ID: 1114516483

View in Genome Browser
Species Human (GRCh38)
Location 14:23302873-23302895
Sequence TTCCAAGGCCCTCACGGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 729
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 686}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114516475_1114516483 27 Left 1114516475 14:23302823-23302845 CCTGCTAGCGGTCTGCTCTGAGC 0: 1
1: 0
2: 1
3: 12
4: 103
Right 1114516483 14:23302873-23302895 TTCCAAGGCCCTCACGGCCCGGG 0: 1
1: 0
2: 2
3: 40
4: 686
1114516474_1114516483 30 Left 1114516474 14:23302820-23302842 CCTCCTGCTAGCGGTCTGCTCTG 0: 1
1: 0
2: 1
3: 12
4: 118
Right 1114516483 14:23302873-23302895 TTCCAAGGCCCTCACGGCCCGGG 0: 1
1: 0
2: 2
3: 40
4: 686

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114516483 Original CRISPR TTCCAAGGCCCTCACGGCCC GGG Intronic
900184749 1:1327819-1327841 TGCCACGGGACTCACGGCCCTGG - Exonic
900463668 1:2813386-2813408 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
900894282 1:5472446-5472468 TTCTAGTGCCCTCACGGCTCCGG + Intergenic
901045977 1:6395975-6395997 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
901198779 1:7455040-7455062 TTCCGATGCACTCAGGGCCCTGG + Intronic
902033440 1:13439394-13439416 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
902148154 1:14420747-14420769 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
904434598 1:30485989-30486011 TCCCAAAGCCCTCACACCCCAGG - Intergenic
906876137 1:49541449-49541471 TGCTAAGCCCCTCACTGCCCGGG - Intronic
907371149 1:54004471-54004493 TGCTAAGCCCCTCACTGCCCCGG + Intergenic
907980060 1:59472244-59472266 TGCTAAGCCCCTCACTGCCCTGG - Intronic
908027755 1:59969909-59969931 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
908301095 1:62761629-62761651 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
908330106 1:63062833-63062855 TAGCAAGGCTCTCACTGCCCTGG - Intergenic
908657922 1:66407279-66407301 ATCTAAGGCCCTCAAGGCCTGGG - Intergenic
909782290 1:79561770-79561792 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
910334327 1:86110658-86110680 TGCTAAGCCCCTCACTGCCCGGG - Intronic
910371789 1:86524054-86524076 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
910550288 1:88467182-88467204 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
910693135 1:89984863-89984885 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
911807963 1:102235055-102235077 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
911943252 1:104073574-104073596 CTCCAAAGCCCTGCCGGCCCTGG - Intergenic
912538758 1:110396578-110396600 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
913470195 1:119179183-119179205 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
915242329 1:154532337-154532359 TGCTAAGCCCCTCACTGCCCGGG + Intronic
915487486 1:156231948-156231970 ATCCAAGTCCCTCAGGGCACTGG + Intronic
915515126 1:156408243-156408265 ATCCATGGCCCTCACAACCCAGG + Intronic
915528031 1:156488082-156488104 TTCAAAGGCTCTCAAGGCTCTGG + Intronic
915584952 1:156839451-156839473 TTCAAATGCCCTCATGGCACTGG + Intronic
916451974 1:164929366-164929388 TTCCAAGTCCCACAAGTCCCTGG - Intergenic
916606045 1:166343278-166343300 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
916939036 1:169661332-169661354 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
916940073 1:169668170-169668192 TGCTAAGCCCCTCACTGCCCAGG - Intronic
917348865 1:174056617-174056639 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
917445411 1:175102545-175102567 TGCTAAGCCCCTCACTGCCCGGG + Intronic
917446366 1:175108702-175108724 TGCTAAGCCCCTCACTGCCCGGG + Intronic
918154572 1:181832531-181832553 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
918512008 1:185321918-185321940 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
918659765 1:187074061-187074083 TGCTAAGTCCCTCACTGCCCGGG + Intergenic
918789967 1:188813196-188813218 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
918853216 1:189718543-189718565 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
918993892 1:191731929-191731951 TGCTAAGCCCCTCACGGCCCGGG - Intergenic
919049784 1:192499298-192499320 TGCTAAGCCCCTCACTGCCCTGG + Intergenic
919377159 1:196808926-196808948 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
920604871 1:207371642-207371664 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
920878464 1:209858896-209858918 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
921903842 1:220475914-220475936 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
922985874 1:229865571-229865593 TGCTAAGCCCCTCACAGCCCGGG - Intergenic
923172597 1:231431019-231431041 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
923353173 1:233129222-233129244 TGCTAAGCCCCTCACTGCCCGGG - Intronic
923386069 1:233466145-233466167 TGCTAAGCCCCTCACTGCCCTGG - Intergenic
923573812 1:235140409-235140431 TGCTAAGCCCCTCACTGCCCGGG - Intronic
923623229 1:235594632-235594654 TGCTAAGCCCCTCACTGCCCGGG + Intronic
923810525 1:237309871-237309893 TGCTAAGCCCCTCACTGCCCGGG + Intronic
924510021 1:244722505-244722527 CTCCACGGCCCTCACTGGCCAGG - Intergenic
1063148956 10:3320065-3320087 TGCTAAGCCCCTCACTGCCCTGG + Intergenic
1063309305 10:4937628-4937650 TGCTAAGACCCTCACTGCCCGGG + Intronic
1063321047 10:5053346-5053368 TGCTAAGCCCCTCACTGCCCTGG + Intronic
1063848702 10:10161012-10161034 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1064196417 10:13247442-13247464 TTCTGAGCCCCTCACAGCCCTGG + Intergenic
1064449209 10:15426312-15426334 TGCTAAGACCCTCACTGCCCGGG + Intergenic
1065284797 10:24176969-24176991 TGCTAAGTCCCTCACTGCCCGGG + Intronic
1065554901 10:26905661-26905683 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1065590308 10:27256577-27256599 TGCTAAGCCCCTCACTGCCCTGG - Intergenic
1065743283 10:28815918-28815940 TGCCAAGTCCCTCACTGCCCAGG + Intergenic
1065752168 10:28897022-28897044 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1065895892 10:30162970-30162992 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1065965848 10:30769664-30769686 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1065983869 10:30930319-30930341 TGCTAAGCCCCTCACTGCCCAGG + Intronic
1066590568 10:36989537-36989559 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1067346692 10:45443118-45443140 TCCCGAGGCCATCAAGGCCCGGG + Exonic
1068083316 10:52346680-52346702 TCCCTAGGCCCTCACGGCAGTGG - Intergenic
1068554963 10:58448501-58448523 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1068820971 10:61377116-61377138 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1069215346 10:65812297-65812319 TGCTAAGCCCCTCACTGCCCCGG + Intergenic
1070172720 10:73944718-73944740 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1070968320 10:80543371-80543393 TGCTAAGCCCCTCACTGCCCCGG - Intronic
1071055698 10:81505941-81505963 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1071078716 10:81784333-81784355 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1071332177 10:84571313-84571335 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1071388001 10:85141515-85141537 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1071611014 10:87031225-87031247 TGCTAAGCCCCTCACTGCCCTGG + Intergenic
