ID: 1114524045

View in Genome Browser
Species Human (GRCh38)
Location 14:23357162-23357184
Sequence GCCCCCCTTTAGGCCTTGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 137}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114524045_1114524053 -8 Left 1114524045 14:23357162-23357184 CCACCCAAGGCCTAAAGGGGGGC 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1114524053 14:23357177-23357199 AGGGGGGCTTTGGCAGGCAGGGG 0: 1
1: 0
2: 5
3: 40
4: 534
1114524045_1114524054 -5 Left 1114524045 14:23357162-23357184 CCACCCAAGGCCTAAAGGGGGGC 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1114524054 14:23357180-23357202 GGGGCTTTGGCAGGCAGGGGAGG 0: 1
1: 0
2: 5
3: 82
4: 1522
1114524045_1114524052 -9 Left 1114524045 14:23357162-23357184 CCACCCAAGGCCTAAAGGGGGGC 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1114524052 14:23357176-23357198 AAGGGGGGCTTTGGCAGGCAGGG 0: 1
1: 0
2: 0
3: 29
4: 341
1114524045_1114524056 24 Left 1114524045 14:23357162-23357184 CCACCCAAGGCCTAAAGGGGGGC 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1114524056 14:23357209-23357231 GCTGTGCCAAAGGACCTTCATGG 0: 1
1: 0
2: 0
3: 11
4: 116
1114524045_1114524051 -10 Left 1114524045 14:23357162-23357184 CCACCCAAGGCCTAAAGGGGGGC 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1114524051 14:23357175-23357197 AAAGGGGGGCTTTGGCAGGCAGG 0: 1
1: 0
2: 1
3: 22
4: 264
1114524045_1114524055 14 Left 1114524045 14:23357162-23357184 CCACCCAAGGCCTAAAGGGGGGC 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1114524055 14:23357199-23357221 GAGGAGCAGAGCTGTGCCAAAGG 0: 1
1: 1
2: 2
3: 29
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114524045 Original CRISPR GCCCCCCTTTAGGCCTTGGG TGG (reversed) Exonic
900176358 1:1293119-1293141 GCCACCCTTTCTGCCCTGGGAGG + Exonic
900507796 1:3038429-3038451 GCCCAGCTCTAGGCCTCGGGTGG + Intergenic
900540511 1:3200313-3200335 GCCCTCCTTTAGGCTTAAGGTGG + Intronic
901810119 1:11762592-11762614 GCTCCCTCTGAGGCCTTGGGTGG + Intronic
902955449 1:19921950-19921972 GCTCCTGTTGAGGCCTTGGGAGG + Intronic
903164391 1:21510164-21510186 CGCCCCCTTTAGGCTTTGCGAGG + Intronic
904595776 1:31644529-31644551 GCCCCCATGAGGGCCTTGGGAGG + Intronic
905799129 1:40832244-40832266 GCTCCCCCTTTGGCCTTGGAGGG + Intronic
906691023 1:47792834-47792856 GGCTCCCCTTAGGCCTGGGGAGG + Intronic
912951582 1:114124089-114124111 GCCCCTCCTTAGGGCTTGGGTGG - Intronic
913733398 1:121742556-121742578 GACCCCCTTGAGGCCTTCGTTGG + Intergenic
913793673 1:122574773-122574795 GACCTCCTTGAGGCCTTCGGTGG + Intergenic
913798580 1:122661805-122661827 GACCTCCTTGAGGCCTTCGGTGG + Intergenic
913800328 1:122693775-122693797 GACCTCCTTTAGGCCTTCGTTGG + Intergenic
913809003 1:122850508-122850530 GACCTCCTTGAGGCCTTGGTTGG + Intergenic
913851627 1:123613869-123613891 GACCTCCTTGAGGCCTTCGGTGG + Intergenic
913853716 1:123651602-123651624 GACCTCCTTTAGGCCTTCGTTGG + Intergenic
913859667 1:123758839-123758861 GACCTCCTTGAGGCCTTCGGTGG + Intergenic
