ID: 1114517276

View in Genome Browser
Species Human (GRCh38)
Location 14:23308150-23308172
Sequence AGCCAGCTGCGTCTCCAGGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 200}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114517276_1114517282 0 Left 1114517276 14:23308150-23308172 CCTACCTGGAGACGCAGCTGGCT 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1114517282 14:23308173-23308195 GACTGGATCCACAGCAGTGGGGG 0: 1
1: 0
2: 0
3: 15
4: 148
1114517276_1114517279 -3 Left 1114517276 14:23308150-23308172 CCTACCTGGAGACGCAGCTGGCT 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1114517279 14:23308170-23308192 GCTGACTGGATCCACAGCAGTGG 0: 1
1: 0
2: 1
3: 38
4: 259
1114517276_1114517280 -2 Left 1114517276 14:23308150-23308172 CCTACCTGGAGACGCAGCTGGCT 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1114517280 14:23308171-23308193 CTGACTGGATCCACAGCAGTGGG 0: 1
1: 0
2: 1
3: 14
4: 145
1114517276_1114517283 4 Left 1114517276 14:23308150-23308172 CCTACCTGGAGACGCAGCTGGCT 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1114517283 14:23308177-23308199 GGATCCACAGCAGTGGGGGCTGG 0: 1
1: 0
2: 0
3: 45
4: 276
1114517276_1114517284 5 Left 1114517276 14:23308150-23308172 CCTACCTGGAGACGCAGCTGGCT 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1114517284 14:23308178-23308200 GATCCACAGCAGTGGGGGCTGGG 0: 1
1: 0
2: 1
3: 29
4: 209
1114517276_1114517281 -1 Left 1114517276 14:23308150-23308172 CCTACCTGGAGACGCAGCTGGCT 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1114517281 14:23308172-23308194 TGACTGGATCCACAGCAGTGGGG 0: 1
1: 0
2: 2
3: 18
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114517276 Original CRISPR AGCCAGCTGCGTCTCCAGGT AGG (reversed) Exonic
900255528 1:1696530-1696552 TGCAGGCTGGGTCTCCAGGTGGG - Intronic
900264205 1:1749232-1749254 TGCAGGCTGGGTCTCCAGGTGGG - Intergenic
902505942 1:16939125-16939147 CGCCAGCTGCAGGTCCAGGTAGG + Exonic
902882800 1:19383893-19383915 AGCCAGCGGCCTCTGCAGGTAGG - Intronic
903288293 1:22290821-22290843 TGCCACCTGCTTCTCCACGTTGG - Intergenic
905884867 1:41486199-41486221 AGCCAGCTCAGTCTCCAGGAAGG - Intergenic
906524139 1:46484850-46484872 ACACATCTGCCTCTCCAGGTGGG + Intergenic
912305391 1:108561086-108561108 AGAGAGCGGCGTCTCCAGTTAGG + Intronic
913252210 1:116920947-116920969 AGCCAGCTGAGTCTATTGGTTGG - Intronic
913972016 1:143423152-143423174 CCCCAGCTGCCTCTCCAGGGAGG - Intergenic
914066397 1:144248765-144248787 CCCCAGCTGCCTCTCCAGGGAGG - Intergenic
914112756 1:144717589-144717611 CCCCAGCTGCCTCTCCAGGGAGG + Intergenic
916461322 1:165027915-165027937 AGCTAGCTGCGTCTGGAAGTTGG - Intergenic
919188895 1:194189954-194189976 AGCCAGCTGCTTCCACTGGTGGG - Intergenic
921951510 1:220934912-220934934 AACGAGCTGAGTCTCCAGATAGG - Intergenic