1072278494 10:93845307-93845329 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1072341855 10:94459742-94459764 TGCTAAGCCCCTCACTGCCCGGG + Intronic
1074996347 10:118760392-118760414 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1075307631 10:121382277-121382299 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1075376028 10:121978634-121978656 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1075398123 10:122142381-122142403 TTCCCAGCCCCTCACCGTCCTGG - Intronic
1075505009 10:123013749-123013771 TGCTAAGCCCCTCACTGCCCGGG + Intronic
1075603115 10:123785337-123785359 TTCCATGGCTCTCACTGCCCCGG + Intronic
1075872678 10:125782189-125782211 TTCCCAGGCCCTCAGAGCCCAGG + Intergenic
1076184796 10:128437959-128437981 CTCCAAGGCCCACATGGGCCAGG - Intergenic
1076919070 10:133441945-133441967 CTCCAAGGCCCCCATGGCCCAGG - Intergenic
1077414785 11:2420040-2420062 CTCCCAGGCCCCCACGGCCCAGG + Intronic
1077414793 11:2420055-2420077 GGCCCAGGCCCCCACGGCCCAGG + Intronic
1077583790 11:3435189-3435211 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1077764591 11:5144530-5144552 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1077764597 11:5144553-5144575 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1078795819 11:14591177-14591199 TGCCAAGTCCCTCACTGCCCAGG - Intronic
1079190977 11:18276338-18276360 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1079708675 11:23653395-23653417 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1079756808 11:24274486-24274508 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1080204417 11:29712761-29712783 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1080223514 11:29934278-29934300 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1080503079 11:32888413-32888435 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1081046412 11:38278844-38278866 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1081047697 11:38296512-38296534 TGCTAAGCCCCTCACTGCCCTGG + Intergenic
1081136154 11:39442307-39442329 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1081315202 11:41622990-41623012 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1081374713 11:42344578-42344600 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1081659563 11:44879690-44879712 TTACAAGGCCCTCAGTGACCTGG - Intronic
1081755430 11:45540919-45540941 CTCTAAGGCCCACACAGCCCTGG - Intergenic
1082082766 11:48025107-48025129 TTCCAGGTCCCTCCAGGCCCAGG - Intronic
1082106726 11:48229025-48229047 TGCTAAGCCCCTCACTGCCCTGG - Intergenic
1083074293 11:60020460-60020482 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1083619673 11:64042594-64042616 TTCCAAGACCCCCACAGGCCTGG - Intronic
1083855505 11:65391069-65391091 TTGCAGGGCACTCACGGCCCTGG - Intronic
1084186652 11:67476207-67476229 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1084240692 11:67817861-67817883 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1084877345 11:72142940-72142962 TTCTGAAGCCCTCATGGCCCAGG + Intergenic
1085235220 11:75009445-75009467 ACCCAAGGCCTTCAGGGCCCTGG + Exonic
1085445311 11:76597427-76597449 CTCCCAGGCCCTCCCTGCCCAGG + Intergenic
1086001092 11:81986920-81986942 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1086043030 11:82501274-82501296 TGCTAAGGCCCTCACTGCCCGGG - Intergenic
1087401006 11:97667199-97667221 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1087407320 11:97745863-97745885 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1087441191 11:98185463-98185485 TTCTAAGGTCCTCACTGCCTGGG + Intergenic
1088843972 11:113649589-113649611 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1089244740 11:117110697-117110719 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1089389194 11:118088512-118088534 TGCCCAGGCCCCCAGGGCCCAGG - Intronic
1089688037 11:120169306-120169328 TCCCACCGCCCCCACGGCCCCGG - Intronic
1090229219 11:125089612-125089634 TGCCAAGTCCCTCACTGCCCGGG - Intronic
1090776728 11:129972066-129972088 TGCTAAGCCCCTCACTGCCCGGG + Intronic
1090820522 11:130337605-130337627 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1091402242 12:188319-188341 TGCTAAGCCCCTCACTGCCCCGG + Intergenic
1091582775 12:1799135-1799157 TTTCAAAGCACTCACTGCCCGGG - Intronic
1092336675 12:7639955-7639977 TGCTAAGCCCCTCACTGCCCCGG - Intergenic
1092472959 12:8794839-8794861 TACTAAGCCCCTCACTGCCCGGG - Intergenic
1093034491 12:14320209-14320231 TGCCAAGCCCCTCATTGCCCGGG - Intergenic
1093172354 12:15874743-15874765 TGCTAAGCCCCTCACTGCCCAGG - Intronic
1093527092 12:20115474-20115496 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1093653946 12:21674297-21674319 TGCTAAGTCCCTCACTGCCCGGG + Intronic
1093921662 12:24866192-24866214 TGCTAAGCCCCTCACTGCCCGGG - Intronic
1094338613 12:29386485-29386507 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1094409831 12:30156986-30157008 TGCTAAGTCCCTCACTGCCCGGG - Intergenic
1094495410 12:30986166-30986188 TTCCAAGACCCCCAAGGCTCAGG + Intronic
1094722059 12:33075460-33075482 TGCTAAGCCCCTCACTGCCCCGG - Intergenic
1095304154 12:40620771-40620793 TGCTAAGCCCCTCACTGCCCCGG - Intergenic
1097212943 12:57386427-57386449 TGCTAAGCCCCTCACTGCCCTGG - Intronic
1097253680 12:57655882-57655904 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1099204351 12:79711050-79711072 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1099790707 12:87330331-87330353 TGCTAAGTCCCTCACTGCCCGGG - Intergenic
1100584693 12:95969250-95969272 TGCTAAGTCCCTCACTGCCCGGG - Intergenic
1101603840 12:106233126-106233148 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1101898347 12:108772238-108772260 TCCCAAGACCCTCAGAGCCCAGG + Intergenic
1102009107 12:109607088-109607110 TGCCCAGGCCCTCAGGCCCCTGG - Intergenic
1102255671 12:111413509-111413531 CTCCAGGTCCCTCACTGCCCAGG - Intronic
1102387237 12:112520134-112520156 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1102869987 12:116406573-116406595 GGCCAAGGCCCTCTCAGCCCTGG + Intergenic
1102904019 12:116660840-116660862 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1103146150 12:118597420-118597442 TGCCAAGTCCCTCACTGCCCGGG + Intergenic
1103459665 12:121093753-121093775 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1103668541 12:122592140-122592162 TGCTAAGCCCCTCACTGCCCGGG - Intronic
1103678713 12:122676841-122676863 TGCTAAGGCCCTCACTGCCCGGG + Intergenic
1103990760 12:124797772-124797794 TGACTAGGCCCTCTCGGCCCCGG - Intronic
1104803581 12:131570959-131570981 ATCCAGGGCCCCCACGGCCCTGG + Intergenic
1106568648 13:30907386-30907408 TTCCACAGCCCACATGGCCCCGG - Intronic
1109145404 13:58773433-58773455 TGCTAAGTCCCTCACTGCCCGGG - Intergenic
1109201865 13:59440025-59440047 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1109563159 13:64077739-64077761 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1109699694 13:66009485-66009507 TGCTAAGCCCCTCACTGCCCTGG - Intergenic
1109854303 13:68107962-68107984 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1110854214 13:80278896-80278918 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1112200125 13:97266552-97266574 CTCCAGGGCCCTCTCCGCCCAGG + Intronic
