ID: 1114516480

View in Genome Browser
Species Human (GRCh38)
Location 14:23302867-23302889
Sequence CTCCGGTTCCAAGGCCCTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114516475_1114516480 21 Left 1114516475 14:23302823-23302845 CCTGCTAGCGGTCTGCTCTGAGC 0: 1
1: 0
2: 1
3: 12
4: 103
Right 1114516480 14:23302867-23302889 CTCCGGTTCCAAGGCCCTCACGG 0: 1
1: 0
2: 0
3: 11
4: 103
1114516474_1114516480 24 Left 1114516474 14:23302820-23302842 CCTCCTGCTAGCGGTCTGCTCTG 0: 1
1: 0
2: 1
3: 12
4: 118
Right 1114516480 14:23302867-23302889 CTCCGGTTCCAAGGCCCTCACGG 0: 1
1: 0
2: 0
3: 11
4: 103
1114516473_1114516480 28 Left 1114516473 14:23302816-23302838 CCTGCCTCCTGCTAGCGGTCTGC 0: 1
1: 0
2: 0
3: 10
4: 142
Right 1114516480 14:23302867-23302889 CTCCGGTTCCAAGGCCCTCACGG 0: 1
1: 0
2: 0
3: 11
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114516480 Original CRISPR CTCCGGTTCCAAGGCCCTCA CGG Intronic
900214236 1:1472630-1472652 CCCCTGACCCAAGGCCCTCAGGG + Intronic
900221786 1:1513014-1513036 CCCCTGACCCAAGGCCCTCAGGG + Intronic
902262852 1:15239729-15239751 CTCCTGTTCCAAGGAACTCCTGG + Intergenic
902375948 1:16030011-16030033 CTCCAGTCACAATGCCCTCAGGG - Exonic
902728863 1:18355469-18355491 CTCCTGTTCCATGGCCACCAAGG - Intronic
904380000 1:30104106-30104128 ATTCGGTTCCAAGCCCCTCCAGG - Intergenic
905382586 1:37573716-37573738 CTCTTTTTCCAAGGCCCTAAAGG + Intronic
905652852 1:39668192-39668214 CTCCTGTTCCAAAGGCCTCCAGG - Intronic
912381627 1:109250684-109250706 GTCCGGGTCGATGGCCCTCAGGG - Exonic
915380167 1:155433286-155433308 CTAAGCTTCCAAGGCCCTCCTGG + Intronic
916640743 1:166726163-166726185 CTCCAGTTCAAAACCCCTCAGGG + Intergenic
917795372 1:178529246-178529268 CTCCGGGTCCCAGGCCCTCTTGG + Intronic
920356340 1:205376026-205376048 CCCCTGTCCCAAGTCCCTCAAGG + Intergenic
920979451 1:210819511-210819533 CTGCGGCTCCAAGGCAATCACGG + Intronic
1065405889 10:25363810-25363832 CTCAGGTTACATGACCCTCAGGG + Intronic
1069087656 10:64160223-64160245 CTCCACTGCCAAGGCCCTCTTGG - Intergenic
1069717673 10:70531394-70531416 CCCCGGGTCCAAGGCCCTGGAGG - Exonic
1070538065 10:77394158-77394180 CTCTGGCTCCCAGGCCCTCAGGG - Intronic
1071442855 10:85718436-85718458 CTGCGGGGGCAAGGCCCTCATGG - Intronic
1073429877 10:103479144-103479166 CTCTGCTTCCAAGGGCCTGAGGG + Exonic
1076294921 10:129376740-129376762 CTCCGCATCCCAGGCCCCCAGGG - Intergenic
1076634584 10:131874031-131874053 GTCCGGTTCCAGCGCCCTGAGGG - Intergenic
1077056593 11:597033-597055 CTCCCGTCCCAAGGCGCACATGG + Intronic
1077639349 11:3867413-3867435 CTTTGGTTCCATGGCCCACATGG + Intronic
1084326924 11:68405880-68405902 CTCAGGAGCCAAGGCCCTGAGGG + Intronic
1084336370 11:68460333-68460355 CTCCGGCTCCACGGCCATGATGG + Intergenic
1085034291 11:73290918-73290940 CTGTGGTTCCAAGGTCCTGAGGG + Intronic
1085379134 11:76096881-76096903 CTGCTGCTCCAAGGACCTCAAGG + Intronic
1085423299 11:76381502-76381524 CTCCGATTCCGCGGCCCTTAAGG - Exonic
