ID: 1114523401

View in Genome Browser
Species Human (GRCh38)
Location 14:23352579-23352601
Sequence CAGACGCTCCGCGGGGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114523401 Original CRISPR CAGACGCTCCGCGGGGGCGG GGG Intronic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
902169428 1:14598542-14598564 CACACCCCCCGGGGGGGCGGAGG - Intergenic
903501013 1:23800277-23800299 CAGGCGCGGGGCGGGGGCGGGGG - Intronic
903822214 1:26111499-26111521 CAGACGGTCCCCGGGGCCGCGGG + Intronic
904540405 1:31228946-31228968 CAGAGGCTCTGCAGGGGTGGGGG - Intronic
912627161 1:111215061-111215083 CAGATGGTCGGCGGCGGCGGGGG - Intronic
914677615 1:149916719-149916741 CAAAACGTCCGCGGGGGCGGGGG + Intronic
915561732 1:156691922-156691944 CAGCCGCTCACAGGGGGCGGTGG - Intergenic
922291583 1:224213132-224213154 CTGACGCTACTCGGGGGAGGTGG + Intergenic
1064048926 10:12043280-12043302 CAGGCGCTTCGCGGGGGATGGGG + Intergenic
1064112859 10:12553433-12553455 CAGACTTTCCCCGGGGGCAGAGG + Intronic
1065342891 10:24723395-24723417 CGGGCGCCCGGCGGGGGCGGAGG - Intronic
1070570647 10:77637748-77637770 CCCGCGCTCCGCGGCGGCGGCGG - Intronic
1070877188 10:79825782-79825804 CAGACGCCGGGCGGGGGAGGGGG + Intergenic
1071616546 10:87080949-87080971 CAGCCGCTCCGAGAGGGAGGTGG + Intronic
1071643684 10:87341826-87341848 CAGACGCCGGGCGGGGGAGGGGG + Intergenic
1073299310 10:102461332-102461354 CAATCGCTGGGCGGGGGCGGAGG + Intergenic
1074503122 10:114043996-114044018 CAGCCGCGGCGCGGGGCCGGAGG - Intergenic
1074843424 10:117376024-117376046 CAGACGCTCTGCGTCCGCGGAGG + Intergenic
1075393786 10:122112843-122112865 CAGACGCACCGAGGGGCCCGCGG - Intronic
1076116967 10:127907451-127907473 TGGGCGCGCCGCGGGGGCGGCGG - Intronic
1076570688 10:131430925-131430947 CAGACCCTCCACGAGGGAGGTGG - Intergenic
1077064870 11:636692-636714 CAGAGGCTGCGGGGGGGGGGCGG + Intergenic
1077343791 11:2037345-2037367 CTGAGGCTCCCTGGGGGCGGTGG + Intergenic
1081860928 11:46333050-46333072 CCTGCGCTCCGGGGGGGCGGGGG - Intronic
1082782693 11:57299957-57299979 CAGACGCTCCTCAGAGGTGGAGG + Exonic
1082849648 11:57753707-57753729 GAGACCGTTCGCGGGGGCGGGGG - Intronic
1083572801 11:63769097-63769119 GAGATGCCCCGAGGGGGCGGTGG - Intergenic
1083623646 11:64060928-64060950 CATGCGCACCGCGGCGGCGGCGG + Intronic
1084268443 11:68016777-68016799 CAGAAGCTCAGTGGTGGCGGGGG - Intronic
1086545467 11:87962484-87962506 CAGAGGCTTGGCGGGGGCAGGGG + Intergenic
1089169335 11:116501155-116501177 CAGAAGCTCAGCGGGGGAGAGGG + Intergenic
1089533807 11:119149053-119149075 CAGTCGCCCCGCGGGCTCGGAGG + Exonic
1089966210 11:122656396-122656418 AAGACGCGGCGCGGGGGCGTTGG + Intronic
1202826777 11_KI270721v1_random:92534-92556 CTGAGGCTCCCTGGGGGCGGTGG + Intergenic
1095271520 12:40224841-40224863 CAGAGGCTCCGCCGAGGCGACGG - Intronic
1102350049 12:112185236-112185258 CGGGGGCTCCGGGGGGGCGGCGG - Exonic
1106108965 13:26760538-26760560 CAGGCGGCCCGCGGGGGCGGGGG + Intronic
1108227536 13:48304185-48304207 CAGACGCTCCGCCGTGGCGGGGG - Intronic
1114483251 14:23048049-23048071 CAGCGGCTCCGCGGGGCCGGGGG + Exonic
1114523401 14:23352579-23352601 CAGACGCTCCGCGGGGGCGGGGG + Intronic