1112492590 13:99880776-99880798 TTCCGTGCCCCTCATGGCCCTGG + Intronic
1112705846 13:102068589-102068611 TGCCAAGTCGCTCACTGCCCGGG - Intronic
1112842700 13:103600097-103600119 TGCTAAGCCCCTCACTGCCCCGG - Intergenic
1113775827 13:112944111-112944133 TTCCCCTCCCCTCACGGCCCGGG - Intronic
1114155545 14:20099313-20099335 TGCGAAGCCCCTCACTGCCCGGG - Intergenic
1114516483 14:23302873-23302895 TTCCAAGGCCCTCACGGCCCGGG + Intronic
1114957746 14:27845474-27845496 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1115174600 14:30547762-30547784 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1115284247 14:31700661-31700683 TGCTAAGCCCCTCACTGCCCGGG - Intronic
1115533242 14:34346044-34346066 TGCTAAGCCCCTCACTGCCCGGG + Intronic
1116152130 14:41154485-41154507 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1116223184 14:42113694-42113716 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1116297914 14:43136172-43136194 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1116311008 14:43326720-43326742 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1116426523 14:44798708-44798730 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1116653776 14:47626672-47626694 TGCTAAGCCCCTCACCGCCCGGG - Intronic
1116900960 14:50362041-50362063 TGCTAAGCCCCTCACTGCCCGGG - Intronic
1117082587 14:52166862-52166884 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1117330843 14:54710505-54710527 TTCCAGGGGCCTCACTGCCTAGG - Intronic
1117449815 14:55839624-55839646 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1118306329 14:64658282-64658304 TGCTAAGCCCCTCACTGCCCCGG - Intergenic
1118386618 14:65260929-65260951 TTTCAAGGCCCTCATGGCTCTGG + Intergenic
1119027780 14:71167653-71167675 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1119303675 14:73590680-73590702 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1120209873 14:81624012-81624034 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1120214681 14:81668956-81668978 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1122125250 14:99575271-99575293 TGCCAAGGCCCTCAGGAACCTGG + Intronic
1122434976 14:101689195-101689217 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1123033206 14:105460806-105460828 CTCCAAGGCCATCTCGGCGCTGG + Exonic
1123051878 14:105547942-105547964 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1123782834 15:23644830-23644852 CTCCCAGGCACTCAGGGCCCAGG + Exonic
1124061593 15:26298307-26298329 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1124387849 15:29224994-29225016 TGCTAAGCCCCTCACTGCCCGGG + Intronic
1124418133 15:29491120-29491142 TACTAAGCCCCTCACTGCCCAGG + Intronic
1125112212 15:36047070-36047092 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1125577723 15:40766758-40766780 CTCCAGGCCCCTCACTGCCCTGG - Exonic
1125885547 15:43226795-43226817 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1126165536 15:45651250-45651272 TGCTAAGCCCCTCACTGCCCGGG + Intronic
1126232724 15:46345704-46345726 TTGCAAGGCCCTCCCTGGCCTGG + Intergenic
1126450564 15:48804026-48804048 CTCAAATGCCCTCAGGGCCCTGG + Intronic
1126452601 15:48825832-48825854 TTCCAAGACCATCATGGACCAGG - Exonic
1128797457 15:70476251-70476273 TTCCTTGGCCTTCAGGGCCCAGG - Intergenic
1129107908 15:73321976-73321998 ATGCTAGGCCCTCAGGGCCCTGG + Exonic
1129158264 15:73732390-73732412 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1129196935 15:73973867-73973889 TGCTAAGACCCTCACTGCCCGGG - Intergenic
1129374007 15:75116198-75116220 TGCTAAGCCCCTCACTGCCCGGG + Intronic
1129586858 15:76876073-76876095 TGCTAAGCCCCTCACTGCCCGGG + Intronic
1129724391 15:77894218-77894240 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1129997148 15:80016637-80016659 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1131012705 15:89031902-89031924 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1131212692 15:90511074-90511096 TTCTAAGCCCCTCACTGCCCGGG - Intergenic
1131250255 15:90825628-90825650 TGCTAAGCCCCTCACTGCCCCGG - Intergenic
1131992380 15:98104468-98104490 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1132155836 15:99494879-99494901 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1132663597 16:1072091-1072113 TTCCCAGGCCCTCACTGCCTGGG + Intergenic
1133014036 16:2930690-2930712 CTCCAGGGCCCTCAGGACCCTGG - Exonic
1133352157 16:5108755-5108777 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1133770061 16:8862684-8862706 TGCAAAGGCCCTGAGGGCCCGGG + Intronic
1135299398 16:21313025-21313047 TGCTAAGTCCCTCACTGCCCGGG + Intergenic
1135942690 16:26836300-26836322 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1135985583 16:27181392-27181414 TACCAAGCCCCTCAAGTCCCAGG + Intergenic
1137896676 16:52220075-52220097 TTCCAGGTCACTCAAGGCCCAGG - Intergenic
1139356033 16:66367472-66367494 CCCCAAGGCCCCCACAGCCCAGG + Intronic
1139442306 16:66974386-66974408 TGCTAAGGCCCTCACTGCCTGGG - Exonic
1139603046 16:67998330-67998352 TGCCAAGCCCCTCATTGCCCGGG - Intronic
1139676422 16:68526863-68526885 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1141726855 16:85795409-85795431 TTCCTGGCTCCTCACGGCCCTGG + Intronic
1141837701 16:86553526-86553548 TGCTAAGCCCCTCACTGCCCAGG - Intronic
1203124264 16_KI270728v1_random:1561242-1561264 TGCCATGGCCCTGACGGCCCTGG + Intergenic
1142828810 17:2532338-2532360 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1143127985 17:4656754-4656776 TACTAAGCCCCTCACTGCCCGGG + Intergenic
1143135267 17:4709295-4709317 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1143163870 17:4887843-4887865 CTCCAAGGCCCTAATGGACCCGG - Intronic
1143608406 17:8003650-8003672 GTCCACGGCACTCAGGGCCCGGG + Exonic
1144128084 17:12221020-12221042 TGCTAAGGCCCTCACTGCCCGGG - Intergenic
1144737849 17:17564841-17564863 TCCCAAGGCCCTCCCTGGCCAGG - Intronic
1144804675 17:17956735-17956757 TGCTAAGCCCCTCACTGCCCGGG + Intronic
1145906702 17:28520346-28520368 TTCCTAAGGCCACACGGCCCAGG - Intronic
1148023374 17:44568332-44568354 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1148078488 17:44953939-44953961 TTCCCAGGCCTTCAAGGCACAGG - Intergenic
1148576886 17:48718733-48718755 TCCCCAGGCCTTCGCGGCCCGGG - Intergenic
1148833488 17:50452155-50452177 ACCCAAGGCTCTCAGGGCCCAGG - Intronic
1148971419 17:51486205-51486227 TTCCAAGACCCACACAGACCTGG + Intergenic
1148991245 17:51668887-51668909 TGCTAAGCCCCTCACTGCCCAGG - Intronic
1149526583 17:57360519-57360541 TGCTATGGCCCTCACGGGCCAGG - Intronic
1149753970 17:59172638-59172660 TGCTAAGCCCCTCACTGCCCGGG - Intronic
1150772279 17:68051988-68052010 TGCTAAGCCCCTCACTGCCCTGG - Intergenic
1150788263 17:68179964-68179986 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1150804612 17:68309154-68309176 TTCTAAGCCCCTCATTGCCCGGG + Intronic
1151461332 17:74255944-74255966 TTCCTGGGTCCTCAGGGCCCAGG - Intronic
1151875903 17:76868295-76868317 GTCCCAGCCCCGCACGGCCCCGG + Intergenic
1152008590 17:77697154-77697176 TTCCCAGACCCTCACTGCCCCGG - Intergenic
1152353390 17:79795429-79795451 TTCGAAGGCCCTCCCGGGCCCGG + Exonic