913860136 1:123767001-123767023 GACCTCCTTGAGGCCTTGGTTGG + Intergenic
913863929 1:123834634-123834656 GACCTCCTTTAGGCCTTCGTTGG + Intergenic
913865094 1:123856049-123856071 GACCTCCTTGAGGCCTTCGGTGG + Intergenic
913877208 1:124073060-124073082 GACCTCCTTGAGGCCTTCGGTGG + Intergenic
913884641 1:124205852-124205874 GACCACCTTGAGGCCTTCGGTGG + Intergenic
913885223 1:124216393-124216415 GACCTCCTTTAGGCCTTCGTTGG + Intergenic
913885553 1:124222168-124222190 GACCTCCTTGAGGCCTTCGGTGG + Intergenic
913891927 1:124336550-124336572 GACCTCCTTGAGGCCTTCGGTGG + Intergenic
913903061 1:124536233-124536255 GACCTCCTTGAGGCCTTGGTTGG + Intergenic
913904617 1:124564100-124564122 GACCTCCTTTAGGCCTTCGTTGG + Intergenic
913907375 1:124613392-124613414 GACCTCCTTTAGGCCTTCGTTGG + Intergenic
913909000 1:124642631-124642653 GACCTCCTTTAGGCCTTCGTTGG + Intergenic
913909336 1:124648747-124648769 GACCCCCTTGAGGCCTTCGTTGG + Intergenic
913916905 1:124784359-124784381 GACCTCCTTGAGGCCTTGGTTGG + Intergenic
914343206 1:146777201-146777223 GTCCCCTTCTTGGCCTTGGGTGG + Intergenic
916890228 1:169106498-169106520 GCGCTCCTCTAGCCCTTGGGGGG - Exonic
922428634 1:225524631-225524653 GCCCTCCTATTGGCCTTCGGAGG - Intronic
922852538 1:228745964-228745986 TCCTGCCTTTAGGCCATGGGTGG + Exonic
1062921646 10:1284887-1284909 GCCCACCTTCAGTCCTTGAGGGG + Intronic
1063054855 10:2493637-2493659 GTCCCCCTTTTTGGCTTGGGTGG - Intergenic
1064429255 10:15257219-15257241 GCACCCCTCCAGGCCTTAGGAGG + Intronic
1066828176 10:39635327-39635349 GACCCCCTTGAGGCCTTCGTAGG + Intergenic
1066900050 10:41084669-41084691 GACCCCCTTGAGGCCTTCGTAGG + Intergenic
1069321584 10:67178152-67178174 GCCACCCTTTATTCCTTGTGGGG + Intronic
1069834076 10:71297702-71297724 GCCACCCTTCAGGCCTCAGGGGG - Intronic
1072362241 10:94670884-94670906 GCCTCCCTTGAGGCCTTGTATGG - Intergenic
1072913360 10:99522392-99522414 GCGCCCTTTGAGGCCTTGGCTGG - Intergenic
1073797823 10:107007213-107007235 GACCCCCTCTCTGCCTTGGGAGG - Intronic
1075504415 10:123009231-123009253 GACCCCCTTCAGGCCTCTGGTGG + Intronic
1076207450 10:128614417-128614439 GCCCCCGGTGAGGCCTCGGGTGG + Intergenic
1076407414 10:130221898-130221920 GCCTTTCTTTATGCCTTGGGAGG + Intergenic
1076655164 10:132019157-132019179 GCCCACCTTTAGGCCAGGGAGGG - Intergenic
1077154034 11:1083587-1083609 GCCCCCCTGTGGGCCTTTGTTGG - Intergenic
1077163325 11:1123517-1123539 GTCCCCCTTTAGGACATGCGGGG + Intergenic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1084272888 11:68038557-68038579 GCCCCGCTCTGGCCCTTGGGTGG - Intergenic
1084685386 11:70691354-70691376 TCCCCCGTTTAGGCACTGGGAGG + Intronic
1091715784 12:2775254-2775276 GCCCTCCTTCAGCCCGTGGGAGG - Intergenic
1093416219 12:18924003-18924025 ACCCCACTTTAGGTTTTGGGTGG - Intergenic
1094880755 12:34775634-34775656 GCCACCTTTTAGGCCTTCGTTGG + Intergenic
1095030071 12:37261962-37261984 GACCTCCTTAAGGCCTTGGTTGG - Intergenic
1095948091 12:47765327-47765349 GGCCCCCCTCAGGCCTTGCGGGG + Intronic