922235246 1:223717703-223717725 AGCCAGGTGCTTCTGCAGCTAGG - Intronic
924289468 1:242523827-242523849 GCCCACCTGCGTCTCCCGGTAGG - Intronic
924343354 1:243054381-243054403 TCCCGGCTGCGTCTCCAGGCCGG - Intergenic
1063142734 10:3269797-3269819 TGACAGCTGGGTCTTCAGGTCGG + Intergenic
1066046866 10:31602759-31602781 AGCCAGCTGGGGCTCCAGGCAGG - Intergenic
1067080253 10:43208651-43208673 CCCCAGGTGGGTCTCCAGGTAGG - Intronic
1069150605 10:64954365-64954387 AGCTTGCTGGGTCCCCAGGTAGG - Intergenic
1069409530 10:68139091-68139113 AGCCAGCAGCTGCTCCATGTTGG - Intronic
1069485890 10:68823072-68823094 AGCCGGCTGGGCTTCCAGGTCGG - Intergenic
1070821410 10:79357485-79357507 AGCCAGTTGCGGCTGCTGGTTGG - Intergenic
1071281455 10:84107907-84107929 AGCCAGCTGAGAGTCCAGCTGGG - Intergenic
1071296708 10:84226054-84226076 AGACAGCTGCTTCTGCAGCTTGG + Intergenic
1075167931 10:120085905-120085927 ACCTGGCTGCTTCTCCAGGTAGG + Intergenic
1075900637 10:126040411-126040433 AGCCAGCTGAGGGTCCAGGTGGG - Intronic
1075977246 10:126706508-126706530 TGCCAGCTGCCTCTCTATGTGGG + Intergenic
1076889312 10:133276178-133276200 CCCCTGCTGCCTCTCCAGGTTGG - Intronic
1076890595 10:133281268-133281290 GGCCAGCGTCATCTCCAGGTGGG - Exonic
1076894423 10:133302877-133302899 AGCCTGCTGCGTGTCCACGGAGG - Exonic
1077126866 11:943641-943663 TGCCACCTGCATCTCCAGTTGGG - Intronic
1077126906 11:943879-943901 TGCCACCTGCATCTCCAGTTGGG - Intronic
1077307840 11:1875882-1875904 CCCCAGCTGCCTCTCCAGGGAGG + Intronic
1077342125 11:2030865-2030887 TGCCAGGGGGGTCTCCAGGTGGG + Intergenic
1080599494 11:33808487-33808509 AGCAAGCTGAGTCTGCACGTTGG + Intergenic
1081329737 11:41788544-41788566 GGCCAGCTGGGGCTCCAGGTGGG - Intergenic
1084452105 11:69245299-69245321 AGCCAGATGGGTGTCAAGGTGGG - Intergenic
1084464336 11:69313414-69313436 AGCCAGCAGCATCTGCAAGTGGG + Intronic
1084512767 11:69616430-69616452 AGAGAGCTGCGTGACCAGGTGGG - Intergenic
1084558138 11:69887177-69887199 CGCCAGCTGCGTCTCAAGTTAGG + Intergenic
1084758210 11:71252228-71252250 AGTGAGCCGCGTGTCCAGGTGGG - Intronic
1087744783 11:101930774-101930796 AGCCAGCTGGGCCTCTGGGTTGG - Intronic
1089813620 11:121152659-121152681 AGCCACCTCCGTCTGCATGTTGG + Intronic
1090280996 11:125455830-125455852 AACCAGATGCCTCTCAAGGTAGG - Exonic
1202825111 11_KI270721v1_random:86054-86076 TGCCAGGGGGGTCTCCAGGTGGG + Intergenic
1091603797 12:1933971-1933993 AGGCTGCTCCATCTCCAGGTCGG - Intergenic
1092287267 12:7135929-7135951 TGCCAGCTGGGTTTACAGGTGGG - Exonic
1097141097 12:56903021-56903043 AGTCATCTGGGTCTCCAGGGTGG - Intergenic
1097235150 12:57534339-57534361 TCCCAGCAGCTTCTCCAGGTGGG + Exonic
1099414432 12:82370014-82370036 AGCCAGCTGGGCCTCTGGGTTGG - Intronic
1100286588 12:93172649-93172671 AGGAAGCTGCTGCTCCAGGTTGG - Intergenic
1100521436 12:95379651-95379673 AGCCAGCTGGAGTTCCAGGTGGG + Intronic