1153967099 18:10191957-10191979 TTCCAAGCCCCACTCGACCCAGG + Intergenic
1154231158 18:12557392-12557414 TGCTAAGCCCCTCACTGCCCAGG + Intronic
1154255318 18:12777099-12777121 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1156150344 18:34234073-34234095 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1156863654 18:41865873-41865895 TGCCAAGTTCCTCACTGCCCGGG - Intergenic
1156969671 18:43139637-43139659 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1157498471 18:48172715-48172737 GTCCAAGGCCCTCTTCGCCCCGG - Intronic
1157630742 18:49092866-49092888 TCCCAAGGACCTCTCAGCCCAGG - Intronic
1157856900 18:51112050-51112072 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1157858372 18:51121163-51121185 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1158460733 18:57643859-57643881 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1158553873 18:58459489-58459511 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1158697266 18:59714337-59714359 TGCCAAGTCCCTCACTGCCCGGG + Intergenic
1158831539 18:61284741-61284763 TTTCAAAGCACTCACAGCCCTGG + Intergenic
1160245381 18:77154852-77154874 TTCAAAGCCCCTCGTGGCCCTGG - Intergenic
1160763419 19:797014-797036 TCCCTTTGCCCTCACGGCCCAGG + Intergenic
1161867928 19:6848151-6848173 TTCCCAGGCCCGCAGGGCCCAGG - Intronic
1161952485 19:7475653-7475675 GTCCAAGGCCTTCCCAGCCCAGG + Intergenic
1162263044 19:9547923-9547945 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1162456795 19:10789978-10790000 TTGCAGGGCCCTCCCTGCCCAGG + Intronic
1162529306 19:11226769-11226791 TTCCAATGCCCTCAGGGGCTAGG - Intronic
1162987099 19:14277741-14277763 TGCCAAGCCCCTCACTGCCCAGG - Intergenic
1163263970 19:16207267-16207289 TCCCCAAGCCCTCACCGCCCAGG - Intronic
1163695428 19:18761176-18761198 TGGCAAGGCCGTCCCGGCCCTGG + Intronic
1164532748 19:29060551-29060573 TTCCCAGGCCCCCAGTGCCCTGG - Intergenic
1165036386 19:33036754-33036776 TGCTAAGCCCCTCACTGCCCGGG - Intronic
1165266933 19:34668309-34668331 TGCTAAGCCCCTCACTGCCCGGG - Intronic
1165415529 19:35691303-35691325 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1166309945 19:41957242-41957264 TGCCAAGGCCCTCCAGGTCCTGG + Intronic
1168122776 19:54262149-54262171 GTCCACGGCCATCACGGCTCTGG + Intronic
924977484 2:191602-191624 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
925172604 2:1759541-1759563 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
927357080 2:22186458-22186480 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
927942187 2:27111712-27111734 TGCTAAGCCCCTCACTGCCCGGG + Intronic
928106361 2:28472787-28472809 TGCTAAGCCCCTCACTGCCCGGG - Intronic
928617947 2:33057672-33057694 TGCTAAGCCCCTCACTGCCCGGG + Intronic
928688553 2:33775464-33775486 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
928701545 2:33903762-33903784 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
929379681 2:41335706-41335728 TGCCAAGTCCCTCACTGCCTGGG - Intergenic
929452676 2:42047808-42047830 TTCCCAGGCCCGGACGGCCGCGG + Intergenic
929915991 2:46136200-46136222 TTCCAATGCCCTCACTTCCCTGG - Intronic
930057773 2:47265132-47265154 TTCCCAGAGCCTCAGGGCCCAGG - Intergenic
930593388 2:53356550-53356572 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
932799166 2:74724158-74724180 GTCCAGGGCCCTCTTGGCCCTGG - Intergenic
932902043 2:75711690-75711712 TGCCAAGTCCCTCACTGCCCGGG - Intergenic
933060836 2:77734984-77735006 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
933442081 2:82326451-82326473 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
933531630 2:83518287-83518309 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
935790295 2:106584505-106584527 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
935878369 2:107536335-107536357 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
936172703 2:110190433-110190455 TGCTAAGCCCCTCACTGCCCAGG + Intronic
937608207 2:123826989-123827011 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
937985765 2:127637476-127637498 TTCCCAGGCCCTCTCAACCCAGG + Exonic
939869049 2:147507024-147507046 TACTAAGCCCCTCACTGCCCCGG - Intergenic
939886435 2:147686496-147686518 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
940112650 2:150171272-150171294 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
940215094 2:151296115-151296137 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
941178884 2:162234957-162234979 TGCTAAGTCCCTCACTGCCCGGG - Intronic
941309244 2:163909638-163909660 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
941928078 2:170915626-170915648 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
942170263 2:173282833-173282855 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
942299597 2:174548796-174548818 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
942317608 2:174709821-174709843 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
942620017 2:177835789-177835811 TGCTAAGTCCCTCACTGCCCAGG - Intronic
943566892 2:189526541-189526563 TTCCAAAGCCCTCAAGAGCCTGG + Intergenic
943941447 2:194002982-194003004 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
943942719 2:194020277-194020299 TCCTAAGCCCCTCACTGCCCAGG - Intergenic
944122130 2:196251612-196251634 TTCAAAGGCCCTCACTACCTAGG - Intronic
944482800 2:200174897-200174919 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
945069641 2:205977342-205977364 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
945401391 2:209387494-209387516 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
945451489 2:210000818-210000840 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
945869143 2:215207989-215208011 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
945872833 2:215245973-215245995 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
945907899 2:215615130-215615152 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
946376506 2:219312936-219312958 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
946725336 2:222656361-222656383 TTCCAGGGCGCTAACGGCCGGGG + Intergenic
948456340 2:238106295-238106317 TCCCAAGGGCCTCAGGGCCATGG - Intronic
948820092 2:240538396-240538418 TGCTAAGCCCCTCACTGCCCGGG - Intronic
1169645351 20:7803762-7803784 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1173027634 20:39324403-39324425 TTCCAAGACCCTCTCCGCCCTGG + Intergenic
1173201340 20:40957440-40957462 TACCAGGTCCCTCATGGCCCTGG - Intergenic
1174354782 20:49990449-49990471 TTCCAGGGCTCTCACTGCCTTGG - Intergenic
1176276311 20:64271844-64271866 TTCCGAGGCCCTCGGGGTCCCGG - Intronic
1176385553 21:6137246-6137268 TGCCAAGGCCCTCACCTCCCAGG - Intergenic
1177318718 21:19493699-19493721 TGCTAAGCCCCTCACTGCCCCGG - Intergenic
1178054527 21:28783872-28783894 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1178074179 21:29000296-29000318 TGCTAAGCCCCTCACTGCCCCGG - Intergenic
1178295025 21:31402491-31402513 TTACAAGGCCCGCACAACCCTGG + Intronic
1178499725 21:33115809-33115831 TTCCAATTCCCTGACAGCCCGGG + Intergenic
1179084598 21:38206268-38206290 TTCCAGGTCCCTCATGGCCTGGG - Intronic
1179433706 21:41345068-41345090 TTCCACAGCCCTCACGTCTCGGG - Intronic
1179737920 21:43401006-43401028 TGCCAAGGCCCTCACCTCCCAGG + Intergenic
