ID: 1114516475

View in Genome Browser
Species Human (GRCh38)
Location 14:23302823-23302845
Sequence GCTCAGAGCAGACCGCTAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 103}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114516475_1114516476 4 Left 1114516475 14:23302823-23302845 CCTGCTAGCGGTCTGCTCTGAGC 0: 1
1: 0
2: 1
3: 12
4: 103
Right 1114516476 14:23302850-23302872 GCTCAACTGCACTCACCCTCCGG 0: 1
1: 0
2: 2
3: 16
4: 242
1114516475_1114516482 26 Left 1114516475 14:23302823-23302845 CCTGCTAGCGGTCTGCTCTGAGC 0: 1
1: 0
2: 1
3: 12
4: 103
Right 1114516482 14:23302872-23302894 GTTCCAAGGCCCTCACGGCCCGG 0: 1
1: 0
2: 1
3: 38
4: 644
1114516475_1114516477 12 Left 1114516475 14:23302823-23302845 CCTGCTAGCGGTCTGCTCTGAGC 0: 1
1: 0
2: 1
3: 12
4: 103
Right 1114516477 14:23302858-23302880 GCACTCACCCTCCGGTTCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 93
1114516475_1114516480 21 Left 1114516475 14:23302823-23302845 CCTGCTAGCGGTCTGCTCTGAGC 0: 1
1: 0
2: 1
3: 12
4: 103
Right 1114516480 14:23302867-23302889 CTCCGGTTCCAAGGCCCTCACGG 0: 1
1: 0
2: 0
3: 11
4: 103
1114516475_1114516483 27 Left 1114516475 14:23302823-23302845 CCTGCTAGCGGTCTGCTCTGAGC 0: 1
1: 0
2: 1
3: 12
4: 103
Right 1114516483 14:23302873-23302895 TTCCAAGGCCCTCACGGCCCGGG 0: 1
1: 0
2: 2
3: 40
4: 686

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114516475 Original CRISPR GCTCAGAGCAGACCGCTAGC AGG (reversed) Exonic
900959184 1:5908576-5908598 GCTCAGCTCAGACCGCTGGCGGG + Intronic
901218292 1:7567031-7567053 GCTCAGAGCAGACAGCTGTTAGG + Intronic
902155207 1:14479480-14479502 GCAGAGAGCAAACCACTAGCAGG - Intergenic
903163251 1:21504008-21504030 GCTCAGAGCTGACTGCTAGGAGG + Intergenic
905359988 1:37412579-37412601 GCTCAGAACAGAGCACAAGCCGG - Intergenic
915526045 1:156476933-156476955 GGAAAGAGCAGACCTCTAGCAGG - Intronic
1064295939 10:14079251-14079273 GCTAAGAGCAGATCCCTGGCAGG - Intronic
1067567734 10:47350539-47350561 GCTCACAGCAGACCTCCAGGAGG + Exonic
1070968202 10:80542927-80542949 GCTCAGAGCACTCTGCTGGCTGG - Intronic
1071504990 10:86226813-86226835 GCTCAGGGAGGACCGCCAGCTGG - Intronic
1076599368 10:131647020-131647042 GCTGAGAGCCGGCCCCTAGCAGG + Intergenic
1079604100 11:22343656-22343678 GCTGAGGGCAGACCGGGAGCAGG + Intronic
1081701106 11:45153345-45153367 GCTCAGATCTCACCGCTATCTGG - Intronic
1082073891 11:47961639-47961661 GCTCAGAGCAGGCGGGAAGCTGG - Intergenic
1082848815 11:57747142-57747164 GCTCAGAACAGACCACTGCCTGG - Intronic
1083551037 11:63590423-63590445 GCTCAGAGCTGGCCCCCAGCCGG + Intronic
1087162605 11:94964082-94964104 GCTCAGAGCAGAACTCTGGTTGG + Intronic
1090162376 11:124509594-124509616 GCCCAGTTCAGACCGCTTGCCGG + Intergenic
1091241195 11:134053601-134053623 GCCCAGAGCAGAAAGCTTGCAGG + Intergenic
1091301285 11:134509757-134509779 GCTCACAGGAGACAGCTAGGAGG - Intergenic
1096944651 12:55391713-55391735 GCTCAGAGGAGACCAGCAGCAGG + Intergenic
1098376727 12:69823294-69823316 ACTCAGGGCAGACTGATAGCTGG - Intronic
1106300788 13:28462854-28462876 GCACAGAGCAGGCCCCTATCTGG + Intronic
1106587577 13:31070588-31070610 GCTCAGAGCAGACTTCTAGCAGG - Intergenic
1109272446 13:60269410-60269432 TCTGAGAGCAGATAGCTAGCAGG + Intergenic
