ID: 1114524281

View in Genome Browser
Species Human (GRCh38)
Location 14:23358832-23358854
Sequence CTAGAGAAGGGGACAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 983
Summary {0: 1, 1: 0, 2: 10, 3: 77, 4: 895}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114524281_1114524295 10 Left 1114524281 14:23358832-23358854 CCCTCCCCTGTCCCCTTCTCTAG 0: 1
1: 0
2: 10
3: 77
4: 895
Right 1114524295 14:23358865-23358887 GCCAGGGTCACCTGCGGCGCCGG 0: 1
1: 0
2: 2
3: 26
4: 177
1114524281_1114524292 4 Left 1114524281 14:23358832-23358854 CCCTCCCCTGTCCCCTTCTCTAG 0: 1
1: 0
2: 10
3: 77
4: 895
Right 1114524292 14:23358859-23358881 ATTCCCGCCAGGGTCACCTGCGG 0: 1
1: 0
2: 0
3: 7
4: 128
1114524281_1114524299 25 Left 1114524281 14:23358832-23358854 CCCTCCCCTGTCCCCTTCTCTAG 0: 1
1: 0
2: 10
3: 77
4: 895
Right 1114524299 14:23358880-23358902 GGCGCCGGCATCCCCCTCTCGGG 0: 1
1: 0
2: 2
3: 12
4: 96
1114524281_1114524289 -7 Left 1114524281 14:23358832-23358854 CCCTCCCCTGTCCCCTTCTCTAG 0: 1
1: 0
2: 10
3: 77
4: 895
Right 1114524289 14:23358848-23358870 TCTCTAGCACCATTCCCGCCAGG 0: 1
1: 0
2: 0
3: 3
4: 84
1114524281_1114524298 24 Left 1114524281 14:23358832-23358854 CCCTCCCCTGTCCCCTTCTCTAG 0: 1
1: 0
2: 10
3: 77
4: 895
Right 1114524298 14:23358879-23358901 CGGCGCCGGCATCCCCCTCTCGG 0: 1
1: 0
2: 0
3: 7
4: 82
1114524281_1114524290 -6 Left 1114524281 14:23358832-23358854 CCCTCCCCTGTCCCCTTCTCTAG 0: 1
1: 0
2: 10
3: 77
4: 895
Right 1114524290 14:23358849-23358871 CTCTAGCACCATTCCCGCCAGGG 0: 1
1: 0
2: 1
3: 0
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114524281 Original CRISPR CTAGAGAAGGGGACAGGGGA GGG (reversed) Intronic
900034611 1:396595-396617 CTAGAGAAAAGGACAGTGAATGG + Intergenic
900055442 1:626483-626505 CTAGAGAAAAGGACAGTGAATGG + Intergenic
900625691 1:3607573-3607595 ATGGAGAAGGTGGCAGGGGAAGG + Intronic
900628465 1:3620836-3620858 CAAGACAAGGGGGCAGGGTAAGG + Intergenic
900654496 1:3748401-3748423 CAAGACAAGGGGGCAGGGTAAGG + Intergenic
900811149 1:4802181-4802203 GGAGAGATGGAGACAGGGGAGGG - Intergenic
901146093 1:7065539-7065561 CTGGAGGAGGGGACAGGAGATGG + Intronic
901483247 1:9540087-9540109 CAGGAGAAGGGGGCGGGGGAGGG - Intronic
901669859 1:10849835-10849857 ATAGGGAAGTGGACAGTGGAAGG + Intergenic
901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG + Intergenic
902219647 1:14956966-14956988 CTAGAGGATGCGACTGGGGAAGG - Intronic
902271516 1:15308452-15308474 CCAGTGGAAGGGACAGGGGAGGG - Intronic
902288834 1:15423707-15423729 CTAGAGAAGGCGAAAGGAGCTGG + Intronic
902797666 1:18809932-18809954 TCAGAAAAGGGGACAGGGGCAGG + Intergenic
902833127 1:19030269-19030291 CTGGAGCAGGGGAGAGAGGAAGG + Intergenic