1180023994 21:45148225-45148247 TTCCCAAGCCCTCAGGGCCATGG + Intronic
1180103176 21:45599445-45599467 GTCCCAGGCCCCCATGGCCCTGG + Intergenic
1181053499 22:20248644-20248666 GTCCCAGGCACTCACGGTCCAGG + Intronic
1181077671 22:20392610-20392632 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1181450542 22:23017260-23017282 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1182338028 22:29598267-29598289 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1183601999 22:38845072-38845094 TCCCAAGGCCCTTCCAGCCCTGG - Intergenic
1185330879 22:50251567-50251589 CCCCAAGGCCCACCCGGCCCGGG + Intronic
950401018 3:12769112-12769134 TGCTAAGCCCCTCACTGCCCGGG + Intronic
950418422 3:12882517-12882539 TACCAAGGCCAGCACGGCCGGGG + Intergenic
950632642 3:14293327-14293349 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
951024863 3:17817930-17817952 TGCTAAGTCCCTCACTGCCCAGG + Intronic
951323209 3:21271866-21271888 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
951332949 3:21387454-21387476 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
951415436 3:22417068-22417090 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
951491240 3:23272257-23272279 TGCTAAGTCCCTCACTGCCCGGG + Intronic
952275242 3:31870235-31870257 TGCTAAGCCCCTCACTGCCCGGG - Intronic
952393708 3:32902910-32902932 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
952398225 3:32939799-32939821 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
952713316 3:36453461-36453483 TGCTAAGACCCTCACTGCCCGGG - Intronic
953002884 3:38951267-38951289 TGCCAAGCCCCTCACTGCCCGGG - Intergenic
954226195 3:49182867-49182889 TGCTAAGCCCCTCACTGCCCGGG + Intronic
954792581 3:53144130-53144152 TTCCAGGGCCCTCTTGGACCAGG - Intergenic
955219658 3:57012981-57013003 TGCTAAGCCCCTCACTGCCCAGG - Intronic
956195743 3:66651686-66651708 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
956392192 3:68785519-68785541 TGCTAAGCCCCTCACTGCCCAGG + Intronic
956438817 3:69260391-69260413 TGCTAAGCCCCTCACTGCCCAGG - Intronic
956459217 3:69454553-69454575 TGCTAAGCCCCTCACTGCCCGGG - Intronic
956563632 3:70611971-70611993 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
957002264 3:74900178-74900200 TGCTAAGCCCCTCACTGCCCTGG + Intergenic
957386444 3:79502369-79502391 TGCTAAGCCCCTCACTGCCCGGG - Intronic
957419675 3:79951615-79951637 TTCTAAGCCCCTCATTGCCCGGG + Intergenic
957919666 3:86731692-86731714 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
958548601 3:95588783-95588805 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
959699808 3:109288171-109288193 TTACAAGGCCCTTAAGGGCCTGG - Intergenic
960199405 3:114812898-114812920 TGCTAAGCCCCTCACTGCCCGGG + Intronic
960560045 3:119073646-119073668 TGCTAAGCCCCTCACTGCCCAGG + Intronic
960868594 3:122227422-122227444 TGCTAAGCCCCTCACTGCCCGGG + Intronic
961201368 3:125048362-125048384 TACCATGGTCCTCATGGCCCTGG + Intronic
961280009 3:125758824-125758846 TGCCAAGCCCCTCACTGCCCGGG + Intergenic
961298229 3:125904049-125904071 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
961461963 3:127056352-127056374 TGCCAAGCCCCTCACTGCCCGGG + Intergenic
961465046 3:127076486-127076508 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
961821375 3:129577365-129577387 ATCCCAGGCGCCCACGGCCCAGG + Intronic
961874397 3:130010755-130010777 TGCTAAGTCCCTCACTGCCCAGG - Intergenic
961957048 3:130815076-130815098 TGCTAAGCCCCTCACTGCCCTGG + Intergenic
962177249 3:133167636-133167658 TGCTAAGCCCCTCACTGCCCGGG + Intronic
962252740 3:133847399-133847421 TTCCTAGGCCCTCTTGGCACTGG + Intronic
962383771 3:134916604-134916626 TGCTAAGCCCCTCACTGCCCGGG + Intronic
962476504 3:135759771-135759793 TTCCACGGCCCTCACTGGCTTGG - Intergenic
963397876 3:144756998-144757020 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
963554661 3:146772461-146772483 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
963673505 3:148280765-148280787 TGCTAAGCCCCTCACTGCCCCGG + Intergenic
963743007 3:149098094-149098116 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
963744159 3:149109504-149109526 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
964138790 3:153373956-153373978 TTCCAAGACCCTAACAGTCCAGG - Intergenic
964375054 3:156041435-156041457 TGCTAAGCCCCTCACTGCCCCGG - Intronic
964376256 3:156051882-156051904 TGCTAAGCCCCTCACTGCCCAGG - Intronic
965003524 3:162987473-162987495 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
965586973 3:170327539-170327561 TTCTAAGCCACTCACTGCCCGGG - Intergenic
965728571 3:171746001-171746023 TGCTAAGCCCCTCACTGCCCGGG - Intronic
966076061 3:175937489-175937511 TGCCAAGTCCCTCACTTCCCGGG - Intergenic
966191022 3:177271973-177271995 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
966246076 3:177809142-177809164 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
966516890 3:180829222-180829244 TTCCAGAGCCCTCAGGACCCCGG + Intronic
967718343 3:192789148-192789170 TGCTAAGCCCCTCATGGCCCGGG - Intergenic
967935516 3:194724430-194724452 TTCCAAGGCCCTCTGTGACCTGG - Intergenic
968469680 4:773682-773704 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
969314114 4:6371292-6371314 TTCCAAGGGTCTCCCTGCCCAGG + Intronic
969654981 4:8491654-8491676 TGCCAAGTCCCTCACTGCCTGGG + Intronic
969660663 4:8525639-8525661 CTCCTCGGCCCTCATGGCCCAGG - Intergenic
970108314 4:12609747-12609769 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
970272121 4:14358779-14358801 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
970574583 4:17414531-17414553 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
970692001 4:18630815-18630837 TGCCAAGCCCCTCACGGCCCAGG + Intergenic
970817895 4:20179277-20179299 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
971618757 4:28828112-28828134 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
971635102 4:29047636-29047658 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
971709459 4:30092823-30092845 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
972034794 4:34506822-34506844 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
972344633 4:38182680-38182702 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
972505787 4:39718746-39718768 TGCTAAGCCCCTCACTGCCCAGG + Intronic
973039944 4:45457359-45457381 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
973656028 4:53048710-53048732 TTCGATGGCCCTCCAGGCCCTGG + Intronic
973656211 4:53050755-53050777 TTCGATGGCCCTCCAGGCCCTGG + Intronic
974299255 4:60042462-60042484 TGCTAAGCCCCTCACTGCCCTGG + Intergenic
974807567 4:66899703-66899725 TACTAAGCCCCTCACTGCCCGGG + Intergenic
974839795 4:67286941-67286963 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
975028053 4:69576578-69576600 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
975755868 4:77570780-77570802 TGCTAAGCCCCTCACTGCCCAGG - Intronic
975994942 4:80302956-80302978 TGCTAAGCCCCTCACTGCCCAGG - Intronic
976520634 4:86021851-86021873 TGCTAAGTCCCTCACTGCCCGGG + Intronic
976736291 4:88313391-88313413 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
977206516 4:94169961-94169983 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