1100679310 12:96901411-96901433 AGCCAGCTGCTTCCACTGGTGGG + Intergenic
1102963836 12:117111561-117111583 AGCCAGCTGCATCGCCCCGTGGG - Intergenic
1103063375 12:117876436-117876458 AGGCAGCTGCCTCTGCAGGAAGG + Intronic
1104071612 12:125350646-125350668 GGCCAGCTGCGTCTGCTGGCTGG + Intronic
1113511524 13:110858995-110859017 AGGCAGCAGAGACTCCAGGTGGG + Intergenic
1114352538 14:21869325-21869347 AGACAGCCGAGTCTTCAGGTTGG - Intergenic
1114517276 14:23308150-23308172 AGCCAGCTGCGTCTCCAGGTAGG - Exonic
1117710250 14:58521075-58521097 AGCCAACTGCTGCTCAAGGTCGG - Intronic
1118295443 14:64564151-64564173 AGCCATCTCCATCTCCAGGTAGG - Intronic
1119438043 14:74610975-74610997 AGGTAGATGCGTCTCCAGGAGGG - Intronic
1120812989 14:88824373-88824395 AGGCAGCTGCGCCTCCTGGGAGG + Intronic
1121520243 14:94581286-94581308 AGGGAGCTGCGTCTGCAGGCAGG + Intronic
1122116042 14:99527744-99527766 ACCCAGCTGTGGCTCCCGGTGGG - Intronic
1123144240 14:106112541-106112563 AGTCAGGTGTGTCTCCATGTGGG - Intergenic
1123192223 14:106582422-106582444 AGTCAGGTGTGTCTCCATGTGGG - Intergenic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1124878508 15:33619722-33619744 AGGCAGCTGCTTCTCCACATTGG + Intronic
1124938959 15:34200140-34200162 AGCCAGCTGGGTTTCTGGGTTGG - Intronic
1126191771 15:45885931-45885953 AGCCAGCTCCCTCTGCTGGTGGG + Intergenic
1126530872 15:49710412-49710434 AGCCAGCAGGGTCTGCAGGCAGG + Intergenic
1130647405 15:85741191-85741213 GGCCTGCTGCTTCTGCAGGTTGG - Exonic
1131094451 15:89646847-89646869 AGCCAACTTCATCTCCAGGGAGG + Exonic
1131198341 15:90375140-90375162 AGCCAGCTGGGCTTCTAGGTTGG + Intergenic
1132554748 16:567585-567607 AGCCCGTGGAGTCTCCAGGTGGG - Exonic
1133698631 16:8288439-8288461 ATCAACCTGCATCTCCAGGTTGG + Intergenic
1133771286 16:8868527-8868549 CGCCAGCTGTGGCTCGAGGTTGG - Intronic
1133937420 16:10280417-10280439 ATGCAGCTGCTTCTCCAGGACGG - Intergenic
1134023346 16:10937116-10937138 TGCCAGCTGCGTCTTCAGACAGG - Intronic
1134538222 16:15043717-15043739 AGGCAGGTGCATCACCAGGTCGG + Intronic
1137503107 16:49026441-49026463 AGACAGGTGAGTCACCAGGTGGG - Intergenic
1137844526 16:51674340-51674362 TGGCAGCTGCCACTCCAGGTAGG + Intergenic
1138046535 16:53731309-53731331 AGGGATCTGCTTCTCCAGGTGGG + Intronic
1138657943 16:58501427-58501449 AGCCGGCCCCGCCTCCAGGTAGG - Intronic
1139583417 16:67886150-67886172 AGCCCGCAGCGTCTCCTGGTTGG - Exonic
1140809533 16:78564090-78564112 AGGCAGTTGCGTCTGTAGGTTGG - Intronic
1141384979 16:83613703-83613725 AGGCAGCTGAGACTACAGGTGGG - Intronic
1141688890 16:85585543-85585565 GCCCAGCTGGGTCTCCATGTGGG + Intergenic
1142055971 16:87996262-87996284 AGGCAGCTGAGACGCCAGGTGGG - Intronic
1143474460 17:7194765-7194787 AGTCAGCTGGGATTCCAGGTGGG - Intronic
1145043175 17:19592044-19592066 AGCCAGCTGCTTCTCCTGTGAGG - Intergenic