902923052 1:19678787-19678809 CCAGGCATGGGGACAGGGGAGGG + Intronic
903061281 1:20670537-20670559 CTAGAGGAGGGCACAGGTGGAGG + Intronic
903666172 1:25008976-25008998 CAAGAGGAGAGGACAGAGGAGGG + Intergenic
904265709 1:29317602-29317624 AGAGAGAAGGGTACAGGGCACGG - Intronic
904565352 1:31425307-31425329 CTACAGAAGGGGTCGGGGAATGG - Intronic
904746872 1:32716779-32716801 CTGGGGGAGGGGACAGGGCAGGG - Intergenic
905223952 1:36467312-36467334 CTGGAGAAGGGGGCAGGTGGAGG + Intronic
905858378 1:41330048-41330070 CTGGAGAAGGGGCCTGGGGCTGG - Intergenic
906090261 1:43172585-43172607 CAAGGGGAGGGGAAAGGGGAGGG + Intronic
906112969 1:43336896-43336918 CAAGACAAGGGGGCAGGGTAAGG + Intergenic
906288128 1:44601684-44601706 AGAGAGAGGGGGACAGGAGATGG + Intronic
906435482 1:45792683-45792705 GAAGAGAAGAGGAGAGGGGAGGG - Intronic
906489272 1:46255425-46255447 CTATAGCAGGGGGCAGGGGAGGG - Intronic
907241171 1:53081886-53081908 CTCCAGAAGGTAACAGGGGAGGG - Intronic
907288872 1:53399958-53399980 CCAGACAAGGGGGCAGGGTAAGG - Intergenic
907552326 1:55314809-55314831 CTAGAGAAGGGAACAGAGTCAGG + Intergenic
907560226 1:55381156-55381178 CAAGAGAGTGGGACAGTGGAGGG - Intergenic
908082770 1:60598517-60598539 GGAGAGAAGAGGACAGGGGCGGG + Intergenic
908295345 1:62707225-62707247 ATAGGGAAGGGGGCTGGGGAGGG + Intergenic
908446458 1:64202436-64202458 CTTGAAAAGGGAACAAGGGAAGG - Intergenic
909777554 1:79501494-79501516 ATAGAGGAGGGGTCAGGGTAGGG - Intergenic
910105939 1:83631232-83631254 GTGGAGAAGGGGCCAGAGGAAGG - Intergenic
910379324 1:86609151-86609173 CTTGAGGAGAGGACAGGGAAGGG - Intergenic
911073469 1:93850454-93850476 CAAGACAAAGGGACAGGGTAAGG + Intergenic
911654062 1:100423182-100423204 TGAGAGAAGAGGACAGGGGGCGG - Intronic
911718690 1:101166202-101166224 ATAGAGAAGAGGCCAGAGGATGG - Intergenic
911779430 1:101857597-101857619 AGAGAGAAGGGGAAAGGAGAGGG - Intronic
912412099 1:109486630-109486652 GGAGATAAAGGGACAGGGGAAGG + Intronic
912562421 1:110560412-110560434 CCAGAGGAGAGGACAGGGAAGGG - Intergenic
912695275 1:111836870-111836892 CAAGTGAAGGGTACCGGGGATGG - Intronic
913382413 1:118226629-118226651 CTAAAGAAGGGAACAGGGTCTGG - Intergenic
914441816 1:147714364-147714386 CTTGAGTAGGTGAAAGGGGATGG - Intergenic
914952283 1:152126844-152126866 TTAGAGAAGGGCACAGGTGGTGG + Intergenic
915161370 1:153922841-153922863 CTAGGGACGGGGGTAGGGGAGGG + Exonic
915185894 1:154104975-154104997 CTAGAGGAGAGGAGAGGAGAGGG + Intronic
915248214 1:154570794-154570816 CAATGGAAGGGGACAGGGCATGG - Intronic
915355205 1:155251680-155251702 CTAAGGAAGGGGACTGGGGCTGG - Intronic
915355954 1:155255273-155255295 CTAGAGAAGAGGGGAGGGGTCGG + Exonic
915356009 1:155255463-155255485 CTAGAGAAGGGGGATGGGAATGG + Intronic
915468808 1:156113908-156113930 CAAAGGAAGGGGACAGGAGATGG + Intronic