1109618129 13:64863740-64863762 TCTCAGAGCAGACTGCGAGTTGG + Intergenic
1112507427 13:99983217-99983239 GCTGGGCGCAGACCGCCAGCCGG + Intronic
1113747769 13:112756808-112756830 GCTGGGAGCAGACCCCTCGCTGG - Intronic
1113896619 13:113768585-113768607 GAGCAGGGCAGACCGTTAGCAGG - Intronic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1119439458 14:74618499-74618521 ACTCAGAGCGGACCCCTAGCTGG - Intergenic
1121629036 14:95409211-95409233 CCTCAGAGCAGCCAGCTAGGCGG - Intronic
1202940900 14_KI270725v1_random:144092-144114 GCTCAGAGGAGACCCATAGTGGG - Intergenic
1126386177 15:48095678-48095700 GCTCAGAGCAGACATCAAGCTGG - Intergenic
1129947080 15:79548521-79548543 GCACAGAGCAGACCGGTAAGAGG - Intergenic
1130899202 15:88194305-88194327 GCTCAGAGCAGAGCACTTGGGGG - Intronic
1132883547 16:2172657-2172679 GCTGAGAGCTGCCCGCTTGCTGG + Intronic
1134328444 16:13228504-13228526 GCTCAGAGCAGACCTCAGACTGG + Intronic
1139490547 16:67283749-67283771 GCTCAGAGGAGAGGTCTAGCTGG + Intronic
1143057157 17:4170943-4170965 GGGCAGAACAGACCGCTGGCAGG + Intronic
1146143206 17:30387939-30387961 GCTCAGAGGAGACCGGCAGTGGG + Intronic
1146386114 17:32375044-32375066 GCTCAGAGTAAACTGCTATCTGG - Exonic
1152227799 17:79100750-79100772 GCTCAAAGCAGGCCCCTTGCCGG + Intronic
1152864171 17:82712423-82712445 TCTGAGAGCTGAACGCTAGCTGG - Intergenic
1153108820 18:1560017-1560039 GCTCAGAGCAGACAGCTCTATGG + Intergenic
1153280487 18:3410067-3410089 GCTCAGAGCAGTCTGTTGGCAGG + Intergenic
1160040627 18:75342140-75342162 GCTCAGAGCAGAGGGCAAGCTGG - Intergenic
1161666724 19:5581638-5581660 GGTCAGAGGAGACCTCTTGCAGG + Intergenic
1163908027 19:20164613-20164635 GATCAGAGCAGAACCCTAGGGGG + Intergenic
1163935512 19:20439020-20439042 GATCAGAGCAGAACCCTAGCAGG - Intergenic
1166329199 19:42069099-42069121 GCGCAGAGCAGGCCCCTAGTGGG + Intronic
1167013223 19:46822400-46822422 GCTCAGAGGAGACCGTCAGTGGG - Intergenic
926227776 2:10980701-10980723 GCCCAGAGCAGGCCCCTGGCTGG - Intergenic
929014619 2:37481971-37481993 GCTCAGAGCAGACCTCCATTGGG - Intergenic
930800607 2:55438810-55438832 GCTCAGAGGAGACCTGTAGTGGG - Intergenic
937330588 2:121025883-121025905 GCTCAGGGCAGGCCCCAAGCAGG + Intergenic
947435382 2:230068291-230068313 GTTCAGGGCAGACCGCCAGGCGG - Intronic
1170004232 20:11647480-11647502 GCTCAGAGGAAACCTTTAGCAGG - Intergenic
1171839747 20:30194705-30194727 GCTCAGAGGAGACCCATAGTGGG - Intergenic
1173718604 20:45233270-45233292 GCTCAGAGGAGACCTGTAGTGGG - Intergenic
1176096605 20:63347230-63347252 GCTGAGAGCAGACCGCTCACGGG - Intronic
1176582259 21:8542849-8542871 GCTCAGAGGAGACCCATAGTGGG + Intergenic
1179823595 21:43951591-43951613 GCACAGAGCAGGACGCCAGCTGG + Intronic
1179887926 21:44322319-44322341 GCTCTGGGCAGACCACCAGCAGG - Intronic
1180265094 22:10519897-10519919 GCTCAGAGGAGACCCATAGTGGG + Intergenic
1183732424 22:39626111-39626133 GCACAGAGCAAACCTCCAGCTGG - Intronic
1184514557 22:44954025-44954047 GCTCAGAGCAGACCCCCAGTGGG + Intronic
1184562431 22:45270924-45270946 GCTCAGAGCAGTCAGGTAGTAGG - Intergenic
1185070319 22:48652466-48652488 GCTCACAGGAGACCGCCTGCTGG + Intronic
949688114 3:6601080-6601102 GCTCAGAGCAGAGGGCTAGATGG + Intergenic
950333521 3:12175943-12175965 CCTCACAGCAGCCCGCAAGCTGG - Intronic
