ID: 1114519418

View in Genome Browser
Species Human (GRCh38)
Location 14:23323714-23323736
Sequence AGCTTCTACTTGGCCTATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 223}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114519418 Original CRISPR AGCTTCTACTTGGCCTATTA TGG Intronic
906022638 1:42644057-42644079 AACTTTTACTTGGTGTATTAGGG + Intronic
907611057 1:55871522-55871544 AGCTTCCAGATGGCCTATTACGG + Intergenic
909834931 1:80242012-80242034 AGCTTGTAGATGGCCTATTGTGG + Intergenic
910060819 1:83089634-83089656 AGCTTGGAGATGGCCTATTATGG - Intergenic
910999909 1:93152882-93152904 AGCATTTTCTTGGCCAATTAAGG + Exonic
912076413 1:105881511-105881533 AGCTTGTTATTGGTCTATTAAGG + Intergenic
912639109 1:111327534-111327556 AGCTTGTCATTGGCCTATTCAGG + Intergenic
918195407 1:182216845-182216867 AGCTACTGCTTTGCCTCTTATGG + Intergenic
918917898 1:190669242-190669264 AGCTTGTAGATGGCCTATTATGG - Intergenic
919586312 1:199444830-199444852 AGCTTGTATTTGGTCTATTCAGG + Intergenic
921373076 1:214445466-214445488 AGCTTCTAATTGTCCTAATGAGG - Intronic
1063194257 10:3726516-3726538 AGCTTTGACTAGGCATATTATGG - Intergenic
1066027576 10:31378425-31378447 ATCTTCTACTAAGCCTATAAAGG - Intronic
1066347677 10:34604502-34604524 AGCTTGCAGATGGCCTATTATGG + Intronic
1066966040 10:42266023-42266045 AGCTTATAGATGGCCTATTGTGG - Intergenic
1067314859 10:45151678-45151700 AGCTTCGACTTGGCCAGGTATGG + Intergenic
1068007769 10:51410335-51410357 AGCTTGTAGATGGCCTATTGTGG - Intronic
1070899104 10:80012428-80012450 AGGTTCTACGTGGCCTGTGATGG - Intergenic
1071218682 10:83436973-83436995 AGCTTGTAGATGGCCTATTGTGG + Intergenic
1071374279 10:84986762-84986784 AGCTTGTAGATGGCCTATTGAGG - Intergenic
1071908848 10:90207075-90207097 TGGTTCCACATGGCCTATTATGG + Intergenic
1074340832 10:112627902-112627924 GGGTTCTACTTGACCTATGATGG + Intronic
1076103350 10:127800336-127800358 AGCTTGCAGATGGCCTATTATGG + Intergenic
1078816387 11:14826581-14826603 AGCTTCTTATTGGTCTATTCAGG - Intronic
1079183052 11:18210626-18210648 AACTTGTATTTGGCCAATTAAGG - Exonic
1079483766 11:20912118-20912140 TGCTTTTACTTTGCCTATAAAGG - Intronic
1081095147 11:38923311-38923333 AGCTTGTAGGTGGCCTATTGTGG - Intergenic
1082292002 11:50387312-50387334 AGCTTCTTATTGGTCTATTCAGG - Intergenic
1082855343 11:57801199-57801221 AGCTTCTCCTTATCCTATTTTGG - Intronic
1083332646 11:61906112-61906134 GGCTGCTGCTTGGCCTCTTAAGG + Intronic
1084840993 11:71847502-71847524 AGCTTCTTATTGGTCTATTCAGG + Intergenic
1085656091 11:78316248-78316270 AGCTTCCAGATGGCCTATTGTGG + Intronic
1087453007 11:98348620-98348642 AGCTTCTACTTCTCCTCTCAAGG - Intergenic
1088285220 11:108180879-108180901 AGGTTCTACATGGCCTGTGATGG - Intronic
1089299104 11:117487805-117487827 ACCTCCTACTTGGCCTAAGAAGG + Intronic
1093663516 12:21785170-21785192 AGCTTGCACATGGCCTATTGTGG - Intergenic