915565046 1:156708334-156708356 CTAGGGAAGGGGACTCGGGGAGG + Intergenic
915730590 1:158051208-158051230 AAAGGCAAGGGGACAGGGGAAGG - Intronic
915736776 1:158090241-158090263 CCAGAGGAGGAGACAGGGAAGGG - Intronic
916405222 1:164491544-164491566 CTAGAGTCAGGGACAGGGGTCGG + Intergenic
917176050 1:172236640-172236662 GTAGAGAAGAGGACAGAGGGAGG + Intronic
917245297 1:172994713-172994735 CAAGAGAAAGGGAAAGGTGAAGG - Intergenic
917343266 1:174002856-174002878 CTAGGGAAGAGAACTGGGGAAGG - Intronic
917495991 1:175540691-175540713 CTGGGGAAGGGGAGAGTGGATGG - Intronic
917954907 1:180085122-180085144 GAAGGGAAGGGGAAAGGGGAAGG - Intronic
918069200 1:181122622-181122644 CTAGAAAAGGGGCCAAGGAAGGG - Intergenic
918131719 1:181635267-181635289 CTAGAGAAGGGGTTGTGGGAGGG + Intronic
919429166 1:197471494-197471516 CGACAGCAGGGAACAGGGGAGGG - Intronic
920006304 1:202836014-202836036 CTGGAGATGGAGAGAGGGGAAGG - Intergenic
920032984 1:203048489-203048511 GATGAGAAGAGGACAGGGGAGGG + Intronic
920098731 1:203503322-203503344 GAAGAGAAGGGGAGAGAGGAAGG - Intronic
920099594 1:203508588-203508610 CTAGTGTGGGGGAGAGGGGAGGG - Intronic
920268872 1:204747782-204747804 CTGCAGAAGAGGAGAGGGGATGG + Intergenic
920276907 1:204813286-204813308 CCAGAGAAGAGGACAGGTAAAGG + Intergenic
920312729 1:205058158-205058180 CTGCAGCAGGGGACAGAGGAAGG - Intronic
920548298 1:206837096-206837118 AAAGAGAAGGGGACAAGGTAGGG - Intronic
920682797 1:208085410-208085432 CAGGAGAAGGGGACAGAGAAAGG - Intronic
920777010 1:208948711-208948733 AGAGAGAAGAGGAGAGGGGATGG + Intergenic
920881664 1:209886567-209886589 AAAGAGAAGGGAATAGGGGAGGG + Intergenic
920971480 1:210746909-210746931 CTGCAGAATGGGACAGAGGAAGG + Intronic
921011517 1:211146428-211146450 AGAGAGAAAGTGACAGGGGATGG - Intergenic
921329304 1:214019644-214019666 GTACACAAGGTGACAGGGGAGGG - Intronic
921562724 1:216677584-216677606 ATAGAGAAAGGGAAAGGGAAAGG + Intronic
921616495 1:217273915-217273937 CTAAAGAAGGGGAGAGGAGCCGG - Intergenic
921906527 1:220501360-220501382 CTGGAGCAGGGGACAGGAGGAGG - Intergenic
922266828 1:223991969-223991991 CTAGAGATGGGGTCGGGGGGGGG - Intergenic
922625826 1:227041293-227041315 CTAGAGAAGGGGAAGGAGGGAGG - Intronic
922640341 1:227223627-227223649 TTAGAGAAGGGGACAAAGGGAGG - Intronic
922696758 1:227734919-227734941 CTAGAGAGGGGCACCAGGGAGGG - Intronic
923037214 1:230292638-230292660 CAAGAGAAGGAGAGAGAGGAAGG - Intergenic
923716152 1:236426300-236426322 CTAGAGCAGGGGTGAGGAGAAGG - Intronic
923750777 1:236744506-236744528 CAAGAGAAGGGGACAGAGAGGGG - Intronic
923790094 1:237104441-237104463 CTAGACAAGGAGACAGGGAAAGG - Intronic
924155590 1:241173220-241173242 CTAGAGTAGAGGTCAGAGGATGG - Intronic