1100100579 12:91099215-91099237 GCCCCCCTTAATGCCACGGGGGG + Intergenic
1101733390 12:107444824-107444846 GCCCCCCGTGAGGCCTAGGGAGG + Intronic
1102211212 12:111128569-111128591 GCCCCCCTTTATGGCTTGGAGGG + Intronic
1102581144 12:113888927-113888949 GCCCCCCTGAAAGCCTTTGGGGG + Intronic
1104888977 12:132130665-132130687 GCCCCCTTCTTGGCCCTGGGGGG - Intronic
1105033240 12:132899766-132899788 GCCTCACTTTATGGCTTGGGGGG + Intronic
1105435893 13:20378136-20378158 GTCTCCCCTTAGGTCTTGGGGGG + Intergenic
1112415611 13:99201110-99201132 GCCCCCATTTCGGCCTGGAGGGG + Intronic
1114524045 14:23357162-23357184 GCCCCCCTTTAGGCCTTGGGTGG - Exonic
1116821871 14:49634501-49634523 GCTCCCCGTCAGGCCTTGCGGGG + Exonic
1117373766 14:55102319-55102341 GCCCTCCTGCAGGCCCTGGGTGG - Intergenic
1122974269 14:105164631-105164653 GCCCACCTTGAGCCCTAGGGCGG + Intronic
1125413577 15:39429833-39429855 GTCACCCTTTAGGTTTTGGGGGG - Intergenic
1125886033 15:43230234-43230256 GCCCACCTCTTGGCCATGGGCGG + Intergenic
1129894206 15:79091481-79091503 GCCCGCCTTCAGGCTTTGGGGGG - Intergenic
1129933301 15:79429983-79430005 GCCCTCATTCAAGCCTTGGGAGG - Intergenic
1135668356 16:24354395-24354417 GCCCCCATTTTGCCCTTGGTGGG - Intronic
1139990785 16:70938126-70938148 GTCCCCTTCTTGGCCTTGGGCGG - Intronic
1141639587 16:85333499-85333521 TCACCCCCTTAGGGCTTGGGGGG + Intergenic
1141693964 16:85611435-85611457 GCCCCCCTTGCGGCCTTGGCCGG - Intronic
1145073134 17:19828817-19828839 GACTCCCTTTAGGCCATGTGAGG + Intronic
1162018868 19:7859767-7859789 GCCTCCCTTTGGGCCTGAGGAGG - Intronic
1166232293 19:41431989-41432011 GCCCCTGTTCAGGCCTGGGGAGG - Exonic
1166330400 19:42075215-42075237 GCGCCCCTCAGGGCCTTGGGAGG - Intronic
927843298 2:26458436-26458458 GCTCCCATCTAGGCCTTAGGAGG - Intronic
928294820 2:30073435-30073457 GTCCCTCTCTAGCCCTTGGGTGG + Intergenic
932167426 2:69520924-69520946 GCCCAGCTTTAGGCCTCTGGCGG + Exonic
933810076 2:86027662-86027684 GCCCCCCTCTAGCACTTGAGAGG + Intronic
940015662 2:149101529-149101551 GCCCCCCTTCAGCTCTTGGCTGG - Intronic
943385869 2:187203132-187203154 GCCCCACTTTAGGCCTAGATGGG + Intergenic
946873525 2:224106319-224106341 GCCCAACTTTAGGGCTTGGTGGG + Intergenic
948137372 2:235646739-235646761 GGCCACCCTTAGGCCTTGAGAGG + Intronic
1168966059 20:1898710-1898732 GGCCCCTTTCTGGCCTTGGGTGG + Intronic
1169525152 20:6416463-6416485 CCCTCCCTTTAGGCTTTGGTAGG - Intergenic
1169843637 20:9966129-9966151 GCCCTGTTTTAGGTCTTGGGAGG - Intergenic
1170795303 20:19541778-19541800 GCCACCCTTTCGGGGTTGGGCGG + Intronic
1174063941 20:47851515-47851537 TTGCCCCTTCAGGCCTTGGGAGG - Intergenic
1176205767 20:63887369-63887391 GCCCCCCATGAGGCCAAGGGAGG + Intronic
1176257894 20:64162110-64162132 GCCGCCCTTCAGCCCCTGGGAGG - Intronic
1180526734 22:16272123-16272145 GAGCCCCTTTAGGCCTGTGGTGG + Intergenic
1181042104 22:20197086-20197108 GCCCACCTATAGGCCCTGTGTGG + Intergenic
1181079426 22:20404097-20404119 GCTCCCTTTTAAGCCTGGGGAGG + Intronic