1146594657 17:34157820-34157842 AGGCAACTGGGACTCCAGGTGGG + Intronic
1146903416 17:36602382-36602404 ACTCGGCTGCGTCTCCAAGTTGG - Intronic
1147539647 17:41346567-41346589 CGCCAGCTGGGACTCCACGTTGG + Exonic
1147541597 17:41364898-41364920 CGCCAGCTGGGACTCCACGTTGG + Exonic
1147543280 17:41379075-41379097 TGCCAGCTGAGACTCCACGTTGG + Exonic
1147545074 17:41394967-41394989 CGCCAGCTGGGACTCCACGTTGG + Exonic
1147553687 17:41462949-41462971 AGCCAGCTGGGCCTCAACGTTGG + Exonic
1147555702 17:41477637-41477659 GGCCAGCTGGGCCTCCACGTTGG + Exonic
1148186110 17:45645006-45645028 AGGCAGCTGGGACTACAGGTGGG - Intergenic
1149409925 17:56394741-56394763 TGCCAGCTGCGTGTCCAGTTGGG - Intronic
1149439644 17:56663718-56663740 AGCCTGCTGCCTCCTCAGGTGGG + Intergenic
1150208291 17:63426138-63426160 AGCCGGCTGCCTTTGCAGGTCGG - Exonic
1150658355 17:67055382-67055404 GGCCATCAGCGACTCCAGGTGGG + Intronic
1151183927 17:72349849-72349871 AGGCAGCTTCTTCTCCAGGAGGG + Intergenic
1152096691 17:78276775-78276797 TGCCACCTGGGTCCCCAGGTGGG + Intergenic
1152388803 17:79991169-79991191 GCCCAGCTGGGTCTCCAGGGTGG - Intronic
1152751305 17:82063654-82063676 AACCAGCAGTGTCTCCAGTTGGG + Intronic
1152857578 17:82674783-82674805 GGCCAGCTTCCTCACCAGGTGGG + Intronic
1153571274 18:6475787-6475809 AGCCAGTTGCATCCCCAGGTAGG + Intergenic
1154310625 18:13263735-13263757 AGCCAGCTGTGTCTCAAGCTCGG - Intronic
1156379841 18:36547800-36547822 AGCCAGCTGCTTCGTGAGGTTGG + Intronic
1157718626 18:49906550-49906572 AGCCCGCAGCTTCTCCAGGTAGG + Exonic
1159065054 18:63560255-63560277 AGCAAGCTGTGTCTCCATCTGGG + Intronic
1160875588 19:1295022-1295044 AGCGAGGTGGGTGTCCAGGTGGG - Intronic
1160894831 19:1397485-1397507 GGGCACCTGCGTCTCCTGGTCGG + Intronic
1162019092 19:7860592-7860614 CTCCAGCTCGGTCTCCAGGTGGG - Exonic
1162785871 19:13034361-13034383 AGCATGCTGCCTCTCGAGGTTGG - Intronic
1163242199 19:16071046-16071068 AGCCAGCTGCGTGGCCAAGGAGG + Intronic
1164148986 19:22532597-22532619 AGGCAGCAGCGCGTCCAGGTGGG + Intergenic
1164545542 19:29158892-29158914 AGCCCTCTGCTTCTCCAGTTGGG - Intergenic
1164594355 19:29524249-29524271 AGACTGCTACCTCTCCAGGTGGG + Intergenic
1164631959 19:29767830-29767852 GGGAAGCTGCGTCTCCAGGTGGG + Intergenic
1164768477 19:30789724-30789746 AGCCAGCTGGACCTCCAGGGAGG + Intergenic
1165721266 19:38081610-38081632 AGCCAGCTGTGGCGCCAGGGTGG + Exonic
1165760775 19:38320063-38320085 CGCCCGCAGCGTCTCCAGCTCGG - Exonic
1166596972 19:44058836-44058858 AGCTAGCTGCACCTCCAGGCAGG + Intronic
1167493197 19:49803398-49803420 AGCCTCCTGCCTCTCCACGTCGG + Intronic
931540085 2:63322016-63322038 AGCCAGCTGGGTTTCTGGGTTGG + Intronic
934176715 2:89584089-89584111 CCCCAGCTGCCTCTCCAGGGAGG - Intergenic
934287021 2:91658449-91658471 CCCCAGCTGCCTCTCCAGGGAGG - Intergenic
