ID: 1114521882

View in Genome Browser
Species Human (GRCh38)
Location 14:23344636-23344658
Sequence AGTTTACATTCTCCCCCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114521882_1114521887 27 Left 1114521882 14:23344636-23344658 CCAGAAGGGGGAGAATGTAAACT No data
Right 1114521887 14:23344686-23344708 CCACCCTGCAACCATCTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114521882 Original CRISPR AGTTTACATTCTCCCCCTTC TGG (reversed) Intergenic
No off target data available for this crispr