924172051 1:241352636-241352658 CTATTGAAGGGTACAGGTGATGG - Intronic
924631316 1:245743395-245743417 TTGGAGAAGGGGGCAAGGGATGG - Intergenic
1062958960 10:1558512-1558534 CCACAGAAGGGGACAGAGGTGGG - Intronic
1062958975 10:1558571-1558593 CCACAGAAGGGGACAGAGGTGGG - Intronic
1063163006 10:3433466-3433488 CTCAAGAATGAGACAGGGGAAGG + Intergenic
1063320436 10:5046876-5046898 CAAGACAAAGGGACAGGGTAAGG + Intronic
1063660686 10:8033865-8033887 CTAGAGCAGGGGAGTTGGGAGGG - Intergenic
1063857883 10:10275069-10275091 CTGGAGAAGTGGACAGGGAGAGG - Intergenic
1064176817 10:13082215-13082237 CAAGACAAGGGGGCAGGGTAAGG + Intronic
1065759088 10:28965013-28965035 CAAGAGGAGGGGAGAGAGGAGGG - Intergenic
1066072660 10:31835833-31835855 CAAGGGCAGGGGACTGGGGAGGG + Intronic
1066122952 10:32309114-32309136 CAATAGAAGGGTACTGGGGAGGG + Intronic
1066249278 10:33617221-33617243 CTAAAGAAGGGGGTTGGGGAGGG + Intergenic
1066334528 10:34462905-34462927 GGAGAGGAGGGGAGAGGGGAGGG + Intronic
1066762559 10:38769444-38769466 CCAGAGAAGGGCAGAGGGAAAGG - Intergenic
1067231913 10:44418007-44418029 TGAGGGAAGGGGACAGTGGAGGG + Intergenic
1067288511 10:44924590-44924612 ACAGAGCAGGGGACAGAGGAGGG + Intronic
1067382575 10:45788515-45788537 GTAGAGTAGGGGCCAAGGGAGGG + Intronic
1067890279 10:50129065-50129087 GTAGAGTAGGGGCCAAGGGAGGG + Intronic
1069304997 10:66957990-66958012 CTGGAGCAGGGTACAGAGGAAGG + Intronic
1069633398 10:69911191-69911213 ATTGAGAAGGGGCAAGGGGAAGG - Intronic
1069846366 10:71374600-71374622 ATGGAGATGGGGACAGGGGCAGG - Intergenic
1070541503 10:77418570-77418592 CTGGAGATGGGGACAGGGTGTGG - Intronic
1070586876 10:77773004-77773026 CAAGACAAGGGGGCAGGGTAAGG + Intergenic
1070688238 10:78505668-78505690 CTGGAGAAGGAGACAGGGCAGGG + Intergenic
1070806290 10:79272962-79272984 CTGGAGAGGATGACAGGGGATGG + Intronic
1070831434 10:79420271-79420293 CTTGGGGAGGGGACAGGGGAAGG - Intronic
1070855162 10:79602903-79602925 CTGGAAAAGGGGGCAGGGGAAGG + Intergenic
1070921968 10:80193359-80193381 CTGGAGAAAGGGAAAGAGGAAGG + Intronic
1071420067 10:85486423-85486445 CTAGAGGTGGAGACAGGGAAGGG - Intergenic
1071561745 10:86650936-86650958 CCAGAGCAGGGGACAGGCGAAGG + Intergenic
1071887086 10:89963093-89963115 CTAGAAGAGGGAAGAGGGGAAGG + Intergenic
1071887293 10:89964859-89964881 CTAGAAGAGGGAAGAGGGGAAGG + Intergenic
1073293943 10:102427191-102427213 GCAGAGAAGGGGACAGAGAAAGG - Intronic
1073342847 10:102758757-102758779 CAAGACAAGGGGGCAGGGTAAGG + Intronic
1073479922 10:103779937-103779959 CTGAAGAAGGGGGAAGGGGAAGG + Intronic
1073612519 10:104958517-104958539 CTAGAGAATGGGAAAGAGGGAGG + Intronic
1073712273 10:106057206-106057228 ATAAAGAAGGGGAAAGGGAAAGG - Intergenic