977400069 4:96521230-96521252 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
977416659 4:96742635-96742657 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
977883590 4:102234455-102234477 TGCTAAGGCCCTCACTGCCTGGG - Intergenic
977885154 4:102245158-102245180 TGCTAAGCCCCTCACGGCCCAGG - Intergenic
979445673 4:120808811-120808833 TGCTAAGTCCCTCACTGCCCAGG + Intronic
979755868 4:124339169-124339191 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
979857507 4:125651973-125651995 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
979865212 4:125745108-125745130 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
980051936 4:128047802-128047824 TGCCAAGTCCCTCACTGCCCGGG + Intergenic
980115217 4:128672779-128672801 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
980562927 4:134501771-134501793 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
980595440 4:134948395-134948417 TGCTAAGCCCCTCACTGCCCTGG + Intergenic
980774490 4:137421137-137421159 TGCTAAGCCCCTCACTGCCCCGG - Intergenic
980824104 4:138053143-138053165 TGCTAAGCCCCTCACTGCCCCGG + Intergenic
981136196 4:141213670-141213692 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
981169567 4:141605639-141605661 TGCTAAGCCCCTCACTGCCCCGG + Intergenic
982758330 4:159251038-159251060 TGCTAAGCCCCTCACTGCCCTGG - Intronic
982770141 4:159390076-159390098 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
982985758 4:162203704-162203726 TGCCAAGACCCTCAATGCCCAGG - Intergenic
983425697 4:167581676-167581698 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
983553061 4:169036079-169036101 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
983834248 4:172369714-172369736 TGCTAAGCCCCTCACTGCCCGGG + Intronic
983835400 4:172377780-172377802 TGCTAAGCCCCTCACTGCCCAGG + Intronic
983843186 4:172482116-172482138 TGCTAAGCCCCTCACTGCCCAGG + Intronic
984241832 4:177227772-177227794 TACTAAGCCCCTCACTGCCCAGG + Intergenic
984662244 4:182386667-182386689 TGCTAAGCCCCTCACTGCCCCGG - Intronic
984684443 4:182650267-182650289 TTCTGAGTCCCTCACTGCCCTGG - Intronic
984770559 4:183433261-183433283 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
984805350 4:183746685-183746707 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
984901748 4:184592025-184592047 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
984918096 4:184741323-184741345 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
985269295 4:188179078-188179100 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
985403605 4:189615461-189615483 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
985541426 5:489289-489311 CTCCCACACCCTCACGGCCCTGG - Intronic
985590883 5:764478-764500 TGCTAAGCCCCTCACTGCCCGGG - Intronic
985668891 5:1196307-1196329 TCCCAAAACCCTCACAGCCCTGG - Intergenic
986919024 5:12662023-12662045 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
986993281 5:13578626-13578648 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
987347433 5:16991182-16991204 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
987384016 5:17312016-17312038 TGCCAAGTCCCTCACTGCCTGGG + Intergenic
988020525 5:25614799-25614821 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
988291755 5:29296689-29296711 TGCTAAGCCCCTCACTGCCCTGG + Intergenic
988500127 5:31777219-31777241 TGCTAAGCCCCTCACTGCCCGGG - Intronic
989559676 5:42836485-42836507 TGCTAAGCCCCTCACTGCCCAGG - Intronic
990512155 5:56498901-56498923 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
990869476 5:60415571-60415593 TGCTAAGCCCCTCACTGCCCGGG - Intronic
991330229 5:65485675-65485697 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
991657791 5:68920984-68921006 TGCTAAGCCCCTCACTGCCCTGG - Intergenic
992048858 5:72925608-72925630 TACTAAGCCCCTCACTGCCCAGG - Intergenic
992050357 5:72935355-72935377 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
993031866 5:82714806-82714828 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
993678600 5:90847718-90847740 TGCTAAGCCCCTCACTGCCCGGG + Intronic
994570295 5:101506144-101506166 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
994620337 5:102155055-102155077 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
994669749 5:102752182-102752204 TGCTAAGCCCCTCACTGCCCTGG - Intergenic
994769792 5:103966570-103966592 TGCTAAGCCCCTCATGGCCCAGG + Intergenic
994841388 5:104929120-104929142 TGCTAAGGCCCTCATTGCCCAGG - Intergenic
994928818 5:106154423-106154445 TGCTAAGCCCCTCACTGCCCCGG - Intergenic
995032317 5:107494360-107494382 TGCTAAGCCCCTCACTGCCCGGG - Intronic
995206664 5:109488088-109488110 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
995388350 5:111612409-111612431 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
995529129 5:113075152-113075174 TGCTAAGCCCCTCACTGCCCAGG - Intronic
995678905 5:114695576-114695598 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
996478702 5:123949431-123949453 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
996575900 5:124976358-124976380 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
996815575 5:127569572-127569594 TGCTAAGCCCCTCACCGCCCGGG - Intergenic
997352213 5:133239102-133239124 TGCTAAGCCCCTCACTGCCCGGG - Intronic
1000085860 5:157886964-157886986 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1000212361 5:159119289-159119311 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1000609143 5:163355974-163355996 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1000889319 5:166784742-166784764 TGCTAAGCCCCTCACTGCCCTGG + Intergenic
1001636444 5:173213561-173213583 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1001841540 5:174880785-174880807 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1001843557 5:174901635-174901657 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1002451047 5:179318703-179318725 TGCCAAGGCCCCCTCGGCTCAGG + Intronic
1002616444 5:180459286-180459308 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1002817706 6:694742-694764 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1003124980 6:3348860-3348882 TTCCTAAGCCCTCCCTGCCCTGG - Intronic
1003178481 6:3771753-3771775 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1003224469 6:4191541-4191563 CCCCAAGCCCCTCACTGCCCAGG + Intergenic
1003589606 6:7425899-7425921 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1003593716 6:7456477-7456499 TGCTAAGCCCCTCACTGCCCCGG - Intergenic
1003749577 6:9040876-9040898 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1003882056 6:10487980-10488002 TGCTAAGCCCCTCACTGCCCCGG + Intergenic
1003897012 6:10617261-10617283 TGCTAAGCCCCTCACTGCCCCGG + Intronic
1003908126 6:10720706-10720728 TGCCAAGCCCCTCATTGCCCAGG - Intergenic
1004045368 6:12018164-12018186 TGCTAAGCCCCTCACTGCCCGGG + Intronic
1004234263 6:13860254-13860276 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1004647943 6:17580863-17580885 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1004691302 6:17994439-17994461 TCCCAAGGCCATCACTTCCCAGG - Intergenic
