ID: 1114517695

View in Genome Browser
Species Human (GRCh38)
Location 14:23310500-23310522
Sequence GCCAATTTGGTCCCACGTTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 44}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114517695_1114517700 15 Left 1114517695 14:23310500-23310522 CCAGAACGTGGGACCAAATTGGC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1114517700 14:23310538-23310560 CAGACTTCTGCTTTTGAGAGAGG 0: 1
1: 0
2: 1
3: 23
4: 228
1114517695_1114517701 16 Left 1114517695 14:23310500-23310522 CCAGAACGTGGGACCAAATTGGC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1114517701 14:23310539-23310561 AGACTTCTGCTTTTGAGAGAGGG 0: 1
1: 0
2: 1
3: 30
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114517695 Original CRISPR GCCAATTTGGTCCCACGTTC TGG (reversed) Exonic
909508084 1:76417809-76417831 GCCAATGTGGCTCCACCTTCAGG + Intronic
922980789 1:229824931-229824953 ACCAATTTGGTTCAACTTTCTGG - Intergenic
924902676 1:248418275-248418297 GCCAATTTGCTCCAACATCCAGG - Intergenic
1064327764 10:14366641-14366663 CCCAATTTGCTCCCACCTCCTGG + Intronic
1067223504 10:44360782-44360804 GCCAATTTTGTGCCACGCTCAGG - Intergenic
1069318955 10:67143694-67143716 AGCAATTTGGTCCCATCTTCAGG + Intronic
1076742766 10:132495489-132495511 AGCAATTTAGTCCCACCTTCAGG - Intergenic
1076980149 11:199834-199856 GCCACCTTGGCCCCAGGTTCAGG + Intronic
1077434415 11:2531918-2531940 CCCAAGGTGGTGCCACGTTCAGG + Intronic
1078909384 11:15716997-15717019 GCCTGTTTGGTCCCAAGTTCAGG + Intergenic
1082841280 11:57692227-57692249 GCCAGTTTGGTCTCAAATTCCGG + Intronic
1092397654 12:8142439-8142461 CCCAATTTTGTCCCAACTTCAGG + Intronic
1092553404 12:9528385-9528407 GACAATTTGGCCCCAAATTCTGG - Intergenic
1094518694 12:31162238-31162260 GACAATTTGGCCCCAAATTCTGG + Intergenic
1098997338 12:77136008-77136030 CCCAAATTGTTCCCACCTTCTGG - Intergenic
1100172673 12:91993448-91993470 GCCAATTTGGTTCCTCGGTGAGG + Exonic
1104357280 12:128099015-128099037 GCCAATCTGGGCCCAGGTCCTGG + Intergenic
1114517695 14:23310500-23310522 GCCAATTTGGTCCCACGTTCTGG - Exonic
1116257201 14:42571289-42571311 CCCAATAAGGCCCCACGTTCAGG + Intergenic
1142744366 17:1948336-1948358 GCAAATTTGCTCCCAGGTTTGGG + Intronic
1146264592 17:31443959-31443981 GCCAATTTGGGCTCAGGCTCAGG - Intronic
1151694073 17:75705217-75705239 ACCTATTAGGTCCCACGTTAGGG + Intronic
1160198348 18:76776072-76776094 ACCGATGTGGTCCCACGTTGTGG - Intergenic
1162866197 19:13549030-13549052 GCCACTTTGGACCCACATTCAGG - Intronic
930749971 2:54925258-54925280 GCCAATTTGGTTCCTGGTGCGGG - Intronic
937486790 2:122323784-122323806 GCCAATTTGTTCTCACCCTCAGG + Intergenic
947726665 2:232405622-232405644 ACCAATCTGGGCCCACATTCAGG - Intergenic
1175167852 20:57058191-57058213 GGCAATTTGGTCGCATCTTCAGG + Intergenic
1181691791 22:24566819-24566841 GCCAAGCTGGTCTCACCTTCAGG + Intronic
962703351 3:138020209-138020231 GCCAATTTCCTCCCACTTACTGG + Intronic
964289560 3:155162279-155162301 GCCAATTTGGAGCCACCTCCAGG - Intronic
964309886 3:155381263-155381285 GCCATTTTGGCCCCAGGTTGAGG + Intronic
979814255 4:125080095-125080117 GCCAATTAGGGCCCACTTTTCGG + Intergenic
993368611 5:87063732-87063754 ACCAATTTAGTCCCAAATTCAGG + Intergenic
995158256 5:108942115-108942137 GCCATTTTGGTCACACATTTGGG + Intronic
999899979 5:156076666-156076688 GCCAATTTCTTCCCACCATCAGG + Intronic
1004520811 6:16359205-16359227 CCCAATTAGGCCCCACCTTCAGG + Intronic
1007620771 6:43213165-43213187 GCCGATGTGGTCCCATGTCCAGG - Exonic
1010211113 6:73363432-73363454 GCCAAATTGAACCCTCGTTCTGG + Intronic
1013504135 6:110782269-110782291 CACAGTTTGGTCCCAGGTTCTGG + Intronic
1016956245 6:149629400-149629422 GCCAATTTGGTTCCAGGTGAGGG - Intronic
1028620015 7:92815094-92815116 GCCATTTTCTTCCCACATTCAGG + Intronic
1035387257 7:158482055-158482077 GGCAATTTGGTCACATCTTCAGG - Intronic
1039547051 8:38417887-38417909 GCCACTTTGGTCACACGGTTGGG + Exonic
1044221244 8:89672518-89672540 GCCATTATGGTCCCACCTCCTGG + Intergenic
1047034415 8:120920995-120921017 AGCAATTTGGTCACACCTTCAGG + Intergenic
1047204906 8:122795304-122795326 GCCAGCTTTGTCCCAAGTTCAGG + Intronic
1051211608 9:14750873-14750895 GCCAATTTTTTCCCTCTTTCTGG + Intronic