1074263872 10:111881738-111881760 ATAGAGAAGTGGGCTGGGGACGG + Intergenic
1074523448 10:114245060-114245082 GTATTGAGGGGGACAGGGGAGGG + Intronic
1075144104 10:119868784-119868806 CCAGAAAAGTGGACATGGGATGG + Intronic
1075581280 10:123620326-123620348 CTAGAGATGGGGACCAGAGAGGG + Intergenic
1075683911 10:124350857-124350879 CTGGAGGAGGAGACATGGGAGGG - Intergenic
1075785020 10:125043242-125043264 CAAGGGCAGGGGAAAGGGGAGGG + Intronic
1076034243 10:127185674-127185696 TTAGAGAAGTGGAAAGGAGAAGG + Intronic
1076121760 10:127941866-127941888 GCAGAGTAGGGGACAGGTGAGGG + Intronic
1076152228 10:128171995-128172017 GGGGAGAAGAGGACAGGGGAGGG - Intergenic
1076182930 10:128424703-128424725 CTAGGAAAGAGGAAAGGGGATGG - Intergenic
1077001433 11:325010-325032 CAAGACAAGGGGGCAGGGTACGG + Intronic
1077052582 11:574408-574430 CAAGACAAGGGGGCAGGGTAAGG - Intergenic
1077111518 11:864167-864189 CCAGGGATGGGGGCAGGGGAGGG + Intronic
1077166753 11:1145152-1145174 CTGGAGACTGGGAGAGGGGACGG + Intergenic
1077173807 11:1179890-1179912 CACAAGATGGGGACAGGGGAGGG - Intronic
1077874670 11:6294098-6294120 CAAGAGAAGGAGGCAGGGGCAGG + Intergenic
1077879837 11:6340454-6340476 CGAGAGATGGGGGCAGGAGAAGG - Intergenic
1078639161 11:13079355-13079377 CCAGAGAGGGTGACAGGGAAAGG + Intergenic
1078764063 11:14276590-14276612 CTAAAGAAGGGGAAGAGGGAGGG + Intergenic
1079338223 11:19589850-19589872 GTAGAGAAGGAGAGAGGGAAGGG + Intronic
1079694898 11:23469272-23469294 AAAGAAAAGGGGAGAGGGGAAGG + Intergenic
1079937977 11:26641521-26641543 CTATAGGTGGGGAGAGGGGAAGG + Intronic
1080033810 11:27689872-27689894 CTGGAGCAGGGGGCAGGGGAAGG - Intronic
1080070931 11:28085642-28085664 CAAGACAAGGGGGCAGGGTAAGG - Intronic
1082061532 11:47865204-47865226 ATGGAGAAGGGAACAGGGTAAGG - Intergenic
1082114571 11:48314418-48314440 GTAGAGAAGGAGACAGGGGTAGG - Intergenic
1082856697 11:57814642-57814664 CCAGAGAAGGAGACTGGGGTAGG - Intronic
1083014922 11:59443551-59443573 GTAGAGAAGGGGGCTGGAGATGG - Exonic
1083402065 11:62430376-62430398 CAAGAGAAGGGGATAAGGGCTGG - Intergenic
1083449655 11:62734653-62734675 CAAAAAAAAGGGACAGGGGAGGG + Intronic
1083503013 11:63128770-63128792 CAAGACAAGGGGGCAGGGTAAGG - Intronic
1083604401 11:63969271-63969293 CTACAGAAAGAAACAGGGGATGG - Intergenic
1083627302 11:64078285-64078307 CTGGAGAAGAGGCCAGGGCAGGG - Intronic
1083738013 11:64692747-64692769 GAGGGGAAGGGGACAGGGGAAGG + Intronic
1083875523 11:65522006-65522028 CAAGACAAGGGGGCAGGGTAAGG + Intergenic
1084008020 11:66333458-66333480 GCAGGGAAGGGGAGAGGGGATGG - Intronic
1084985726 11:72869378-72869400 CAAGAGAAGGGGAAAGGGAGGGG + Intronic
1085034259 11:73290789-73290811 CTAGAGGAGGGGGCAGGGCCCGG - Intronic
1086406072 11:86499964-86499986 CTAGTGAATGTGACAGGGCAGGG + Intronic