1091332624 11:134742176-134742198 TTCTGATTCCAAGGCCCACATGG - Intergenic
1092396900 12:8134724-8134746 CTAAGCTTCCAAGGCCCTCCTGG - Intronic
1099889002 12:88566584-88566606 CTTGGTTTCCAAGGCCCTGAGGG - Intronic
1103641380 12:122355255-122355277 CTCCGGTACCACTGCCCTCCAGG - Exonic
1104904568 12:132206244-132206266 CACCTGTGCCAAGGCCCTGAGGG - Intronic
1114295218 14:21323040-21323062 CTGTGGTTCCAAGTTCCTCATGG - Intronic
1114516480 14:23302867-23302889 CTCCGGTTCCAAGGCCCTCACGG + Intronic
1115309711 14:31966910-31966932 CTCCAGTTCCAAGAACATCATGG - Intergenic
1115491865 14:33965620-33965642 CCCCTGTTCCAAGGTCCTCATGG + Intronic
1116012359 14:39366481-39366503 GGCCAGTTCCCAGGCCCTCAGGG + Intronic
1122113801 14:99517975-99517997 CCCCGCTTCCAGGGCCCACAGGG - Intronic
1122878948 14:104681384-104681406 CTCCGTGTCCAAGGTCCCCAAGG - Intergenic
1127460321 15:59192729-59192751 CTCTGCTTCCAAGACTCTCATGG + Intronic
1130651890 15:85766762-85766784 GCCCTGCTCCAAGGCCCTCAAGG + Intronic
1132096364 15:98988007-98988029 CTCCGGTGCCTAGGCCACCAGGG + Intronic
1137543124 16:49378222-49378244 CTGTGTTTCCAAGGCCCCCAGGG + Intronic
1138521009 16:57570825-57570847 CTCCAGTGCCCAGGCCCTGAGGG + Intronic
1140021205 16:71240601-71240623 CTCCTGTTCCTAGGCCCTTGTGG - Intergenic
1142394314 16:89822877-89822899 CTTCTGTCCCAAGGCACTCAGGG + Intronic
1142513746 17:413731-413753 CCCCGACCCCAAGGCCCTCAAGG + Exonic
1142513758 17:413761-413783 CCCCGACCCCAAGGCCCTCAAGG + Exonic
1142513779 17:413821-413843 CCCCGACCCCAAGGCCCTCAAGG + Exonic
1142848275 17:2692371-2692393 CCACGGGCCCAAGGCCCTCAAGG - Exonic
1143592488 17:7893995-7894017 CTCTGGATCCTTGGCCCTCACGG - Intronic
1147440197 17:40443210-40443232 CTCCGGTTCAGAGGCACTCTGGG + Intergenic
1147948044 17:44091603-44091625 TTCCCCTTCCAAGGCCCTAAGGG - Intronic
1148727745 17:49807514-49807536 CTCCTGTGCCAAGGTCCACAAGG - Intronic
1149560239 17:57603361-57603383 CTCAGGTTCCAAGGCTCTCTTGG - Intronic
1151576182 17:74953584-74953606 CTCAGGTTCCAGGGACCGCAAGG + Exonic
1160873370 19:1286711-1286733 CTCCGGTGCCAAGGTCCCCGGGG - Intronic
1165342700 19:35224291-35224313 CTCCCCTTCCAAGGGCCTGAGGG + Intergenic
1168231114 19:55032306-55032328 CTCCGGTGCCAGGGACCTCCGGG - Exonic
926801198 2:16662581-16662603 CTCCGGTTCCAACTTCATCATGG - Intronic
934847678 2:97672662-97672684 CTCCAGTGCCAAGGCCCACCTGG - Intergenic
937297044 2:120815722-120815744 CCCTGGTTCCAAGTCTCTCACGG - Intronic
938822740 2:134975689-134975711 CTCAGGTTCCAGGGAGCTCATGG + Intronic
943807554 2:192141105-192141127 CTCTGGTTCCAGGACCCTCTCGG - Intronic
945940521 2:215944860-215944882 TTCCGTTTCCAAGTCCCTAAAGG - Exonic
946654656 2:221933362-221933384 CTGCAGTTCCAAGGCCCTGATGG - Intergenic
947925918 2:233922359-233922381 AGCCTGTTCCAAGGTCCTCAGGG - Intronic
1169211635 20:3768879-3768901 CTCCTGCTCCAAAGCCCTCTGGG + Intergenic
1169661602 20:7984376-7984398 CTCTGGATCCAAGACCCCCATGG - Intronic
1174953378 20:55067420-55067442 CTTAGGACCCAAGGCCCTCATGG + Intergenic
