ID: 1114515010

View in Genome Browser
Species Human (GRCh38)
Location 14:23293517-23293539
Sequence GAGAACCCACTTACCTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114515007_1114515010 -2 Left 1114515007 14:23293496-23293518 CCCTGGACAATAAGCCATGGAGA 0: 1
1: 0
2: 1
3: 14
4: 137
Right 1114515010 14:23293517-23293539 GAGAACCCACTTACCTCTCCTGG 0: 1
1: 0
2: 1
3: 21
4: 233
1114515008_1114515010 -3 Left 1114515008 14:23293497-23293519 CCTGGACAATAAGCCATGGAGAG 0: 1
1: 0
2: 1
3: 8
4: 122
Right 1114515010 14:23293517-23293539 GAGAACCCACTTACCTCTCCTGG 0: 1
1: 0
2: 1
3: 21
4: 233
1114515005_1114515010 7 Left 1114515005 14:23293487-23293509 CCACAGAGACCCTGGACAATAAG 0: 1
1: 0
2: 1
3: 11
4: 175
Right 1114515010 14:23293517-23293539 GAGAACCCACTTACCTCTCCTGG 0: 1
1: 0
2: 1
3: 21
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114515010 Original CRISPR GAGAACCCACTTACCTCTCC TGG Intronic
900135457 1:1115511-1115533 GAGAACCCCCTCCCCTCCCCAGG + Intronic
900692942 1:3992697-3992719 GAGAGCCCACCTTCCCCTCCTGG - Intergenic
904682585 1:32239855-32239877 GGGAGGCCCCTTACCTCTCCAGG + Intergenic
907173148 1:52490948-52490970 GCGAAATCTCTTACCTCTCCTGG + Intronic
907215122 1:52856538-52856560 GACAAGTCACTTACCTCTCTGGG - Intronic
907961146 1:59283131-59283153 GATCTCCCACTTACCTCTTCTGG - Intergenic
908095216 1:60730479-60730501 GAGATTCCCCTTACCTTTCCAGG + Intergenic
908662108 1:66447973-66447995 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
911993684 1:104735920-104735942 GAGAACCCACTCACCCGTCTAGG - Intergenic
913173610 1:116254457-116254479 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
915074288 1:153296134-153296156 GAGAATTCCCTTCCCTCTCCAGG + Intergenic
915364965 1:155309855-155309877 GGGAACCCAGCCACCTCTCCCGG - Exonic
915642714 1:157241585-157241607 GAGAACCCCCTTCCCTTTCCAGG + Intergenic
916145106 1:161731319-161731341 GAGAATCCTCTTCCCTCTCCAGG + Intergenic
920939977 1:210473075-210473097 GAGAATCCCCTTCCCTTTCCAGG - Intronic
922047941 1:221964935-221964957 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
922075179 1:222236450-222236472 GAGAATCCTCTTCCCTTTCCAGG - Intergenic
922166534 1:223120152-223120174 GAGAATCCCCTTCCCTTTCCAGG + Intronic
922784621 1:228276775-228276797 GAGAACCCACCGACCTTCCCGGG - Intronic
923218441 1:231871459-231871481 GAGAACCCACTTAGCACTATGGG - Intronic
923277564 1:232411371-232411393 CAGAACCCACTGTCCTCTGCAGG + Intronic
924517490 1:244778992-244779014 GGGAAGTCACTTACCTCTCTTGG - Intergenic
924852395 1:247843567-247843589 GAGAATCCCTTTCCCTCTCCAGG + Intergenic
1063102707 10:2964287-2964309 GAGAACCCCCTTCCCTTTCCAGG + Intergenic
1064184847 10:13152714-13152736 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
1064306817 10:14174732-14174754 AAGAACCCAGTTAACTATCCAGG - Intronic
1064520234 10:16193307-16193329 GAGAACACCCTTCCCTTTCCAGG + Intergenic
1064549682 10:16486609-16486631 GACAGCCTACTTACCTATCCAGG - Exonic
1067399253 10:45955985-45956007 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
1067867572 10:49925201-49925223 GAGAATCCCCTTCCCTTTCCAGG + Intronic
1068483636 10:57628068-57628090 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
1070778281 10:79122923-79122945 AGCAACCCACATACCTCTCCTGG - Intronic