1093808782 12:23467718-23467740 AGCTTGTTATTGGCCTATTCAGG - Intergenic
1094105625 12:26808285-26808307 AGCTTCTATTTTGCTTATTTGGG + Intronic
1094227679 12:28064419-28064441 ACCTTCTACTTTGCCTTTTAGGG + Intergenic
1095480458 12:42629596-42629618 AGCTTCAATTTGACCTATTTTGG - Intergenic
1095577308 12:43755831-43755853 AGCTTCTATTTGTCCTAATGGGG - Intronic
1096922910 12:55107991-55108013 AGCTTGCAGATGGCCTATTATGG + Intergenic
1099526759 12:83726320-83726342 AGCTTGCAAATGGCCTATTATGG + Intergenic
1099839727 12:87950382-87950404 AGCTTGTACTTGGCCTCCTCAGG - Intergenic
1101264481 12:103068806-103068828 AGCTTGCAGATGGCCTATTATGG + Intergenic
1102763515 12:115410440-115410462 AGCTTGCAGATGGCCTATTATGG + Intergenic
1102988306 12:117296589-117296611 AGCTTGTAGATGGCCTATTGTGG + Intronic
1107783323 13:43928076-43928098 AGCTTGCACATGGCCTATTGTGG + Intergenic
1107972026 13:45652814-45652836 AGCTTACAGATGGCCTATTATGG - Intergenic
1108735361 13:53278307-53278329 AGCTTGCAGATGGCCTATTATGG - Intergenic
1108933350 13:55859611-55859633 AGCTTGTAGATGGCCTATTGTGG - Intergenic
1109048225 13:57440449-57440471 AGCTTGTAGATGGCCTATTGTGG + Intergenic
1111150397 13:84246150-84246172 AGCTTGCAGATGGCCTATTAAGG - Intergenic
1111266579 13:85822967-85822989 AGATTCTATTTGGCCTAATAGGG - Intergenic
1111286819 13:86104669-86104691 AGCTTCTTATTGGTCTATTCAGG + Intergenic
1113825398 13:113248829-113248851 AGATTCTTCCTGGCCTTTTAGGG + Intronic
1114519418 14:23323714-23323736 AGCTTCTACTTGGCCTATTATGG + Intronic
1116512688 14:45766279-45766301 AGCTTGTAGATGGCGTATTATGG + Intergenic
1116634743 14:47380675-47380697 AGCCTGTAATTGGCCTATTCAGG - Intronic
1118150063 14:63179569-63179591 AGCCTGCACTTGGCCTATTGTGG + Intergenic
1119470981 14:74898919-74898941 AGCTTCGGCTTGGCCTCTCATGG + Intronic
1120231830 14:81848645-81848667 AGCTTGCAGTTGGCCTATTGTGG - Intergenic
1127461320 15:59201903-59201925 AAATTCTACTTGGTCTTTTAGGG - Intronic
1132422016 15:101677939-101677961 AGCTTTTAATTGGCATATCATGG + Intronic
1136731719 16:32420021-32420043 AGCTTATAGATGGCCTATTGTGG - Intergenic
1137384059 16:48025263-48025285 AGCTCCTACTTTGGCTATGAAGG - Intergenic
1138843340 16:60535974-60535996 AACTTGTTATTGGCCTATTAAGG + Intergenic
1140306091 16:73804612-73804634 AGCTTCTAATGGGCCTCTGAGGG - Intergenic
1141365553 16:83439581-83439603 AGCTGCTTCTTTGCCAATTACGG - Intronic
1202994672 16_KI270728v1_random:97233-97255 AGCTTATAGATGGCCTATTGTGG + Intergenic
1203021359 16_KI270728v1_random:409575-409597 AGCTTATAGATGGCCTATTGTGG + Intergenic
1144856276 17:18270018-18270040 AGCTTGTAGATGGCCTATTCTGG - Intergenic
1147195623 17:38764744-38764766 AGATTCCAATTGGCCTTTTAGGG + Intergenic
1147274086 17:39300344-39300366 AGCTTCTTCATGGCTTCTTAAGG - Intronic
1150612662 17:66746564-66746586 AGCCTCCGCTTTGCCTATTAAGG - Intronic