1118220972 14:63853770-63853792 TAGCGCCTCCGCGGGGGCGGGGG + Intronic
1118809038 14:69260520-69260542 CAGACCCTGCGCGGCGGCCGAGG + Intronic
1120788078 14:88554908-88554930 AAGAAGCCCCGTGGGGGCGGGGG + Intergenic
1122337941 14:101006176-101006198 CATGCGCTCCACGGGGGCAGGGG - Intergenic
1126736679 15:51737725-51737747 AGGCCGTTCCGCGGGGGCGGCGG + Exonic
1132724529 16:1333170-1333192 CAGACCGTCCGCGTGGGCGTGGG + Intergenic
1132741264 16:1414498-1414520 CAGGCGCTGCGCGGAGGCCGGGG + Intronic
1137261057 16:46830762-46830784 CAGACTCTCCTCGCCGGCGGCGG - Intronic
1137788534 16:51155369-51155391 CAGCGGCGCCCCGGGGGCGGGGG + Intergenic
1139591561 16:67935954-67935976 CAGACGCTCTTCAGGTGCGGGGG - Exonic
1142217698 16:88837955-88837977 CAGACGCTCTGCAGGGTAGGCGG - Intronic
1143106973 17:4534871-4534893 CAGGCGCTCCCTGGGGGTGGAGG - Intronic
1143176252 17:4956844-4956866 CAGACGCTCCGAGCGGCAGGGGG - Exonic
1146095926 17:29930176-29930198 CTGACGCTCCGAACGGGCGGCGG + Intronic
1148854763 17:50572663-50572685 CCCACGCTGCGCGGGGACGGGGG + Exonic
1150108221 17:62478006-62478028 CAGCATCCCCGCGGGGGCGGGGG + Intronic
1151680511 17:75620407-75620429 CAGAGGCTGCCCGGGGGCAGAGG + Intergenic
1152382455 17:79949142-79949164 CAGACCCTCCCCGGATGCGGCGG + Intronic
1152396438 17:80036107-80036129 CGGACGCTCCGCGTGCGCGCTGG + Intergenic
1152463866 17:80455054-80455076 CGGAAGCTCCGGGAGGGCGGCGG - Intergenic
1152546697 17:81003968-81003990 CAGGCGCTCTGCGGGGGCTCTGG + Intronic
1152908480 17:82983673-82983695 CAGATGCTCCGTGGGGGCAGCGG + Intronic
1152924065 17:83079608-83079630 CAGAGGCTCGGCGGCGGCGGCGG + Intergenic
1153526336 18:5998316-5998338 CAGACGCAGCGCAGGGGAGGGGG - Intronic
1157615766 18:48986942-48986964 CAGGCCCTCCGAGGTGGCGGTGG + Intergenic
1157700738 18:49760291-49760313 GAGTCCCTCTGCGGGGGCGGCGG + Intergenic
1160989518 19:1854784-1854806 CAGCGGGTCAGCGGGGGCGGGGG + Intronic
1162312067 19:9913700-9913722 CAGGCGCCCCGGGGGGGCGTGGG + Intronic
1162479859 19:10921808-10921830 AAGCCGCCCGGCGGGGGCGGCGG - Exonic
1165772376 19:38386950-38386972 CAGAGTCCCCGCGGGGGCCGGGG + Exonic
1165782228 19:38441391-38441413 GAGGCCCTCGGCGGGGGCGGGGG + Intronic
1167122074 19:47523313-47523335 GAGACGCTCGCCGGGCGCGGTGG - Intronic
926130963 2:10302903-10302925 CAGGCGGGCCGCGGCGGCGGCGG + Intronic
927770466 2:25856556-25856578 CAGACGCTCCAAGGGGTAGGGGG + Intronic
934307885 2:91841282-91841304 CAGACGCTTGGAGGGGGCTGGGG + Intergenic
935622957 2:105144486-105144508 CAGAGGCCACGCGGGGACGGAGG + Intergenic
938018193 2:127885394-127885416 CAGACGCCGGGCGGGGGAGGGGG + Intronic
942278164 2:174337319-174337341 AAGACGCACAACGGGGGCGGCGG + Exonic
946836296 2:223776092-223776114 GAGAGGCTCGGCGGGGGAGGAGG - Intronic
1169085009 20:2821059-2821081 CAGACGCGCCGGGAGGGAGGGGG + Intergenic
1173279684 20:41617857-41617879 CAACTTCTCCGCGGGGGCGGCGG + Intronic
1176042351 20:63072280-63072302 CAGAGGCGCAGCGGGGCCGGTGG + Intergenic
1176173679 20:63707873-63707895 CAGCGGCTCCGAGGGCGCGGCGG - Exonic
1179213716 21:39349055-39349077 GAGACCCACAGCGGGGGCGGTGG + Exonic
1182257761 22:29050537-29050559 CAGGTGGCCCGCGGGGGCGGAGG + Exonic