1071036402 10:81251872-81251894 GAAAACCCCCTTCCCTTTCCAGG + Intergenic
1073561042 10:104497183-104497205 GAGAATCCCCTTTCCTTTCCAGG - Intergenic
1073604641 10:104881834-104881856 GAGAAGCCACTTTACTCTCTGGG + Intronic
1074189874 10:111126395-111126417 GAGAACCCACTGACCCATGCAGG + Intergenic
1075101664 10:119510426-119510448 CAGATCCCAGTCACCTCTCCAGG + Intronic
1077461637 11:2713723-2713745 GAGAACCCAGATTCCTCCCCAGG - Intronic
1077776699 11:5280078-5280100 GTGAACCCTTTTAGCTCTCCTGG + Intronic
1079979705 11:27137050-27137072 GAGAACCTAATTACCACTCAAGG - Intergenic
1080762795 11:35268788-35268810 GGGAAGCCACTAATCTCTCCAGG - Intronic
1080823997 11:35832601-35832623 GAGAGCTCCCTTACCTCTTCTGG + Intergenic
1080881721 11:36327559-36327581 GAGAATCCTCTTCCCTTTCCAGG + Intronic
1083682341 11:64357409-64357431 GAGAACCCCCTGCCCTGTCCAGG + Exonic
1084006342 11:66325523-66325545 GGGACCCCACTTCCCTCTCGTGG + Intergenic
1087993993 11:104780956-104780978 GAGAACCCTCTTCCCTTTCTAGG - Intergenic
1088834518 11:113566729-113566751 GAGCACCCAGTTTCCTCTGCTGG + Intergenic
1089219307 11:116857796-116857818 GAGGAGACACTTACCTCTGCTGG + Exonic
1089630192 11:119779592-119779614 GAGACCCCACTTCCCTGTTCTGG - Intergenic
1089833053 11:121346001-121346023 GAGATCCCACTTCATTCTCCTGG + Intergenic
1091736230 12:2924313-2924335 TAGAGCCCACTTCCCTCTCCTGG - Intronic
1091975539 12:4821761-4821783 GAGAACCCACGTCCTTCTGCAGG - Intronic
1093794741 12:23297972-23297994 GAGAACTCTCTTAAATCTCCAGG + Intergenic
1098601105 12:72332470-72332492 GAGAACCCACTTATCACCCAGGG + Intronic
1101586374 12:106089157-106089179 GAAAACCCGCTGCCCTCTCCAGG - Intronic
1102124236 12:110467753-110467775 GAGACCCCACTTTACCCTCCTGG + Intronic
1103031246 12:117615142-117615164 GAGCACCCACTCTCTTCTCCTGG + Intronic
1104355353 12:128080393-128080415 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
1104530578 12:129566679-129566701 GAGAATCCCCTTCCCTTTCCAGG + Intronic
1104537971 12:129636208-129636230 GATAATCCCCTTCCCTCTCCAGG - Intronic
1106397428 13:29394611-29394633 GAGAATCCCCTTCCCTTTCCAGG - Intronic
1107810655 13:44196922-44196944 CTGACCCGACTTACCTCTCCTGG + Intergenic
1107889568 13:44902533-44902555 GAGAACTCACCTAGCTCTCTAGG - Intergenic
1109342539 13:61079449-61079471 GAGAACCCCCTTCCCTTTCCAGG + Intergenic
1113809367 13:113128940-113128962 GAGAACCCCCTTACCATTCCAGG - Intronic
1113919444 13:113898864-113898886 GAGACCACACTTACCTCTGATGG - Intergenic
1113919455 13:113898918-113898940 GAGACCACACTTACCTCTGATGG - Intergenic
1113919466 13:113898972-113898994 GAGACCACACTTACCTCTGATGG - Intergenic
1113919477 13:113899026-113899048 GAGACCACACTTACCTCTGATGG - Intergenic
1113919488 13:113899080-113899102 GAGACCACACTTACCTCTGATGG - Intergenic
1113919499 13:113899134-113899156 GAGACCACACTTACCTCTGATGG - Intergenic
1113919509 13:113899188-113899210 GAGACCACACTTACCTCTGATGG - Intergenic
1113919519 13:113899242-113899264 GAGACCACACTTACCTCTGATGG - Intergenic
1113919530 13:113899296-113899318 GAGACCACACTTACCTCTGATGG - Intergenic
1113919541 13:113899350-113899372 GAGACCACACTTACCTCTGATGG - Intergenic
1113919552 13:113899404-113899426 GAGACCACACTTACCTCTGATGG - Intergenic