1183898287 22:40986404-40986426 GCCCCTCTCTGGGCCTTGGAAGG + Intergenic
950788326 3:15453574-15453596 GCTCCCCTCTGGGCCTTGGATGG + Intronic
953250892 3:41245033-41245055 GTCTCCCTTTAGTTCTTGGGTGG - Intronic
954369531 3:50162951-50162973 GACCCTCTTTAGGTCTTGGAGGG - Intronic
954377974 3:50204958-50204980 GCTCCCCTTCTGGCTTTGGGGGG + Intergenic
954627603 3:52031003-52031025 TCCCACCTTTAGGACCTGGGTGG + Intergenic
962889915 3:139662572-139662594 GCCCACCTTGAGGACTTGGTAGG - Intronic
968698839 4:2045319-2045341 GCCTCCCCCTAGGCCTTGCGGGG + Intergenic
976226564 4:82798966-82798988 GCCCCCCTTTCGGCTTTTCGGGG + Intergenic
998081259 5:139276714-139276736 GCCCCCTTTGAGCCCTTGGTAGG - Intronic
1001441705 5:171748810-171748832 GCCCCCCTCCAGGCCTTCTGAGG - Intergenic
1002897528 6:1388351-1388373 CTCCCCCTTCAGCCCTTGGGAGG + Intergenic
1004417147 6:15435443-15435465 GCCCCATTTTAGGGCTTGGAGGG + Intronic
1005017375 6:21386981-21387003 GCCTCCTTTTTAGCCTTGGGTGG - Intergenic
1006078934 6:31552992-31553014 TGCCCCCTTTAGGCCTGGCGCGG - Intronic
1006595029 6:35186495-35186517 GCTCCCTTTTACCCCTTGGGTGG - Intergenic
1009157419 6:60238742-60238764 GACCCCTTTTAGGCCTTCGTTGG + Intergenic
1009241711 6:61193459-61193481 CTCCCCCTTTAGGCCTGGGATGG - Intergenic
1012362977 6:98406566-98406588 GCCCAACTTTAGGCCTTGGTGGG + Intergenic
1012908767 6:105096316-105096338 GCCCATCTTTTGGCCTTGAGTGG - Intergenic
1018581491 6:165311827-165311849 GCCCCTCTGCCGGCCTTGGGAGG + Intergenic
1019545172 7:1570618-1570640 GCCCCCTTCTTGGCCTTGGCCGG - Intronic
1023418326 7:39951527-39951549 TCCTCCCGGTAGGCCTTGGGCGG - Exonic
1027218075 7:76196969-76196991 GCCCTGCTCTAGGCCTTGGAGGG - Intergenic
1034444720 7:151107937-151107959 CCCACCCTTCAGGCCATGGGAGG + Intronic
1038356208 8:26831736-26831758 GGACCCTTTTGGGCCTTGGGGGG + Intronic
1041949252 8:63482069-63482091 GGCCCCTTTAAGGCCCTGGGTGG + Intergenic
1042499050 8:69489067-69489089 GCTCACAGTTAGGCCTTGGGGGG + Intronic
1047062354 8:121241964-121241986 GCCTCCCTTTAGGCCCTGAATGG + Intergenic
1047659133 8:127013473-127013495 GCTCTCCTTCAGGCCTTGCGGGG - Intergenic
1049368638 8:142253023-142253045 GCCCTCCTGCAGGCCTGGGGAGG - Intronic
1051947217 9:22583376-22583398 GCCCTCTTTTAGGATTTGGGTGG - Intergenic
1061985160 9:134126377-134126399 GCCCCCCGGTAGGTCTGGGGAGG - Intergenic
1062122620 9:134841877-134841899 GCCACCCCTGAAGCCTTGGGAGG + Intronic
1203794668 EBV:169986-170008 GCCCCCCTTGGGGGCTTGGCTGG - Intergenic
1203794869 EBV:170524-170546 GCCCCCCTTGGGGGCTTGGCTGG - Intergenic
1203795060 EBV:171047-171069 GCCCCCCTTGGGGGCTTGGCTGG - Intergenic
1203795261 EBV:171585-171607 GCCCCCCTTGGGGGCTTGGCTGG - Intergenic
1189299404 X:39941829-39941851 GGCCCCCTGTAGGCTTTGGGTGG - Intergenic
1192682113 X:73263063-73263085 GCCCCCCTATACCCCTTAGGGGG + Intergenic
1196828394 X:119758461-119758483 GCCCCCGCGCAGGCCTTGGGGGG - Intergenic
1201777683 Y:17684391-17684413 GACCCCATTGAGGCCTTTGGGGG - Intergenic
1201823875 Y:18221601-18221623 GACCCCATTGAGGCCTTTGGGGG + Intergenic