1185409442 22:50674446-50674468 CGGGGGCTCCGCAGGGGCGGCGG - Intergenic
950903000 3:16513712-16513734 CGGACGCGCGGCGGCGGCGGCGG - Intronic
953024881 3:39139058-39139080 CAGACTCTTTGAGGGGGCGGAGG + Intergenic
954028827 3:47803488-47803510 CAGGGGCTCCGCGGAGGCCGTGG + Intronic
967849548 3:194071413-194071435 CCCACGCCCGGCGGGGGCGGAGG + Intergenic
968546253 4:1200477-1200499 GGGAGGCTCAGCGGGGGCGGGGG + Intronic
969394336 4:6910471-6910493 CAGACGGTTCGCGTGGGTGGAGG - Intronic
985064251 4:186105328-186105350 CAGCCGCGCCGCGGGAGCAGTGG + Intronic
985746423 5:1651459-1651481 CAGACGCACCGTGAGGGCTGGGG + Intergenic
989571605 5:42951147-42951169 CAGCCGCTCCTCGGGGCCGGTGG - Intergenic
993901216 5:93585105-93585127 CAGGCGGCCCGCGGCGGCGGCGG + Exonic
997990808 5:138543139-138543161 CGGCGGCTCCGCGGCGGCGGCGG + Exonic
1001550473 5:172598720-172598742 CAGAGGCCCCGTGGGGGCTGTGG - Intergenic
1002190136 5:177473603-177473625 CAGAGGCTCCGAGGCGGCGGCGG - Intronic
1014230354 6:118895213-118895235 CCGGCGCTCCCCGGGGGCCGTGG + Intronic
1015773467 6:136791994-136792016 CAGAAGCTGCCCGGCGGCGGCGG + Exonic
1017793898 6:157823873-157823895 CACCCGCCCCGCGGGGGCGAGGG - Intronic
1020210303 7:6153938-6153960 CGGAGGCTCCTCGGGGGCGACGG - Exonic
1026890135 7:73977057-73977079 CACACGCACTGCGGGGGTGGAGG - Intergenic
1031604143 7:123748691-123748713 GTGACCCTCCGCGGCGGCGGCGG + Exonic
1032125416 7:129189320-129189342 CAGTGGCTCAGCGGCGGCGGAGG - Exonic
1034446060 7:151114930-151114952 CACACGCTCCGCGGCCGCGCCGG - Intronic
1035168083 7:157003356-157003378 CAGACCCTCCGCGGAGGCCTGGG + Intronic
1035286494 7:157810422-157810444 CAGGCTCTCCACGGGGACGGCGG + Intronic
1036612875 8:10365263-10365285 CAGATGCTCGGAGGGAGCGGGGG - Intronic
1043502809 8:80873845-80873867 CCGGCGCTGCGCGGCGGCGGCGG + Intronic
1043591798 8:81841950-81841972 CAGACGCACAGTGGGGTCGGCGG + Intronic
1048214264 8:132480863-132480885 CCGGCGCTCCGGGGCGGCGGCGG + Exonic
1048980936 8:139703207-139703229 CAGCCGCCTCGCGGTGGCGGTGG - Intergenic
1049762180 8:144336613-144336635 CTGAGGCTCCGCCGCGGCGGCGG - Intergenic
1061208510 9:129177629-129177651 CAGGGGCTGCGCGGCGGCGGCGG - Exonic
1061519953 9:131112026-131112048 GAGACGCTCTGCTGGGGAGGGGG - Intronic
1061802765 9:133121186-133121208 CCGGCGCGCGGCGGGGGCGGCGG + Intronic
1061863462 9:133479336-133479358 CCGGCGCTCCGCGGGGGCCCCGG - Intergenic
1062146444 9:134992276-134992298 GAGACCCTCCGCGGGGAGGGGGG - Intergenic
1062146497 9:134992402-134992424 GAGACCCTCTGCCGGGGCGGGGG - Intergenic
1062351715 9:136142868-136142890 CAGAGGCTCCCCGGGGGCTCGGG + Intergenic
1062390198 9:136330815-136330837 CAGACCCTCCGTGGTGGCTGGGG - Intronic
1062432312 9:136531656-136531678 CCGACGCCCCGCGGGTGCTGTGG - Intronic
1190149919 X:47936813-47936835 CAGACTCTCCGGGGGGCGGGGGG + Intronic
1195334070 X:103832235-103832257 GAGACGCTGCGCGGCGGCAGCGG - Intergenic
1196340074 X:114584912-114584934 AAGACGCTGGGCGGAGGCGGGGG + Intronic
1197415297 X:126166120-126166142 CTGAGGCTCGGCGGCGGCGGCGG + Intergenic
1200111089 X:153741216-153741238 CAGACGCTTGGAGGGGGCTGGGG + Intronic
1200240455 X:154490480-154490502 CAAACGCGCGGCGGCGGCGGCGG + Exonic