1113919563 13:113899458-113899480 GAGACCACACTTACCTCTGATGG - Intergenic
1113919574 13:113899512-113899534 GAGACCACACTTACCTCTGATGG - Intergenic
1113919585 13:113899566-113899588 GAGACCACACTTACCTCTGATGG - Intergenic
1113919596 13:113899620-113899642 GAGACCACACTTACCTCTGATGG - Intergenic
1113919606 13:113899674-113899696 GAGACCACACTTACCTCTGATGG - Intergenic
1113919616 13:113899728-113899750 GAGACCACACTTACCTCTGATGG - Intergenic
1113919627 13:113899782-113899804 GAGACCACACTTACCTCTGATGG - Intergenic
1113919638 13:113899836-113899858 GAGACCACACTTACCTCTGATGG - Intergenic
1113919649 13:113899890-113899912 GAGACCACACTTACCTCTGATGG - Intergenic
1113919660 13:113899944-113899966 GAGACCACACTTACCTCTGATGG - Intergenic
1113919671 13:113899998-113900020 GAGACCACACTTACCTCTGATGG - Intergenic
1113919681 13:113900052-113900074 GAGACCACACTTACCTCTGATGG - Intergenic
1113919691 13:113900106-113900128 GAGACCACACTTACCTCTGATGG - Intergenic
1113919702 13:113900160-113900182 GAGACCACACTTACCTCTGATGG - Intergenic
1113919713 13:113900214-113900236 GAGACCACACTTACCTCTGATGG - Intergenic
1113919724 13:113900268-113900290 GAGACCACACTTACCTCTGATGG - Intergenic
1113919735 13:113900322-113900344 GAGACCACACTTACCTCTGATGG - Intergenic
1113919745 13:113900376-113900398 GAGACCACACTTACCTCTGATGG - Intergenic
1113919755 13:113900430-113900452 GAGACCACACTTACCTCTGATGG - Intergenic
1113919765 13:113900484-113900506 GAGACCACACTTACCTCTGATGG - Intergenic
1113919778 13:113900538-113900560 GAGACCCCACTTACCTCTGATGG - Intergenic
1113919790 13:113900592-113900614 CAGACCCCACTTACCTCTGATGG - Intergenic
1114515010 14:23293517-23293539 GAGAACCCACTTACCTCTCCTGG + Intronic
1118105770 14:62657756-62657778 GAGAACCCACTTCCCTTTCCAGG + Intergenic
1118387909 14:65271923-65271945 GATACCTCACTTACCTCTCCTGG - Intergenic
1119424000 14:74524283-74524305 CACACCCCACTGACCTCTCCTGG - Intronic
1124204341 15:27704278-27704300 GAGCACCCACTTCCCGCTGCAGG - Intergenic
1124898655 15:33801419-33801441 GAGAATCCCCTTCCCTTTCCTGG - Intronic
1126127320 15:45307496-45307518 GAGAATGCACTTACTCCTCCAGG - Intergenic
1127078170 15:55348523-55348545 GAGAACTCACTTACTACTCCAGG - Intronic
1130714025 15:86314156-86314178 GAGAAGGAACTGACCTCTCCTGG + Intronic
1130812443 15:87394089-87394111 AAGAACCTACTCACCTCTCAGGG + Intergenic
1132585145 16:702901-702923 GAGGACCCCCTTCCCTCTCTTGG - Intronic
1134001886 16:10789261-10789283 GAGAACCCCCTTCCCTTTCCAGG - Intronic
1134846046 16:17441557-17441579 GAGTACCAACTTACTTCTCCTGG + Intronic
1136289555 16:29263226-29263248 GAGAATCCTCTTCCCTTTCCAGG - Intergenic
1137767701 16:50990937-50990959 GGAAAGCCACTTCCCTCTCCAGG - Intergenic
1138264346 16:55649686-55649708 AAGAACCCACCTACCCTTCCGGG - Intergenic
1138369515 16:56515381-56515403 GCAAACCCATTTACCTGTCCTGG - Intronic
1141826764 16:86486155-86486177 CAGAACCCACTTCCCTCTCATGG + Intergenic
1142095292 16:88236206-88236228 GAGAATCCTCTTCCCTTTCCAGG - Intergenic
1144144077 17:12380534-12380556 GAGAACCCCCTTCCCTTTCTAGG + Intergenic
1145021823 17:19437878-19437900 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
1146121999 17:30203848-30203870 GAGAACCTTCTTATCTTTCCTGG - Intronic
1146941612 17:36847496-36847518 GATAACCCCCTTATCTCTCCAGG - Intergenic