1004861381 6:19807211-19807233 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1004905430 6:20233332-20233354 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1004914444 6:20319035-20319057 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1005600875 6:27425071-27425093 TGCCAAGCCCCTCATTGCCCGGG + Intergenic
1005725059 6:28639985-28640007 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1006008299 6:31020837-31020859 TGCTAAGCCCCTCACTGCCCGGG - Intronic
1006211765 6:32401430-32401452 TTCAAAGGGCCTCCAGGCCCCGG + Intronic
1006497897 6:34437238-34437260 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1006978372 6:38124579-38124601 TGCTAAGCCCCTCACTGCCCCGG + Intronic
1007204167 6:40135092-40135114 TTCTAGGGCCCTCATGGCCTGGG - Intergenic
1007738735 6:43998216-43998238 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1008005597 6:46406010-46406032 TGCTAAGTCCCTCACTGCCCGGG + Intronic
1008230817 6:48983635-48983657 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1008230897 6:48984061-48984083 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1008308356 6:49933795-49933817 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1008844830 6:55950427-55950449 TTCTAAGACCCTCACTGCCCAGG - Intergenic
1009471416 6:64031274-64031296 TGCTAAGCCCCTCACTGCCCAGG - Intronic
1009746676 6:67825517-67825539 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1010269338 6:73903276-73903298 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1010270368 6:73910105-73910127 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1010617381 6:78029920-78029942 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1011129340 6:84037726-84037748 TGCTAAGCCCCTCACTGCCCAGG + Intronic
1011410330 6:87060000-87060022 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1011931801 6:92723618-92723640 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1012598855 6:101070380-101070402 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1012733536 6:102910886-102910908 TGCTAAGCCCCTCACTGCCCCGG + Intergenic
1013957240 6:115855312-115855334 TGCTAAGCCCCTCACAGCCCAGG - Intergenic
1013963442 6:115928282-115928304 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1014088383 6:117373529-117373551 TGCTAAGCCCCTCACTGCCCGGG + Intronic
1014114162 6:117653804-117653826 TCTCAAGGCCCTCACAGCTCGGG - Intergenic
1014160001 6:118157121-118157143 TACCAAGGCTCTGACAGCCCAGG + Intronic
1014240738 6:119015441-119015463 TGCTAAGCCCCTCACTGCCCGGG - Intronic
1015572256 6:134633788-134633810 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1016172935 6:141041815-141041837 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1016451407 6:144186894-144186916 CGCCAAGGCCATCAAGGCCCGGG + Exonic
1018196804 6:161362380-161362402 TTCCCAGGCCCTAAGGGCACAGG + Intronic
1018551345 6:165001870-165001892 TACTAAGCCCCTCACTGCCCGGG + Intergenic
1018579801 6:165298579-165298601 TTCCCAGGCCAGCAGGGCCCTGG - Intronic
1018720162 6:166566166-166566188 AGCCAAGGCCATCACGTCCCAGG - Intronic
1018902022 6:168056425-168056447 TTCCAAAGACCCCACTGCCCCGG - Exonic
1019358999 7:595213-595235 TTCCTCGGCCCTCACGCTCCTGG + Intronic
1019520544 7:1458842-1458864 CTCCGAGGCTCTCACTGCCCAGG - Intronic
1019567636 7:1692416-1692438 TTGCAAGGCCCTCCCGGCCCAGG - Intronic
1019618357 7:1977359-1977381 TGCTAAGCCCCTCACTGCCCGGG + Intronic
1019944274 7:4314181-4314203 TACTAAGTCCCTCACTGCCCGGG + Intergenic
1019965758 7:4497173-4497195 TGCTAAGTCCCTCACTGCCCGGG + Intergenic
1020008282 7:4793644-4793666 TGCTAAGCCCCTCACTGCCCAGG - Intronic
1020333360 7:7042161-7042183 TTCCTAGGCCACCAGGGCCCTGG + Intergenic
1020662206 7:10995795-10995817 TGCTAAGCCCCTCACTGCCCGGG + Intronic
1021359414 7:19692492-19692514 TGCTAAGCCCCTCACTGCCCTGG + Intergenic
1021761278 7:23904954-23904976 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1022174142 7:27857256-27857278 TGCCAAGCCCCTCACTGCCTGGG + Intronic
1022870308 7:34471482-34471504 TGCAAAGGCCCTCAGGCCCCTGG + Intergenic
1024107430 7:46107541-46107563 TTCCAAGGCCCTCTCCCTCCGGG - Intergenic
1024700640 7:51901138-51901160 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1024741778 7:52362767-52362789 TGCTAAGCCCCTCACTGCCCTGG - Intergenic
1024748211 7:52431484-52431506 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1024794340 7:53004049-53004071 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1026130818 7:67619421-67619443 TCCCAGGGCCCTCCCGTCCCCGG - Intergenic
1026202942 7:68231148-68231170 TGCCAAGTCCCTCACTGCCCGGG - Intergenic
1026516559 7:71078106-71078128 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1027139565 7:75647688-75647710 CTCCAAGGCCCTGCTGGCCCTGG + Intronic
1027238011 7:76309680-76309702 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1027466775 7:78524256-78524278 TTCCAAGGCCCTTTCTGCCGGGG - Intronic
1027579718 7:79977846-79977868 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1027778957 7:82499729-82499751 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1028727172 7:94101009-94101031 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1028857201 7:95605523-95605545 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1029076149 7:97936045-97936067 TGCTAAGCCCCTCACTGCCCCGG - Intergenic
1029407085 7:100381836-100381858 TGCTAAGTCCCTCACTGCCCGGG - Intronic
1029809625 7:103034446-103034468 TGCTAAGCCCCTCACTGCCCGGG + Intronic
1029903965 7:104071916-104071938 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1030292690 7:107888104-107888126 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1030780408 7:113593436-113593458 TGCTAAGTCCCTCACGGCCCGGG - Intergenic
1030980689 7:116182190-116182212 TGCTAAGTCCCTCACTGCCCCGG + Intergenic
1031056536 7:116998241-116998263 TGCTAAGCCCCTCACTGCCCTGG + Intronic
1031605521 7:123763415-123763437 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1031902860 7:127429287-127429309 TGCTAAGCCCCTCACTGCCCAGG - Intronic
1032080033 7:128854164-128854186 ATCCCAGGCGCTCCCGGCCCAGG - Exonic
1032437114 7:131909444-131909466 TGCTAAGTCCCTCACTGCCCGGG - Intergenic
1032465031 7:132138882-132138904 TTCCCAGCCCTTCACAGCCCTGG + Intronic
1032481081 7:132247745-132247767 CTCCAAGGCCCTCACTGCCAGGG + Intronic
1033065083 7:138146281-138146303 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1033312424 7:140271548-140271570 TGCTAAGCCCCTCACTGCCCCGG + Intergenic
1033839929 7:145360880-145360902 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1034556971 7:151856320-151856342 TTCCAAGGCCCGCGCAGCCGAGG + Intronic
1035024878 7:155818785-155818807 TTCCATGCCCCTCAAGCCCCTGG - Intergenic
1035463906 7:159063383-159063405 TGCTAAGCCCCTCACTGCCCGGG + Intronic
1035833911 8:2727951-2727973 TGCCAAGCCCTTCACTGCCCGGG - Intergenic
1036135058 8:6152824-6152846 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1036260470 8:7235813-7235835 TGCTAAGCCCCTCACGGCCCGGG - Intergenic
1036306143 8:7603709-7603731 TGCTAAGCCCCTCACAGCCCCGG + Intergenic
1036312507 8:7694369-7694391 TGCTAAGCCCCTCACGGCCCGGG - Intergenic
1036356989 8:8051694-8051716 TGCTAAGCCCCTCACAGCCCCGG + Intergenic
