ID: 1114524045

View in Genome Browser
Species Human (GRCh38)
Location 14:23357162-23357184
Sequence GCCCCCCTTTAGGCCTTGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 137}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114524045_1114524051 -10 Left 1114524045 14:23357162-23357184 CCACCCAAGGCCTAAAGGGGGGC 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1114524051 14:23357175-23357197 AAAGGGGGGCTTTGGCAGGCAGG 0: 1
1: 0
2: 1
3: 22
4: 264
1114524045_1114524056 24 Left 1114524045 14:23357162-23357184 CCACCCAAGGCCTAAAGGGGGGC 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1114524056 14:23357209-23357231 GCTGTGCCAAAGGACCTTCATGG 0: 1
1: 0
2: 0
3: 11
4: 116
1114524045_1114524052 -9 Left 1114524045 14:23357162-23357184 CCACCCAAGGCCTAAAGGGGGGC 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1114524052 14:23357176-23357198 AAGGGGGGCTTTGGCAGGCAGGG 0: 1
1: 0
2: 0
3: 29
4: 341
1114524045_1114524053 -8 Left 1114524045 14:23357162-23357184 CCACCCAAGGCCTAAAGGGGGGC 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1114524053 14:23357177-23357199 AGGGGGGCTTTGGCAGGCAGGGG 0: 1
1: 0
2: 5
3: 40
4: 534
1114524045_1114524055 14 Left 1114524045 14:23357162-23357184 CCACCCAAGGCCTAAAGGGGGGC 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1114524055 14:23357199-23357221 GAGGAGCAGAGCTGTGCCAAAGG 0: 1
1: 1
2: 2
3: 29
4: 316
1114524045_1114524054 -5 Left 1114524045 14:23357162-23357184 CCACCCAAGGCCTAAAGGGGGGC 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1114524054 14:23357180-23357202 GGGGCTTTGGCAGGCAGGGGAGG 0: 1
1: 0
2: 5
3: 82
4: 1522

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114524045 Original CRISPR GCCCCCCTTTAGGCCTTGGG TGG (reversed) Exonic