1148951818 17:51319921-51319943 GAGAATCCCCTTCCCTTTCCTGG - Intergenic
1153432981 18:5039020-5039042 GAGAATCCTCTTCCCTTTCCAGG - Intergenic
1153724316 18:7939992-7940014 CTGAACACACTGACCTCTCCAGG + Intronic
1154250141 18:12737588-12737610 GCGAACCCGCTTTCCTTTCCCGG + Intergenic
1155850514 18:30768757-30768779 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
1156185684 18:34660536-34660558 GAGAATCCCCTTCCCTTTCCAGG + Intronic
1156378938 18:36539951-36539973 GAGAGCCCACTTAATTCTTCAGG - Intronic
1159995800 18:74962672-74962694 CAGCACCCTCTTCCCTCTCCTGG + Intronic
1160051685 18:75439673-75439695 GAGAACCCAGCTACCCATCCCGG + Intergenic
1160084551 18:75763575-75763597 GAGAACCAAATTGCCTCTTCCGG + Intergenic
1160498374 18:79388296-79388318 GAGACCCCACTGGCCTCCCCTGG - Intergenic
1160543772 18:79639551-79639573 GAGAATCCTCTTCCCTTTCCAGG + Intergenic
1160582982 18:79898325-79898347 GAGACCCCATTGGCCTCTCCTGG + Intronic
1163826747 19:19528407-19528429 AGCAGCCCACTTACCTCTCCAGG + Intronic
1165634632 19:37330431-37330453 GTGCACCCACTTTCCTCTCAGGG + Intronic
1168103769 19:54154649-54154671 GAGAACTCAGTCCCCTCTCCTGG + Intronic
1168584205 19:57579343-57579365 GAGAATCCCCTTTCCTCTCCAGG - Intronic
926382488 2:12304269-12304291 GAGAGCCCTCTTCCCTTTCCAGG + Intergenic
927472299 2:23385520-23385542 GAGGACCGACTTCCCTCTCCCGG + Exonic
928604797 2:32935806-32935828 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
931197566 2:60067043-60067065 GACCACCAACTTACCTCTTCTGG - Intergenic
934940237 2:98495859-98495881 GAGAATCCCCTTCCCTTTCCAGG - Intronic
938661833 2:133494867-133494889 GAGAATCCCCTTCCCTTTCCAGG + Intronic
938682915 2:133710580-133710602 GAACACCCAATTACCTCTCAAGG - Intergenic
938905568 2:135832880-135832902 AAGAAGCCACTTGCCTCTGCTGG - Intronic
941085702 2:161115080-161115102 GGGAACTCACTTCCCTCTCTGGG + Intergenic
942605055 2:177681968-177681990 GAGAATCCCCTTCCCTTTCCAGG + Intronic
944301444 2:198129184-198129206 GAGAAGCCCCTTCCCTTTCCAGG + Intronic
944720528 2:202418858-202418880 GAGAATCCCCTTCCCTTTCCAGG - Intronic
944763900 2:202844946-202844968 TAGAAGCCACTTACATTTCCTGG + Intronic
947814731 2:233028952-233028974 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
1168767487 20:391571-391593 GAGACCACACTCACCTCTCACGG - Exonic
1169575908 20:6960961-6960983 GAGAACCCATTTACTTCCCTTGG - Intergenic
1170481486 20:16769430-16769452 CAGAACTCACTTACCCCTGCAGG + Intronic
1172566880 20:35937658-35937680 GAGAACCTCCTTTCCTTTCCAGG - Intronic
1172752138 20:37258419-37258441 CAGAACCCACCTTGCTCTCCCGG + Intronic
1173746469 20:45441207-45441229 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
1174123511 20:48285707-48285729 GAGAACCTACTGTCCTCCCCAGG + Intergenic
1174236260 20:49094955-49094977 GACAACACACTTACCCTTCCTGG - Exonic
1174543223 20:51306033-51306055 GAGAATCCTCTTCCCTTTCCAGG - Intergenic
1175180977 20:57147244-57147266 GAGAACTCACTCACCTCTGAAGG - Intergenic
1175181348 20:57149853-57149875 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
1175586769 20:60147342-60147364 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
1178247492 21:30968009-30968031 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