950336103 3:12194735-12194757 GCTCAGAGAAGACCGCACCCTGG + Intergenic
952269313 3:31816759-31816781 GCTCAGAGGAGACCCGTAGCGGG + Intronic
953578716 3:44134363-44134385 TCTCAGAGCAGAGCTCCAGCAGG + Intergenic
954709939 3:52500558-52500580 GCTCAGAGCAGAGTGGTGGCTGG + Intronic
956688434 3:71854303-71854325 GCACAGAGCAGAAAGCTAGCTGG + Intergenic
960333907 3:116392995-116393017 GCTCAGAGGAGACCCCCAGTGGG - Intronic
966808837 3:183825920-183825942 GCTGGGAGCAGTCCGCCAGCCGG + Intergenic
978249318 4:106610975-106610997 GCTCAGAGGAGACCCACAGCAGG - Intergenic
980745000 4:137001360-137001382 GCTCAGAGGAGACCCGTAGTGGG - Intergenic
984325254 4:178242448-178242470 GCTCAGAGGAGACCTGTAGTGGG - Intergenic
987235319 5:15936404-15936426 GCTCAGAGCAACCTGCCAGCAGG - Intronic
992088886 5:73300784-73300806 GCTCAGAGCAAAGCGATTGCAGG - Intergenic
997612940 5:135227840-135227862 GAGCAGAGCAGACAGCTGGCAGG - Intronic
998845446 5:146304573-146304595 ACTCAGAGCGGACCCCCAGCAGG - Intronic
1002276069 5:178105045-178105067 GGTGTGAGCAGACCGCTAGGTGG + Intergenic
1003459997 6:6320489-6320511 GCCCAGAGCAAGCCGCTTGCTGG + Intronic
1004392807 6:15223541-15223563 GCTCACAGCAGACGGATAGGAGG - Intergenic
1005021413 6:21422997-21423019 GCTCAGAGGAGACCGACAGTGGG + Intergenic
1013946165 6:115725254-115725276 GCTCTGAGCAGACCAATAACAGG - Intergenic
1015061905 6:128976373-128976395 GCTCAGGGGAGAACTCTAGCTGG + Intronic
1017420446 6:154267633-154267655 GCTCAGAGAAGACCCATAGTGGG + Intronic
1018236316 6:161727326-161727348 GCTCAGAGCACACAGTGAGCCGG + Intronic
1018515830 6:164579238-164579260 GCACAGAGCAGAACCCAAGCAGG + Intergenic
1019215986 6:170444175-170444197 GCTCAGAGCAGAAGGCTTGTAGG + Intergenic
1020274598 7:6616407-6616429 GCTCTGAGAAGGCCGCCAGCAGG - Intronic
1023296252 7:38717798-38717820 GCTCAGAGCAGAGCTCCAGGGGG + Intergenic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1026477130 7:70746575-70746597 CATCAGAGCAGATGGCTAGCAGG + Intronic
1026619166 7:71935274-71935296 TCCCAGAGCAGACAGCAAGCAGG + Intronic
1028985794 7:97007101-97007123 GCTCAGACCAGCCCACGAGCAGG - Intronic
1035670351 8:1412233-1412255 GCTCAGAGCAGGAGGCTGGCGGG - Intergenic
1040280651 8:46040192-46040214 GGGCAGGGCAGACCGCCAGCAGG + Intergenic
1042336996 8:67639863-67639885 GCTCAGAGGAGACCTATAGTGGG + Intronic
1044008637 8:86965802-86965824 GCTCAGAGGAGACCTGCAGCAGG + Intronic
1049832814 8:144713166-144713188 TCTCAGAGCAGACCGAGAGCAGG + Intergenic
1050096970 9:2077033-2077055 GATCAGGGCAGACTGCTAGGAGG - Intronic
1050725547 9:8644325-8644347 GCTCAGAGGAGACCCATAGTGGG - Intronic
1054803897 9:69379833-69379855 GCTCAGAGCACACTGCTGGATGG - Intronic
1062348742 9:136128481-136128503 GCTCCGTGCTGCCCGCTAGCTGG + Intergenic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1203612277 Un_KI270749v1:20863-20885 GCTCAGAGGAGACCCATAGTGGG + Intergenic
1186025047 X:5300147-5300169 GCTCAAATCACACAGCTAGCAGG - Intergenic
1190063266 X:47224114-47224136 GCTCAGAGCCGGCAGCTAGGTGG - Intronic
1190369550 X:49727601-49727623 GCTCAGAGAAGACCCATAGTGGG - Intergenic
1202349693 Y:23974691-23974713 GCTCAGAGCAGACATTCAGCAGG - Intergenic
1202521086 Y:25695429-25695451 GCTCAGAGCAGACATTCAGCAGG + Intergenic