1086518685 11:87645902-87645924 CAAGAGAAGGGGGAAGGGAAGGG - Intergenic
1087423915 11:97966390-97966412 CTAGAGAAGGGAAAAGAGAAGGG + Intergenic
1087674707 11:101147130-101147152 TAAGTGAAGGGGACAGGAGAGGG - Intergenic
1088817530 11:113431958-113431980 GTAGAGGAGGGGACAGGGAGTGG + Intronic
1089169732 11:116503648-116503670 CAAGTGAAGGGCACAGAGGAGGG - Intergenic
1089831849 11:121335861-121335883 GTAGAACAGGGGCCAGGGGAGGG + Intergenic
1091192576 11:133707362-133707384 AAAGAGAAGGGGAAAGGGAAGGG + Intergenic
1091821791 12:3480984-3481006 CTAGAGGAGGGGCCAGGACAGGG + Intronic
1091848615 12:3677577-3677599 CTGGAGAAGGGGGAAGGAGAAGG - Intronic
1092140781 12:6182082-6182104 CTGGAGGAAGGGACAGGGGATGG + Intergenic
1092140787 12:6182095-6182117 CAGGGGATGGGGACAGGGGATGG + Intergenic
1092232227 12:6782644-6782666 CAAGAGAAGAGGGCTGGGGATGG - Intergenic
1092286874 12:7133629-7133651 CTTGACAAGGCGACAGGAGAGGG + Exonic
1092331935 12:7593029-7593051 TTAGGGAAGGCAACAGGGGAGGG + Intergenic
1092380937 12:7996571-7996593 CCAGAGAATGTGACGGGGGAAGG - Intergenic
1092676752 12:10929393-10929415 CTATAGAGGGGGAAAGTGGAGGG + Intronic
1094079386 12:26516153-26516175 AAAGAGAAGGGGAGAGGAGAGGG + Intronic
1096177857 12:49534897-49534919 GAAGAGACGGGGAGAGGGGAGGG + Intergenic
1096244277 12:49975579-49975601 GTAGAGGTGGGGACAGGGGCAGG + Exonic
1096745588 12:53724864-53724886 CAAGAGAAAGGGAAAGTGGAGGG + Intronic
1096781054 12:53992333-53992355 CTATAGAAGGGGAAGGGGAAAGG - Intronic
1096799586 12:54101272-54101294 CCAGAGAGGGGCACTGGGGATGG + Intergenic
1096887276 12:54730652-54730674 GAAGAGAAAGGGAAAGGGGAAGG - Intergenic
1097065042 12:56314986-56315008 TGAGAGCAGGGGACAGGGTAGGG + Intronic
1097161071 12:57047139-57047161 CTAGAGAAGGGAAAGGAGGAAGG + Intronic
1097227912 12:57489570-57489592 CTTGAGATGAGGACTGGGGAAGG + Intronic
1097579481 12:61436539-61436561 AGAGAGAAGGGGAGAGGGGAAGG + Intergenic
1097918366 12:65044065-65044087 CCAGAGAGGGGGACAGGCAAGGG + Intergenic
1098285389 12:68901879-68901901 AGAGAGAAGGGGAGAGGGGAGGG + Intronic
1098483356 12:70991899-70991921 CCAGGGAAGGAGGCAGGGGAAGG - Intergenic
1098625406 12:72660027-72660049 CAAGACAAGGGGGCAGGGTAAGG + Intronic
1100375557 12:94013179-94013201 GAAGAGAAGAGGAGAGGGGAGGG + Intergenic
1100878638 12:98992035-98992057 GTAGAGAATGGGGCAGGGGTAGG + Intronic
1101256513 12:102982876-102982898 TTAGAGAAGTGGAGTGGGGAAGG + Intergenic
1101257042 12:102988896-102988918 CTAGTGTAGGGCACAGAGGATGG - Intergenic
1101686685 12:107030777-107030799 GTGGGGAAGGGGGCAGGGGAAGG + Intronic
1101693024 12:107098401-107098423 AGAGAGAAGGGGAGAGGGGAAGG + Intergenic
1101755816 12:107619945-107619967 CCAGGGAAGGTGGCAGGGGAGGG - Intronic