1179129407 21:38621307-38621329 GAGAGCGCACTTTCCTCTCCAGG + Intronic
1179547717 21:42123929-42123951 GAAAACCCACTTTCCCCACCTGG - Intronic
1180258170 21:46648611-46648633 GAGACCCCACTCACCGCTCTAGG - Exonic
1183103100 22:35595986-35596008 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
1185035222 22:48472148-48472170 GAGAAGCCACTCTCCACTCCTGG + Intergenic
952138727 3:30454785-30454807 GAGCAGCCTCTTCCCTCTCCAGG - Intergenic
952174491 3:30846913-30846935 CATAACTCACTTGCCTCTCCTGG + Intronic
952854565 3:37758410-37758432 GAGAACCAACTTAGCATTCCTGG - Intronic
953048466 3:39317105-39317127 GAGAATCCCCTTCCCTTTCCTGG + Intergenic
955463850 3:59215576-59215598 TAGAAACAACTTATCTCTCCTGG + Intergenic
955909793 3:63848170-63848192 GAGAATCCCCTTCCCTTTCCAGG + Intronic
956463573 3:69496337-69496359 GAGGACCCACTTTCTGCTCCAGG + Intronic
960744669 3:120873966-120873988 GAGAATCCCCTTACTTTTCCAGG - Intergenic
961094175 3:124140635-124140657 GTGAAGCCACTTCCCTGTCCAGG - Intronic
962722439 3:138187998-138188020 GAGCGCCCACTCAGCTCTCCCGG + Intronic
962749217 3:138421008-138421030 TAGAACCCTCTTTCCTTTCCAGG - Intergenic
963756426 3:149239309-149239331 GAGAATCCTCTTCCCTTTCCAGG - Intergenic
965699090 3:171441063-171441085 GAGAACCCATCTATCTCTCCAGG + Intronic
966491483 3:180532095-180532117 GAGACCCCACTTAGGTCTGCAGG - Intergenic
966754320 3:183354326-183354348 GAGAATCCCCTTCCCTTTCCAGG + Intronic
969857883 4:10014632-10014654 GAGGCCCCACTGACCTCCCCAGG + Intronic
970058146 4:11999181-11999203 GAGAACTCACTCACCTCTGAGGG + Intergenic
972565941 4:40269085-40269107 GAGAATCCTCTTCCCTTTCCAGG + Intergenic
972841655 4:42937433-42937455 GTGAACACACTTAGCTCTCTTGG - Intronic
973543257 4:51955348-51955370 GAAGACCCTCTTTCCTCTCCAGG - Intergenic
975059807 4:69983906-69983928 GAGAATCCCCTTACCTTTTCAGG - Intergenic
975703012 4:77084523-77084545 GAGAATCCCCTTTCCTTTCCAGG - Intergenic
979202732 4:117997848-117997870 GACAGCTCACTTACCTTTCCTGG + Intergenic
981903291 4:149891279-149891301 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
982009471 4:151092849-151092871 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
983268296 4:165531085-165531107 GAGAACTCACTTATCACTCTGGG + Intergenic
984640318 4:182157759-182157781 TGGAACGCCCTTACCTCTCCTGG - Intronic
984689794 4:182713866-182713888 GAGACACCACTTACCTGTGCAGG - Intronic
985207745 4:187558409-187558431 GAGAAAACACTTAACTTTCCTGG + Intergenic
986550998 5:8955515-8955537 GAGACCCTACACACCTCTCCAGG - Intergenic
986689546 5:10302892-10302914 GAGAATCCCCTTCCCTTTCCAGG + Intronic
987486599 5:18534181-18534203 GAGAATCCACTTCCCTTTCTAGG + Intergenic
988109586 5:26800825-26800847 GACAACTCACTTTCCTTTCCTGG - Intergenic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
990255332 5:53962935-53962957 GAGAAAATACTTAACTCTCCAGG + Intronic
990513864 5:56514445-56514467 GAGAACTCACTTACCTCCAAGGG - Intronic
991314272 5:65282511-65282533 GAGAATCCCCTTCCCTTTCCAGG - Intronic
992017588 5:72591711-72591733 CAGACCCTCCTTACCTCTCCAGG - Intergenic
992541890 5:77774318-77774340 GAGAACCCTCTTCCCTGTCCAGG + Intronic
996612529 5:125399683-125399705 CAGAACCCACATACCTTGCCTGG + Intergenic
999415089 5:151388067-151388089 GAGAACCCCCTTCCCTTTCTAGG + Intergenic