1036554653 8:9847999-9848021 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1036663403 8:10722781-10722803 TTCCCAGGCCCTCTGGGCCAAGG - Intergenic
1036801368 8:11794919-11794941 TGCTAAGCCCCTCACTGCCCTGG - Intergenic
1036851308 8:12203607-12203629 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1036872672 8:12445881-12445903 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1036901581 8:12673568-12673590 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1036928656 8:12931548-12931570 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1037263849 8:17037061-17037083 TGCTAAGTCCCTCACTGCCCGGG + Intronic
1037899132 8:22677325-22677347 GCCCAAGGCCCCCACAGCCCGGG - Intergenic
1038847600 8:31244350-31244372 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1039587611 8:38719957-38719979 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1040000872 8:42575333-42575355 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1040014450 8:42689610-42689632 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1040323956 8:46331849-46331871 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1040688854 8:49910468-49910490 TTCAAAGGTCCACATGGCCCTGG + Intronic
1040791016 8:51230764-51230786 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1041636684 8:60153202-60153224 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1042512571 8:69626715-69626737 TGCTAAGCCCCTCACTGCCCGGG + Intronic
1043435318 8:80231925-80231947 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1043670634 8:82880805-82880827 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1043726002 8:83611403-83611425 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1044404892 8:91816480-91816502 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1044441640 8:92230892-92230914 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1046208896 8:111041081-111041103 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1046251875 8:111642943-111642965 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1046497765 8:115036808-115036830 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1046521400 8:115330812-115330834 TGCGAAGCCCCTCACTGCCCAGG + Intergenic
1046661205 8:116949989-116950011 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1048274738 8:133057814-133057836 TTCCAAGGCATTCACTGTCCTGG + Intronic
1049157704 8:141076804-141076826 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1049450364 8:142658108-142658130 TTCCAAGTCCCCCAGGGGCCTGG + Intronic
1049500307 8:142959593-142959615 TGCCAAGTCCCTCACTGCCCAGG - Intergenic
1049857933 8:144875286-144875308 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1049944512 9:581015-581037 TGCTAAGCCCCTCACTGCCCAGG + Intronic
1050249950 9:3733927-3733949 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1050975255 9:11929099-11929121 TACTAAGTCCCTCACTGCCCGGG + Intergenic
1051449406 9:17178629-17178651 TGCTAAGCCCCTCACTGCCCGGG + Intronic
1051549784 9:18315587-18315609 TGCTAAGTCCCTCACTGCCCGGG + Intergenic
1052313431 9:27092770-27092792 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1052840412 9:33288294-33288316 TTCCAAGGCCCCCCCACCCCTGG - Intergenic
1053123002 9:35560273-35560295 CTCCAGGGCCCTCCTGGCCCCGG - Exonic
1053475244 9:38377692-38377714 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1053678284 9:40461122-40461144 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1053928266 9:43089465-43089487 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1054285442 9:63163826-63163848 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1054291361 9:63296659-63296681 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1054389380 9:64601197-64601219 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1054506336 9:65915173-65915195 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1055102570 9:72480445-72480467 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1055248600 9:74276175-74276197 TGCCAAGCCCCTCACTGCCTGGG + Intergenic
1055557584 9:77490627-77490649 TGCTAAGCCCCTCACTGCCCAGG + Intronic
1055651369 9:78410113-78410135 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1056305758 9:85289162-85289184 TGCTAAGCCCCTCACTGCCCCGG - Intergenic
1056914017 9:90729588-90729610 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1057216496 9:93231585-93231607 TTCCTTGGGCCTCACAGCCCGGG - Intronic
1057300703 9:93880057-93880079 TGCTAAGCCCCTCACTGCCCTGG - Intergenic
1057860030 9:98633734-98633756 TTCCACGTCCCTCCCCGCCCTGG - Intronic
1057905602 9:98980617-98980639 TTTCATGGCCCTCAGGGCCAGGG - Intronic
1057907197 9:98992349-98992371 TGCTAAGCCCCTCACTGCCCAGG + Intronic
1058235690 9:102487184-102487206 TGCTAAGTCCCTCACTGCCCAGG + Intergenic
1058379576 9:104363144-104363166 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1059791156 9:117642972-117642994 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1062450575 9:136614126-136614148 TGCCAAGGCCAGCACAGCCCAGG - Intergenic
1186471034 X:9822353-9822375 TTCCATGGCTCCCACTGCCCTGG - Intronic
1187125642 X:16451935-16451957 GTACAAGGCACTCAAGGCCCTGG + Intergenic
1188166956 X:26873901-26873923 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1188189521 X:27157120-27157142 TGCCAAGTCCCTCACTGCCTGGG - Intergenic
1188881809 X:35499393-35499415 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1189467125 X:41285953-41285975 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1191053910 X:56222796-56222818 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1191105079 X:56767608-56767630 TGCTAAGCCCCTCACTGCCCTGG - Intergenic
1192186759 X:68952273-68952295 TGCTAAGCCCCTCACTGCCCAGG - Intergenic
1192561961 X:72132989-72133011 TTCCAAGGTCACCACTGCCCTGG - Intergenic
1193719976 X:84974995-84975017 TGCTAAGCCCCTCACAGCCCAGG - Intergenic
1193804051 X:85972602-85972624 TGCTAAGCCCCTCACTGCCCGGG + Intronic
1194025592 X:88746572-88746594 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1194173489 X:90618001-90618023 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1194204456 X:90995522-90995544 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1194890487 X:99372281-99372303 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1196197924 X:112855100-112855122 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1196705921 X:118717181-118717203 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1197533780 X:127663215-127663237 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1198468107 X:136921525-136921547 TGCTAAGCCCCTCACTGCCCCGG - Intergenic
1199285100 X:146046401-146046423 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1199356257 X:146867127-146867149 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1199628111 X:149758684-149758706 TGCTAAGCCCCTCACTGCCCCGG - Intergenic
1200519710 Y:4195693-4195715 TGCTAAGCCCCTCACTGCCCAGG + Intergenic
1201285491 Y:12375254-12375276 TGCTAAGCCCCTCACTGCCCGGG + Intergenic
1201469107 Y:14314606-14314628 TGCTAAGCCCCTCACTGCCCGGG - Intergenic
1201487064 Y:14505766-14505788 TGCTAAGTCCCTCACTGCCCGGG - Intergenic
1201573024 Y:15433960-15433982 TGCTAAGCCCCTCACTGCCCGGG - Intergenic