1102162292 12:110779278-110779300 CTAGAGGAGGGGAAAAGGGAGGG + Intergenic
1102772038 12:115486447-115486469 CTAGAGAAGAGCAGAGAGGAGGG + Intergenic
1102810274 12:115818410-115818432 CTTGAGAAGAGGAGAGAGGAAGG - Intergenic
1102813187 12:115841699-115841721 AGAGAGAAGGGGGAAGGGGAAGG - Intergenic
1103163164 12:118747750-118747772 CTATAGAAAGGGAGAAGGGATGG + Intergenic
1103361884 12:120359405-120359427 CTAGAGAAGGAAATATGGGAGGG + Intronic
1103501675 12:121407903-121407925 GTGGAGAGGGGGACAAGGGATGG - Intronic
1103702380 12:122854694-122854716 CTAGAGAAGGAAACAGCGAATGG - Intronic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1104131164 12:125895716-125895738 CCAGAGTATGGGACAGGAGACGG + Intergenic
1104766379 12:131332959-131332981 CTAGAGAAGGGGGCAGAGGGAGG + Intergenic
1104795803 12:131516599-131516621 CAAGACAAGGGGGCAGGGTAAGG + Intergenic
1104813029 12:131629638-131629660 CTAGAGAAGGGGGCAGAGGGAGG - Intergenic
1104862906 12:131933926-131933948 CAAGGCAAGGGGACAGGGTAAGG + Intronic
1104977311 12:132557934-132557956 CTGGAAGAGGGGACTGGGGATGG + Intronic
1105041450 12:132964584-132964606 CAAGACAAGGGCACAGGGTAAGG - Intergenic
1105043132 12:132977550-132977572 CAAGACAAGGGGGCAGGGTAAGG - Intergenic
1105454332 13:20526091-20526113 CTATAGGAGGGGACACGGGCAGG + Intergenic
1106106399 13:26737087-26737109 GGAGAGAAGGGCACAGGGGTGGG + Intergenic
1108163530 13:47667603-47667625 CAATAGAAGGGCACAGAGGAAGG + Intergenic
1108518759 13:51225912-51225934 CTATAGAAGGGGGAAGGAGAAGG + Intronic
1108588309 13:51890394-51890416 CAAGAGAGGGAGAAAGGGGAGGG - Intergenic
1108862025 13:54872565-54872587 CAAGGGCAGGGGGCAGGGGAGGG + Intergenic
1109181898 13:59223889-59223911 CAGGAGAAGGGGAGAAGGGAAGG + Intergenic
1109290953 13:60474280-60474302 CAAGACAAGGGGGCAGGGTAAGG - Intronic
1110741182 13:78999303-78999325 TTAGAGAAGGGGGCATGGCATGG - Intergenic
1111215232 13:85132787-85132809 CAAGACAAGGGGGCAGGGTAAGG + Intergenic
1111662503 13:91228937-91228959 TTGGAGAAGGGAACAGGGCAAGG - Intergenic
1112376804 13:98850241-98850263 CTATAAAAGAGGGCAGGGGAAGG - Intronic
1112661175 13:101510154-101510176 CTAGAGGAGGGGATGGAGGAAGG - Intronic
1112722528 13:102260833-102260855 TCAGAGAAGGGGATAGGGCAAGG - Intronic
1112982620 13:105404538-105404560 ATGGAGAGAGGGACAGGGGAAGG + Intergenic
1113257968 13:108528577-108528599 GGAGAGGAGGGGAAAGGGGAGGG - Intergenic
1113258004 13:108528662-108528684 CGAGAGGAGAGGAGAGGGGAGGG - Intergenic
1113614488 13:111671025-111671047 AGGGAGGAGGGGACAGGGGACGG - Intronic
1113619956 13:111755939-111755961 AGGGAGGAGGGGACAGGGGACGG - Intergenic
1113775433 13:112942403-112942425 CAAGACAAAGGGACAGGGTAAGG - Intronic
1114524281 14:23358832-23358854 CTAGAGAAGGGGACAGGGGAGGG - Intronic