999671078 5:153959700-153959722 CAGAAGCCTCTTCCCTCTCCTGG + Intergenic
999801765 5:155045070-155045092 GAGAATCCTCTTCCCTTTCCAGG + Intergenic
999839593 5:155411057-155411079 GAGAATGTACTCACCTCTCCAGG + Intergenic
1000601008 5:163274430-163274452 GATAATCCCCTTACCTTTCCAGG - Intergenic
1001036889 5:168303403-168303425 GAGATCCCACTTTCTTGTCCAGG - Intronic
1001076989 5:168637209-168637231 GAGAAGCCCCTTCCCTTTCCAGG - Intergenic
1001144532 5:169172105-169172127 TAGCACCCATTTTCCTCTCCAGG - Intronic
1002055957 5:176598010-176598032 GAGAACCCACTTTTCCCTCTGGG + Exonic
1004920792 6:20373633-20373655 GAGACCACACTTTCCTCCCCTGG + Intergenic
1008649891 6:53551426-53551448 GAGAATCCCCTTCCCTTTCCAGG + Intronic
1013650384 6:112188702-112188724 GAGAAGCCACTTAAATCTCTTGG + Intronic
1015681667 6:135815215-135815237 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
1015751951 6:136569279-136569301 GAGAATCCCCTTCCCTTTCCAGG + Intronic
1016490727 6:144598545-144598567 GAGAATCCCCTTCCCTTTCCAGG - Intronic
1018616234 6:165689527-165689549 GAGAACTCACTTACCACCACAGG - Intronic
1018940079 6:168303394-168303416 GAGAACTCACTTAGCTCTGAGGG - Intronic
1019068475 6:169322381-169322403 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
1019897892 7:3997478-3997500 GAGAAGCTACTATCCTCTCCAGG - Intronic
1023308634 7:38858150-38858172 GAGAATCCCCTTCCCTTTCCAGG - Intronic
1024467865 7:49731878-49731900 GCAGACCCACTTACCTTTCCTGG - Intergenic
1024928781 7:54647222-54647244 GAGAAGCCTCTTCCCTTTCCGGG - Intergenic
1029355421 7:100048300-100048322 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
1033117577 7:138639302-138639324 TTGGACCCACTTACTTCTCCTGG - Intronic
1033162305 7:139008552-139008574 GAGAATCCCCTTCCCTCTCCAGG + Intergenic
1037138244 8:15489484-15489506 GAGAAACCTCTTCCCTTTCCAGG - Intronic
1037653332 8:20860919-20860941 GAGAATCCCCTTTCCTTTCCAGG + Intergenic
1037807595 8:22067082-22067104 CAGCAACCACTTACCTCCCCCGG + Exonic
1044274104 8:90280223-90280245 GAGAATCCCCTTACCTTTCTAGG - Intergenic
1044309470 8:90677005-90677027 GAGAATCCCCTTCCCTCTCCAGG - Intronic
1048357360 8:133664490-133664512 GAGAACCAGCTTGCCTTTCCAGG - Intergenic
1048777969 8:137968410-137968432 GAGAATCCCCTTCCCTTTCCGGG + Intergenic
1049202189 8:141345835-141345857 GAGTTCCCACCGACCTCTCCAGG + Intergenic
1049959926 9:728563-728585 GTGAATCCCCTTACCTGTCCAGG + Intronic
1056453142 9:86735829-86735851 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
1056824806 9:89869637-89869659 GTGAACCCACATACCTCCTCAGG - Intergenic
1057580041 9:96279596-96279618 GAGAATCCCCTTCCCTTTCCAGG - Intronic
1062162643 9:135088406-135088428 GAGAACCCACCAAGCTCCCCCGG - Intronic
1194481780 X:94435679-94435701 GAGGATCCTCTTCCCTCTCCAGG - Intergenic
1195557903 X:106248277-106248299 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
1196023342 X:111013277-111013299 GACAAGTCATTTACCTCTCCAGG - Intronic
1197164482 X:123361453-123361475 GGGAGCCCAGTCACCTCTCCTGG + Intronic
1199093007 X:143713148-143713170 TAGAACCCAATCACCACTCCAGG - Intronic
1201148302 Y:11079055-11079077 GAGAATCCCCTTACCTTTCCAGG + Intergenic
1201345959 Y:12985003-12985025 GAGAACACACTCACTTTTCCTGG + Intergenic
1202147460 Y:21814733-21814755 GAGAAACCACTTCCCTCTTGAGG - Intergenic