1175847794 20:62067701-62067723 ACCAGGTTCCAAGGCCCCCAGGG + Intergenic
1179351835 21:40618460-40618482 CTCCGCCTCCCAGGCCATCAGGG - Intronic
1180023992 21:45148219-45148241 CACCAGTTCCCAAGCCCTCAGGG + Intronic
1181506689 22:23363233-23363255 GTCAGGTGCCCAGGCCCTCAGGG - Intergenic
1183219542 22:36503891-36503913 CTCCAGGACCAAGGGCCTCAGGG + Intronic
949482230 3:4504721-4504743 CTCCTGTTCCTGGGCACTCAGGG - Intronic
962839557 3:139221541-139221563 CTCCCTTTCCAAGCCCCCCAGGG - Intronic
965501233 3:169458487-169458509 ATCAGGCTCCAAGGCCCCCAGGG - Intronic
968478052 4:821650-821672 GTCCGGATCCAGGGTCCTCAAGG - Intronic
968492170 4:895844-895866 CTCCTGGGCCAAGGCACTCAGGG + Intronic
970691999 4:18630809-18630831 CCCAGGTGCCAAGCCCCTCACGG + Intergenic
971670245 4:29546641-29546663 CTGCAGTGACAAGGCCCTCATGG - Intergenic
975489805 4:74976105-74976127 CTCAGGATCCAAGGCCCTGATGG - Intronic
977577468 4:98690575-98690597 CTTGGTTTCCAAGGCCCTCCAGG + Intergenic
981712940 4:147726653-147726675 CTCCAGGTCCAAGGGACTCAGGG + Intergenic
983316104 4:166134480-166134502 CTTGGGTTCCAAGGCCCTGGTGG + Intergenic
986450393 5:7857698-7857720 CACCTGTTTCAAGCCCCTCAAGG + Intronic
986997151 5:13620364-13620386 CTCCTGTCCCAAAGCCCTCTTGG + Intergenic
987001530 5:13664793-13664815 CTTAGGTTCCAAGACCCTGAAGG - Intergenic
1002411008 5:179076512-179076534 CTCCCGGTACAAGGCCCTCTGGG - Exonic
1006029785 6:31170493-31170515 CTAAGCTTCCAAGGCCCTCCTGG - Exonic
1011624741 6:89273646-89273668 TTCAGGTTGCAAGGCCCTCAGGG - Intronic
1013861766 6:114644254-114644276 CTCAGGTTCCAAGATCTTCAGGG - Intergenic
1014110795 6:117617078-117617100 CTGAGGTTCAAAGCCCCTCATGG - Intergenic
1014110815 6:117617162-117617184 CTGAGGTTCAAAGCCCCTCATGG - Intergenic
1018841649 6:167521786-167521808 CTCAGGTTCCCTGCCCCTCAAGG + Intergenic
1020333358 7:7042155-7042177 CTCCGGTTCCTAGGCCACCAGGG + Intergenic
1022404152 7:30070878-30070900 CTCCAGCTCCAAGGCCCACCTGG - Intronic
1023951704 7:44851074-44851096 CTCCGCTTCCCAGGCTCTCCTGG - Intergenic
1031918180 7:127582530-127582552 CTCCAGTTCCAAGTCCTTCTCGG + Exonic
1035382134 7:158446906-158446928 CTCCTGTTCCCACGGCCTCACGG + Intronic
1036162094 8:6398896-6398918 CTGGGGTTCCAAGGCTCGCATGG - Intergenic
1036910554 8:12754629-12754651 CTCCGGGTCCCCGGCCCTCGGGG + Intronic
1038308065 8:26422295-26422317 CTTCGGCTCCAAGGCCCTGATGG + Intronic
1042527043 8:69774238-69774260 CTCCTGGTGCTAGGCCCTCAGGG + Intronic
1047697236 8:127415972-127415994 CTAAGCTTCCAAGGCCCTCCTGG + Exonic
1048132914 8:131717401-131717423 CTTTGGTTCCAAGGTGCTCAAGG - Intergenic
1051366194 9:16323152-16323174 CTCCAGTCCCAAGGTCCTCAAGG - Intergenic
1057996414 9:99824319-99824341 CTCCGCTTGAAAGGCCCTCAGGG + Intronic
1061702804 9:132428770-132428792 CCCAGGTCCCAAGGCCTTCAGGG + Intronic
1189619898 X:42825010-42825032 CCCTGGTACCAGGGCCCTCATGG - Intergenic
1194435788 X:93867700-93867722 CTTCGGATCCAAGACCCTGATGG - Intergenic
1200076077 X:153551892-153551914 CTGCCGTCCCAGGGCCCTCAGGG + Intronic