ID: 1114516161

View in Genome Browser
Species Human (GRCh38)
Location 14:23301608-23301630
Sequence AAGGCGAAGCGGTCGGCGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 37}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114516152_1114516161 4 Left 1114516152 14:23301581-23301603 CCCCCAATCGGCGGCGCGGGCAG 0: 1
1: 0
2: 0
3: 5
4: 36
Right 1114516161 14:23301608-23301630 AAGGCGAAGCGGTCGGCGCGCGG 0: 1
1: 0
2: 1
3: 2
4: 37
1114516155_1114516161 2 Left 1114516155 14:23301583-23301605 CCCAATCGGCGGCGCGGGCAGGC 0: 1
1: 0
2: 0
3: 0
4: 45
Right 1114516161 14:23301608-23301630 AAGGCGAAGCGGTCGGCGCGCGG 0: 1
1: 0
2: 1
3: 2
4: 37
1114516153_1114516161 3 Left 1114516153 14:23301582-23301604 CCCCAATCGGCGGCGCGGGCAGG 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1114516161 14:23301608-23301630 AAGGCGAAGCGGTCGGCGCGCGG 0: 1
1: 0
2: 1
3: 2
4: 37
1114516156_1114516161 1 Left 1114516156 14:23301584-23301606 CCAATCGGCGGCGCGGGCAGGCG 0: 1
1: 1
2: 2
3: 9
4: 59
Right 1114516161 14:23301608-23301630 AAGGCGAAGCGGTCGGCGCGCGG 0: 1
1: 0
2: 1
3: 2
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114516161 Original CRISPR AAGGCGAAGCGGTCGGCGCG CGG Exonic
900349491 1:2227968-2227990 GGGGCGGAGCGGGCGGCGCGGGG + Intergenic
902410028 1:16207039-16207061 CGGGCGCAGCGCTCGGCGCGAGG - Exonic
902658871 1:17887647-17887669 AAGCAGGAGCGGTCGGAGCGAGG - Intergenic
1090187037 11:124745727-124745749 CAGGTGAGGCGGGCGGCGCGCGG + Exonic
1090788725 11:130070898-130070920 AAGGCGAAGCGGCAGGGCCGGGG + Intronic
1094041550 12:26125260-26125282 AAGGCGATGCAGTCGGCAGGAGG + Intronic
1113031306 13:105996791-105996813 AAGGAGCAGCGGTCAGCGGGAGG - Intergenic
1114516161 14:23301608-23301630 AAGGCGAAGCGGTCGGCGCGCGG + Exonic
1115851717 14:37594869-37594891 AAGGCGAGGCGGGCGGCCGGTGG - Intronic
1116658229 14:47676011-47676033 AGGGCGAAGCGGCAAGCGCGGGG + Intergenic
1117962597 14:61178036-61178058 AAGGCACAGGGGTAGGCGCGTGG - Intergenic
1127414974 15:58749299-58749321 AAGGGAAAGCGGTCGGGGCGCGG + Intronic
1128578933 15:68795477-68795499 TAGGCTAAGCCGCCGGCGCGGGG + Intronic
1131160390 15:90101670-90101692 AAGGCGAAGGGGTGGGGGTGGGG + Intronic
1132576867 16:668324-668346 GGGGCGAGGCGGTCAGCGCGAGG - Intronic
1132868298 16:2104413-2104435 AAGGCGACGCGGTTGGGGGGAGG + Intronic
1133037714 16:3043687-3043709 AAGGAGAAGAGGTAGGCACGGGG - Intergenic
1141637126 16:85320110-85320132 AAGGAGAAGCAGTCGGGGCCGGG + Intergenic
1146759096 17:35460579-35460601 AAGGAGACGCGGCCGGCGAGAGG + Intergenic
1148860221 17:50600730-50600752 AAGGGGAACGGGTCCGCGCGTGG + Exonic
1152281767 17:79389081-79389103 GGGACGAAGCGGTGGGCGCGGGG + Intronic
1152742055 17:82022719-82022741 AAGGCACAGGGGGCGGCGCGGGG + Intronic
1160242325 18:77132693-77132715 AAGGCGAAGCAGGCTGCCCGGGG - Exonic
1160824050 19:1071268-1071290 ATGGCGCAGCCGTCGGGGCGCGG - Intronic
932329396 2:70889124-70889146 AAGGCGACGAGGTCCGCGCGAGG - Intergenic
934933209 2:98445108-98445130 GAGGCGACGCGGCCGCCGCGGGG + Intronic
937045106 2:118846978-118847000 AAGGCGCCGCGGGCGGCGAGGGG + Exonic
948405753 2:237717614-237717636 AAGGCAAAGCAGTCGGCACCAGG - Intronic
1175994161 20:62804939-62804961 ACGGCGAGGCCGCCGGCGCGAGG + Exonic
1176005793 20:62861699-62861721 AGGGCGACGCGGGCGGCGGGCGG + Exonic
1179934293 21:44592570-44592592 AAGGGGAAGCTGTGGGCCCGGGG - Intronic
1180093062 21:45542447-45542469 AAGGCGGCGCGGCGGGCGCGCGG + Exonic
956178931 3:66500354-66500376 AAGGCAAGGCGAGCGGCGCGGGG + Exonic
967924228 3:194633533-194633555 ACCGCGAAGAGGTCGGCGGGGGG - Intronic
969528790 4:7718122-7718144 AAGGCGAGGCGGTGGCCGTGCGG + Exonic
1031484323 7:122310225-122310247 AAGGCCAGCGGGTCGGCGCGGGG - Intronic
1033223622 7:139544439-139544461 AAGGCGAAGCGGTGGGTGCGTGG + Exonic
1033644307 7:143288709-143288731 AAGGCCAAGAGGTCCGCCCGCGG - Intronic
1035751951 8:2002480-2002502 GGGGCCCAGCGGTCGGCGCGCGG - Exonic
1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG + Intronic
1192444283 X:71198942-71198964 AAGGCGAAGCTGGCTGGGCGTGG - Intergenic