1151863994 17:76787725-76787747 AGCATCCTCTTGGCCCATTAAGG - Intergenic
1153274989 18:3359695-3359717 AGCTTGTAGATGGCCTATCAAGG - Intergenic
1154505778 18:15039475-15039497 AGCTTGTAGATGGCCTATTGTGG + Intergenic
1155678428 18:28459146-28459168 AGCTTGCAGATGGCCTATTATGG - Intergenic
1157011584 18:43655556-43655578 AGCTTGTAGATGGCCTATTGTGG - Intergenic
1157335645 18:46735261-46735283 AGCTTGTAGATGGCCTATTGTGG + Intronic
1157536442 18:48461841-48461863 AGCTTCCATTTGGCCTTTCAAGG - Intergenic
1159067972 18:63590621-63590643 AGGTTCTACATGGGCTATCATGG - Intronic
1164880192 19:31726426-31726448 AGCTTGCAGATGGCCTATTATGG + Intergenic
1168020654 19:53606578-53606600 ATCTGCTTCTTGGCCTATTTTGG - Intergenic
925682609 2:6438702-6438724 AGATGCCACTTGGCATATTATGG - Intergenic
926388578 2:12363308-12363330 AGCTTGCACATGGCCTATCATGG + Intergenic
926733158 2:16052593-16052615 AGCTTCCAGATGGCCTATTGTGG - Intergenic
927603901 2:24468927-24468949 AGATTAGACTTGGCCTCTTATGG + Intergenic
931727285 2:65123532-65123554 GGCTTCTACTTGGCTTTTAAAGG - Intronic
932561464 2:72874925-72874947 AGCTTGTAGATGGCCTATTGTGG - Intergenic
932970171 2:76531528-76531550 AGCTTGCAGGTGGCCTATTATGG + Intergenic
933132465 2:78689758-78689780 AGCTTCTTATTGGTCTATTCAGG - Intergenic
934314002 2:91899248-91899270 AGCTTATAGATGGCCTATTGTGG + Intergenic
938504965 2:131869756-131869778 AGCTTGTAGATGGCCTATTGTGG + Intergenic
941237560 2:162994426-162994448 AGCTTGCACATGGCCTATTGTGG - Intergenic
943100938 2:183485258-183485280 AGCTTGTAGATGGCCTATTGTGG + Intergenic
943240012 2:185371255-185371277 AGCTTGTACATGGCATATCACGG + Intergenic
944352321 2:198743141-198743163 GGTTTCCACTTGGCATATTATGG - Intergenic
945344860 2:208701473-208701495 AGCTTACAGATGGCCTATTATGG - Intronic
946987471 2:225288756-225288778 AGCTTCCTCTTGGCCTCTTTAGG - Intergenic
947315013 2:228847400-228847422 AGCTTACAGATGGCCTATTATGG + Intergenic
947439356 2:230104889-230104911 AGCTTGTAGATGGCCTATTATGG - Intergenic
948256397 2:236571587-236571609 AGCCTATACTTGGCCTGTTCTGG - Intronic
1169502796 20:6177239-6177261 AGCTTATAGATGGCCTATTGTGG - Intergenic
1170425507 20:16231482-16231504 AGCTTATAGATGGCCTATTGTGG - Intergenic
1170479844 20:16754857-16754879 AGCTTGTAGATGGCCTATTGTGG + Intronic
1171296268 20:24019716-24019738 AGCTTATAGATGGCCTATTGTGG + Intergenic
1176792084 21:13329551-13329573 AGCTTGTAGATGGCCTATTGTGG - Intergenic
1177001068 21:15613766-15613788 AGCTTCTAGATGGCCTATTGTGG + Intergenic
1177279663 21:18964844-18964866 AGCTTCCAGATGGCCTATTGTGG - Intergenic
1177389706 21:20451718-20451740 AGCTTGCAGATGGCCTATTATGG + Intergenic
1177991482 21:28040538-28040560 AGCTTGTAGATGGCCTATTGTGG - Intergenic
1180540756 22:16445140-16445162 AGCTTATAGATGGCCTATTGTGG + Intergenic
1182469265 22:30537632-30537654 AGATTGTAATTGGCCTGTTAGGG - Intronic
