic
1019921111 7:4163761-4163783 GAGCCAGGCTGGGCTGTGGGTGG + Intronic
1022498984 7:30870950-30870972 GAGGCACACTTGACTCTGGGAGG - Intronic
1024610165 7:51057510-51057532 AAGGCAGGCTGGACTACGGGAGG - Intronic
1032515892 7:132505972-132505994 GAGCCAGACTGGAGAATGGAGGG - Intronic
1034269116 7:149795172-149795194 GAGACAGGCTGGAGTAGGGGAGG - Intergenic
1034781471 7:153886451-153886473 GCGCCAGACTGGGCTGCGGGAGG + Intergenic
1037883904 8:22586281-22586303 GTGCCAGGCTGGCCTCTGGGTGG - Intronic
1038714560 8:29980316-29980338 GAGCCAGCCTGGGATATGTGAGG + Intergenic
1046059413 8:109118787-109118809 GAGCCAGAGTTGGCTATAGGGGG + Intronic
1049318474 8:141982619-141982641 GGGTCAGTGTGGACTATGGGCGG - Intergenic
1049435457 8:142584228-142584250 GAGACAGACTGGAGGCTGGGAGG + Intergenic
1049967915 9:796034-796056 GAGCCAGCCTGAGCTCTGGGAGG - Intergenic
1055872897 9:80905536-80905558 GAACCAGACTCGAATATGGCAGG + Intergenic
1056397701 9:86196592-86196614 CAGCCATACTGGACTACTGGGGG - Intergenic
1056691655 9:88813286-88813308 AAGCCAGAATGCACTATGAGAGG - Intergenic
1057914878 9:99047885-99047907 GGGCCAGGCTGGTCTGTGGGCGG + Intronic
1058849123 9:108993408-108993430 CAGTCAGCCTGGACTTTGGGTGG + Intronic
1062083898 9:134638696-134638718 CAGCCAGACGTGACTCTGGGAGG + Intergenic
1062445059 9:136590150-136590172 GGGCCAGAAGGGACTCTGGGAGG + Intergenic
1062630447 9:137460899-137460921 GAGCCAGACAGAACCAGGGGTGG - Intronic
1185844706 X:3427172-3427194 GAGCAAGACAGGAGGATGGGAGG - Intergenic
1186458849 X:9732361-9732383 GAAACATACAGGACTATGGGTGG + Intronic
1187422864 X:19151420-19151442 GAGCAAAACTGGACTAGGGAAGG - Intergenic
1188434867 X:30148509-30148531 GAGGCAGACAGGCCTCTGGGCGG + Intergenic
1188809870 X:34640214-34640236 GAGCCAGAATGGACTCTGAATGG + Intronic
1190947698 X:55111800-55111822 GAGCCAGATGGCCCTATGGGGGG + Intronic
1192497994 X:71629080-71629102 GAGGCAGACTGGCCTGGGGGTGG - Intergenic
1199641617 X:149867920-149867942 GAGCCAGACTAGACCATGGAAGG - Intergenic
1199769628 X:150966303-150966325 GAGCCAGGCGGGACGCTGGGGGG + Intergenic