934517354 2:94997087-94997109 TGCCAGCTGCCAGTCCAGGTTGG - Intergenic
935095763 2:99942831-99942853 AGCCAGCTGTGAGGCCAGGTGGG - Intronic
935800398 2:106689923-106689945 TGCCAGCTCCTCCTCCAGGTAGG - Intergenic
936263351 2:110980623-110980645 AGCCTGCTGAGTCTCCACGCTGG + Intronic
938070030 2:128303526-128303548 AGACAGGTGCGTGTGCAGGTGGG - Intronic
948356152 2:237378992-237379014 AGGCAGCTGCAGCTCCAGGGAGG - Exonic
1169140240 20:3223600-3223622 AGCCAGCTGCTCCTCCAGACAGG - Exonic
1173361351 20:42347166-42347188 AACCAGCTGACTCACCAGGTAGG + Intronic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1175854552 20:62113544-62113566 AGCCCGGTGTGTCACCAGGTGGG - Intergenic
1179726292 21:43343268-43343290 AGGCAGGTGCGTCCCCAGGGAGG - Intergenic
1180940971 22:19659314-19659336 AGCCTGATGAGTCCCCAGGTGGG + Intergenic
1182128377 22:27832997-27833019 AGCCAGCTGTATCTGCAGATAGG - Intergenic
1182369279 22:29799504-29799526 TGCCAGCTGCTTCTTCAGTTAGG - Intronic
1183347236 22:37314667-37314689 AGCCAGCTCTGTCTCCAGGGAGG + Exonic
1184684398 22:46089608-46089630 TGCCAGCAGCCCCTCCAGGTGGG - Intronic
949255850 3:2044899-2044921 AGTCATCAGCGTCTCCATGTTGG + Intergenic
953021672 3:39118420-39118442 AGCCTGCGGCTTATCCAGGTGGG - Intronic
954292239 3:49655778-49655800 AGCCAACTGCATCTCCCCGTGGG - Exonic
954296665 3:49678094-49678116 AGTCAGCTGGGTCTTCAGGAGGG + Intronic
954624339 3:52014425-52014447 AGGCAGTTGGGGCTCCAGGTTGG + Intergenic
954663561 3:52238737-52238759 AGCCACATTCATCTCCAGGTAGG + Intronic
962711948 3:138094857-138094879 AGGCAGCGGCAGCTCCAGGTGGG - Exonic
968362554 3:198157532-198157554 AGCCAGCGGCGTCTCCCGAGTGG - Intergenic
968755814 4:2416127-2416149 AGGCAGCTGCCTTTCCAGGCAGG - Intronic
968903510 4:3441802-3441824 AGACAGCTGGGCTTCCAGGTAGG + Intergenic
969429290 4:7144927-7144949 AGACAGCAGGGTCTCCAGGGAGG - Intergenic
969706533 4:8795185-8795207 GGCCAGCAGCGTCTCCAGCAGGG - Intergenic
970614735 4:17758443-17758465 AGACAGCTGCTGCTACAGGTAGG - Intronic
975238425 4:72028698-72028720 AGAAAGCTTCGTCTCCAGTTTGG - Intergenic
977103272 4:92846092-92846114 AGCCACCTCCTTCTCCAAGTTGG + Intronic
979758765 4:124374117-124374139 ATCCAGCTGGGGATCCAGGTTGG + Intergenic
980809259 4:137853810-137853832 AGCCAGCTGGGCTTCTAGGTCGG + Intergenic
981000508 4:139824813-139824835 AGACAGATGCGTCTCCAAGGAGG - Intronic
985423517 4:189807027-189807049 AGCCAGCTGGGCTTCCGGGTAGG - Intergenic
985897367 5:2756597-2756619 CGCCAGCTGCGGCTCCAGCCTGG + Intergenic
992460214 5:76953644-76953666 AGCCAGCTCCCGCTTCAGGTTGG - Exonic
994148726 5:96423529-96423551 AGAAAGATGGGTCTCCAGGTTGG - Intronic
996010661 5:118478695-118478717 AGCTTGCTGGGTCTCCAGGCAGG + Intergenic
997713606 5:136026737-136026759 AGCCACCTGCATTTCCAGGAGGG - Intergenic
997823560 5:137086899-137086921 AGCCAGCTGCGTCTGATGGATGG + Intronic