1182535010 22:30994514-30994536 AGCTTGCAGATGGCCTATTATGG - Intergenic
1182853400 22:33496028-33496050 AGCTTATAGATGGCCTATTGTGG - Intronic
949674763 3:6440656-6440678 AGCTTGCAGTTGGCCTATTGTGG + Intergenic
951987978 3:28642158-28642180 AGCTTACAGATGGCCTATTATGG - Intergenic
952573907 3:34751223-34751245 AGCTTATAATTGGCCTATTCAGG - Intergenic
952983909 3:38760608-38760630 ATCTTGTCCTTGGCATATTATGG - Intronic
953180665 3:40591478-40591500 AGCTTGCACATGGCCTATTGTGG - Intergenic
956314106 3:67914949-67914971 AGCTTGTAGATGGCCTATTGTGG - Intergenic
957629779 3:82704093-82704115 AACTTGTTCTTGGTCTATTAAGG + Intergenic
958145441 3:89617841-89617863 AGCTTCTGCTTGGCCACTTGGGG + Intergenic
958481540 3:94651204-94651226 AGCTTGTTATTGGCCTATTCAGG + Intergenic
958487357 3:94729788-94729810 AGCTTGTAGATGGCCTATTGTGG - Intergenic
959302875 3:104624724-104624746 AGCTTGCAGATGGCCTATTATGG + Intergenic
959748844 3:109809548-109809570 AGCTTCCAGATGGCCTATTGTGG - Intergenic
960385228 3:117014611-117014633 AGCATTTTCTTGGCCAATTATGG + Intronic
967954118 3:194864273-194864295 AGCTTCTATTTGGGCCTTTAGGG - Intergenic
968390091 4:184689-184711 AACTTGTAATTGGCCTATTTAGG + Intergenic
969292227 4:6247351-6247373 AGCTTGCATTTGGCCTATTGTGG - Intergenic
969782091 4:9413528-9413550 AGCTTCTTATTGGTCTATTCAGG + Intergenic
970644717 4:18107189-18107211 AGCTTGTAGATGGCCTATTGTGG - Intergenic
972552158 4:40143924-40143946 AGCTTACAGCTGGCCTATTATGG - Intronic
973103245 4:46297412-46297434 AGCTTGCAGTTGGCCTATTGTGG + Intronic
973673945 4:53245071-53245093 AGCTTGTAATTGGTCTATTCAGG - Intronic
973944242 4:55941286-55941308 AGCTTCAACTTAGCCTGTAAAGG + Intergenic
974564389 4:63564878-63564900 AGCTTGTAGATGGCCTATTGTGG + Intergenic
977669757 4:99682490-99682512 AGCTTCTAGTTTTCCTATTGGGG - Intergenic
979030594 4:115639392-115639414 AGCTTGTAGATGGCCTATTGTGG + Intergenic
979059733 4:116042845-116042867 AGCTTCCACCTGGCTTGTTAGGG - Intergenic
981817796 4:148850962-148850984 AGCTTTTACTGGAACTATTAGGG - Intergenic
981873518 4:149514995-149515017 AGCTTGTAGATGGCCTATTGTGG + Intergenic
981873878 4:149517886-149517908 AGCTTGTAGATGGCCTATTGTGG + Intergenic
981885796 4:149671159-149671181 AGCTTGTAATTGGTCTATTCAGG + Intergenic
982835055 4:160112927-160112949 AGCTTGTAGATGGCCTATTGTGG + Intergenic
982835881 4:160119330-160119352 AGCTTGTAGATGGCCTATTGTGG + Intergenic
983451907 4:167922459-167922481 AGCTTGCATATGGCCTATTATGG - Intergenic
983490503 4:168384136-168384158 AGCTTGCAGATGGCCTATTATGG + Intronic
983785153 4:171720811-171720833 AGCTTTCAAATGGCCTATTATGG + Intergenic
985953766 5:3244503-3244525 AGCTTCTGCTTGGCTTCTGATGG + Intergenic
986326441 5:6678698-6678720 AGCTTGTAGTTGGACTATCATGG + Intergenic
986645561 5:9913190-9913212 AGCTTGTAGATGGCCTATTGTGG - Intergenic
987648498 5:20708437-20708459 AGCATCTAATTGGACTATGAGGG - Intergenic
989486046 5:41993710-41993732 AGCTTGCACATGGCCTATTGTGG - Intergenic
989503797 5:42202007-42202029 AGCTTGTAGATGGCCTGTTACGG - Intergenic
990212371 5:53494147-53494169 AGCTTGTAGATGGCCTATTGTGG + Intergenic
994133815 5:96262437-96262459 AGCTTCTGCTGGCTCTATTAAGG - Intergenic
994700458 5:103126592-103126614 AGCTTGCACATGGCCTATTGTGG - Intronic
996976454 5:129440405-129440427 AGCTTCCAGATGGCCTATTGTGG - Intergenic
997121872 5:131182806-131182828 AACTTCTACTAGGAGTATTAGGG - Intronic
1003375824 6:5576478-5576500 AGCTTGCACATGGCCTATTTTGG + Intronic
1003684962 6:8293683-8293705 AGCTCCTACTTGGCTAATTCCGG + Intergenic
1004039783 6:11964023-11964045 AGCTTATAAATGGCCTATTGTGG + Intergenic
1005265656 6:24109669-24109691 AGCTTGTAGATGGCCTATCATGG - Intergenic
1005545418 6:26863562-26863584 AGCATCTAATTGGACTATGAGGG + Intergenic
1006997141 6:38271639-38271661 ATCTACTACTTGTCCTTTTATGG + Intronic
1009777495 6:68223309-68223331 TGTTTCTACTTTGCTTATTAGGG + Intergenic
1009898427 6:69781695-69781717 TGTTTCTATTTGGCCTATTAAGG - Intronic
1010478737 6:76322752-76322774 AGCTTGTACTTCGCCTAACAGGG - Intergenic
1010581136 6:77597144-77597166 AGCTTGCAGATGGCCTATTATGG - Intergenic
1011039787 6:83016758-83016780 AGCTTATAGATGGCCTATTGTGG - Intronic
1011909586 6:92420233-92420255 AGCTTCCAGATGGCCTATTGCGG - Intergenic
1012695031 6:102369889-102369911 AGCTTCTCCGTGTCCTGTTATGG - Intergenic
1014929368 6:127315933-127315955 AAATTCTTCTTGGCCTATCAAGG - Intronic
1015659816 6:135562919-135562941 AACTTGTTATTGGCCTATTAAGG + Intergenic
1015967023 6:138704522-138704544 AGCTTGCACATGGCCTATTGTGG - Intergenic
1016331894 6:142961455-142961477 AGCTTACAGCTGGCCTATTATGG + Intergenic
1017582503 6:155881814-155881836 AGATTCAACTTGGCCTTTTAGGG - Intergenic
1019113216 6:169734965-169734987 AGCTTCTTATTGGTCTATTCAGG + Intergenic
1023279218 7:38552768-38552790 AGCTTCTACTTGGCAGAACAGGG - Intronic
1023325432 7:39050559-39050581 AACTTCTGGTTGGCCCATTAGGG + Intronic
1030385006 7:108857648-108857670 AGCTTGCACGTGGCCTATCATGG + Intergenic
1030387737 7:108885984-108886006 GGCTGCTACTTGGAATATTAGGG + Intergenic
1031183884 7:118451536-118451558 TGCTTCTACTTGGGCTGGTATGG + Intergenic
1031729144 7:125276624-125276646 AGCTTATAGATGGCCTATTGTGG - Intergenic
1032264283 7:130359985-130360007 AGCTTCTACCTGCTCTATTCTGG - Intronic
1033070444 7:138197022-138197044 AGCTTGTAGATGGCCTATTGTGG + Intergenic
1033469812 7:141635414-141635436 ACCTTCTACTTGGCTAACTAGGG + Intronic
1035744662 8:1953019-1953041 AGATTCTCCTTGGACTACTAAGG - Intronic
1038215294 8:25556393-25556415 AGCTTCTACTTGGGGTCTGAAGG + Intergenic
1039025076 8:33249730-33249752 AACTTGTTCTTGGCCTATTCAGG + Intergenic
1040614495 8:49020677-49020699 AGCTTGTAGACGGCCTATTATGG - Intergenic