998441055 5:142162369-142162391 AGCCAGGTGCTTCTCCATGGAGG - Intergenic
1001050982 5:168414353-168414375 GGCCAGCTGGATCTTCAGGTTGG - Exonic
1006008277 6:31020765-31020787 GGCCAGCTGCAGTTCCAGGTAGG + Intronic
1006723061 6:36172695-36172717 AGCCAGCTGTGCCTCCAATTGGG + Intergenic
1012196239 6:96344417-96344439 AGCCACCATGGTCTCCAGGTGGG + Intergenic
1012752644 6:103183611-103183633 TGGCAGCAGTGTCTCCAGGTGGG - Intergenic
1013343694 6:109239246-109239268 AGCCTGCTGCTTGTCCATGTGGG + Intergenic
1015355504 6:132272947-132272969 AGCCTGCTGCTTCCACAGGTGGG - Intergenic
1017488637 6:154925058-154925080 AGCCTGCCGCGCCTCCAAGTCGG + Intronic
1019253128 7:31175-31197 AGCCAGCGGCGTCTCCCGAGTGG + Intergenic
1019525275 7:1477884-1477906 AGTCAGCAGCTCCTCCAGGTGGG + Exonic
1019724370 7:2593054-2593076 CTCCAGCTCCTTCTCCAGGTCGG - Exonic
1021943274 7:25700805-25700827 AGCCAGCTGGGCTTCCGGGTTGG - Intergenic
1025770479 7:64500707-64500729 AGCCAACTGCTGCTCGAGGTCGG - Intergenic
1027698313 7:81437404-81437426 GGCCAGCTGCAGCTCCGGGTGGG - Intergenic
1029506701 7:100967336-100967358 CGTGAACTGCGTCTCCAGGTGGG - Exonic
1032051683 7:128654085-128654107 TCCCGGCTGCGTCTCCAGGCCGG + Intergenic
1035034733 7:155887299-155887321 AGAGAGCTGCGTGGCCAGGTCGG + Intergenic
1035445506 7:158939312-158939334 AGCTAGCTGGGACTACAGGTGGG - Intronic
1037528369 8:19749926-19749948 AGCCTGGTGCATCTCCAGATTGG - Intronic
1041044199 8:53876698-53876720 ACCCAGCGGCTTCTCCAGTTAGG - Intronic
1041304291 8:56444922-56444944 AGCTACCTGAGTCTCGAGGTTGG + Intronic
1044998429 8:97859059-97859081 AGTCTGCTGTGTCTCCAGGCTGG + Intergenic
1045654602 8:104373856-104373878 AGTGGGCTGCTTCTCCAGGTGGG - Intronic
1046382319 8:113467426-113467448 AGCCAGGTGAGTCTCCAGATAGG - Intergenic
1046693296 8:117310254-117310276 AGCCATCTGAGTCTACATGTGGG - Intergenic
1048250614 8:132863927-132863949 ACCTTGCTGCTTCTCCAGGTGGG + Intergenic
1051314239 9:15810796-15810818 AGCCAGCTCCCTCTCCTTGTGGG - Intronic
1052790983 9:32875476-32875498 AGCCTGCTGGGCATCCAGGTTGG - Intergenic
1053291384 9:36881811-36881833 AGCCAGCAGCGGCACCAGGGAGG - Intronic
1053517876 9:38746999-38747021 AGCCAGCTCTGTCTCCAGAAAGG - Intergenic
1060858195 9:126932916-126932938 AGCCAGCTGCGTCCACAGCCCGG - Intronic
1062747242 9:138221191-138221213 AGCCAGCGGCGTCTCCCGAGTGG - Intergenic
1190410920 X:50136326-50136348 AGTCAACTGGGTCACCAGGTGGG + Intergenic
1192970347 X:76221810-76221832 AGCTAGCTGGGTCCCCAGGCAGG - Intergenic
1193062672 X:77223040-77223062 AGCTCGCTGCGTCTCCAAGCAGG + Intergenic
1193973920 X:88093853-88093875 AGGCAGTTTAGTCTCCAGGTAGG - Intergenic
1195532017 X:105968427-105968449 ATCCAGCTGCCTCCCCAAGTGGG + Intergenic
1197170828 X:123432179-123432201 AGCCAGCTTTGTCTGCAGCTGGG - Intronic
1201985721 Y:19962629-19962651 AGCCAGCTGGGTTTCTGGGTTGG - Intergenic