1043074142 8:75674426-75674448 AGCTTGCAGTTGGCCTATCATGG + Intergenic
1043569586 8:81587840-81587862 AGCTTATAGATGGCCTATTGTGG - Intergenic
1044980885 8:97715448-97715470 AGTTTCTACATGGCTTTTTAAGG + Intronic
1045578271 8:103449251-103449273 AGCTCTTGCTTGGCCAATTAAGG - Intergenic
1045711770 8:104993136-104993158 AGCTTGTAGTTGGCCTATTGTGG - Intronic
1046066689 8:109205642-109205664 AGCTTGCAGTTGGCCTATTGTGG - Intergenic
1046326534 8:112654507-112654529 AGCTTCCACTTTGCCTTTTAAGG + Intronic
1047034008 8:120914598-120914620 AGCTTCTTCTTGCCTTATTCAGG - Intergenic
1047238319 8:123061951-123061973 AGCTTGTAGATGGCCTATTGTGG + Intronic
1047844585 8:128792287-128792309 AGCTTGCACATGGCCTATTGTGG - Intergenic
1048625820 8:136184015-136184037 AGCTTGCAGATGGCCTATTATGG - Intergenic
1050460608 9:5874552-5874574 AGCTTCTCTTGGGCCTTTTATGG - Intergenic
1050888429 9:10793942-10793964 AGCTTGTAGATGGCCTATCATGG - Intergenic
1051861438 9:21629257-21629279 AGCTTGCAAATGGCCTATTATGG + Intergenic
1055198408 9:73625716-73625738 AGCTTCTAGCTTGCCTATTTAGG + Intergenic
1055509823 9:76985003-76985025 GGCTTCTACTTGGCAAATTTGGG + Intergenic
1055668003 9:78571307-78571329 AGTTTTTACCTGGCCTATTTTGG - Intergenic
1055788525 9:79897206-79897228 AGCTTCAATTTGACCTTTTAAGG + Intergenic
1058668242 9:107339797-107339819 TGCAGCTACTTGGGCTATTAAGG - Intergenic
1058768345 9:108205619-108205641 AGCTTATAGATGGCCTATTGTGG - Intergenic
1059196164 9:112373238-112373260 AGCTTGTACATGGCTTATTGTGG - Intergenic
1059196604 9:112376584-112376606 AGCTTGCAGATGGCCTATTATGG - Intergenic
1059517089 9:114906099-114906121 TGCTTCCACTTGGACTTTTATGG + Intronic
1061477821 9:130880728-130880750 AGCTTCCCGTTGGCCTATGATGG - Intronic
1062608139 9:137357799-137357821 AGCTTGCACATGGCCTATTGTGG - Intronic
1186279852 X:7979792-7979814 AGCTTGCAGATGGCCTATTATGG + Intergenic
1186812881 X:13207521-13207543 TGCTTCTTCTTGCCCTTTTAGGG - Intergenic
1189179580 X:38991047-38991069 AGGCTCTGATTGGCCTATTATGG + Intergenic
1191115701 X:56850291-56850313 AACTTCTTATTGGTCTATTAGGG - Intergenic
1191159896 X:57318486-57318508 AACTTATTCTTGGCCTATTCAGG - Intronic
1191629691 X:63309925-63309947 AGCTTCCAGATGGCCTATTGTGG - Intergenic
1192563400 X:72142662-72142684 AGCAACCACTTGGCCTATTGTGG + Intergenic
1193589394 X:83369114-83369136 AGCTTCTTATTGGTCTATTCAGG - Intergenic
1194028977 X:88788648-88788670 TTCTTCCACTTGGTCTATTATGG + Intergenic
1195270823 X:103228998-103229020 AGCTTGCAGATGGCCTATTATGG - Intergenic
1195317933 X:103696765-103696787 AGCTTCAGGTTGGTCTATTAAGG - Intergenic
1199443360 X:147894400-147894422 AACTTCTAGTTGACCTCTTATGG - Intergenic
1199786000 X:151105409-151105431 AGCTTTTACTTGGACTGTGACGG - Intergenic
1201360821 Y:13146797-13146819 ACTTTATACTTGGACTATTAAGG + Intergenic
1201975993 Y:19849909-19849931 AGCTTGTAGATGGCCTATTGTGG + Intergenic