1114642767 14:24235205-24235227 CTAGAGATGGAGACAGGGTAGGG + Intronic
1115018860 14:28650272-28650294 CAAGAGAAGGGTTGAGGGGATGG - Intergenic
1115821319 14:37215240-37215262 CAAGACAAGGGGGCAGGGTAAGG - Intronic
1115906981 14:38211199-38211221 GGCGAGAGGGGGACAGGGGAGGG - Exonic
1117069442 14:52043474-52043496 GGGGAGAAGGGGACAGAGGAGGG + Intronic
1117571711 14:57055510-57055532 ACAGTGAAGGGGACAGTGGATGG + Intergenic
1118186563 14:63543203-63543225 CAAGAGAAGGGGACAGAATAAGG + Exonic
1119272856 14:73325143-73325165 CAAAAGAAGGGGACAGGGAGTGG - Intronic
1119622026 14:76138582-76138604 CTTGGGGAGGGGGCAGGGGAGGG - Intergenic
1119646125 14:76349811-76349833 ATAGAGAAGGGAAAAAGGGAAGG + Intronic
1119761611 14:77155629-77155651 GGAGAGAAAGGGAAAGGGGAAGG + Intronic
1120401705 14:84040777-84040799 CCAGAGAAGGGGACATTTGAGGG + Intergenic
1121518024 14:94566640-94566662 CTTGAGAAGGAGAGAGGAGATGG - Intronic
1121552585 14:94813624-94813646 CCAGAGAGGGGGACAGGGGATGG + Intergenic
1121729247 14:96174836-96174858 CTGGAGAGGGGGAGAGGGAAAGG + Intergenic
1121914281 14:97821568-97821590 CTTCAGAAGGTGACAGGAGAGGG - Intergenic
1122636066 14:103130254-103130276 CTGGACAAGGGGGCAGGGGACGG - Intronic
1122883935 14:104702260-104702282 CTGGAGTAGGGGACAGGGCGGGG - Intronic
1202933890 14_KI270725v1_random:65684-65706 CCAGAGAAGGGCAGAGGGAAAGG - Intergenic
1124611462 15:31212351-31212373 GGAGAGAAGGGGAGAGAGGAAGG + Intergenic
1125570170 15:40710829-40710851 CTTGAGAAGGTGGCAGGAGATGG - Intronic
1125655635 15:41354721-41354743 ATAGAGACGGGGTCAGGGCAGGG + Intronic
1126443263 15:48714916-48714938 GAAGAGAAGAGGAGAGGGGAAGG - Intronic
1126527983 15:49678977-49678999 CTAGGGGATGGGACAGGGAAAGG - Intergenic
1127027976 15:54829136-54829158 ATAGCTAAGGGGACAGGAGAAGG + Intergenic
1127417103 15:58768956-58768978 CAAGACAAGGGGGCAGGGTAAGG - Intergenic
1127657777 15:61071618-61071640 GGAGAGGAGGGGAGAGGGGAGGG + Intronic
1127689089 15:61377007-61377029 CTTGAGAAGGGGACTTGGGGTGG + Intergenic
1127973018 15:63977101-63977123 AAAGAGAAGGGGAAGGGGGAAGG + Intronic
1128368028 15:67018492-67018514 CGAGAGGAGGGCAAAGGGGAGGG - Intergenic
1128375965 15:67076241-67076263 ATAGAGAAGGTGATGGGGGAGGG - Intronic
1128691380 15:69726984-69727006 CTAGAGCAGAGGGCAGGGGAGGG + Intergenic
1128797988 15:70478818-70478840 CTGGAGAACGGGACAGAGGAGGG + Intergenic
1129338998 15:74872923-74872945 CTAGGGAAGGGGACTGGAGCAGG - Intronic
1129468113 15:75735379-75735401 CAAGACAAGGGGGCAGGGTAAGG - Intergenic
1129676202 15:77633439-77633461 CGAGAGGAGGGGACAGGGCCAGG - Intronic
1129865247 15:78902462-78902484 CAAGACAAGGGGGCAGGGTAAGG + Intergenic
1130074382 15:80676078-80676100 CAAGAGCAGGGGACCGGGGCGGG - Intergenic
1130115225 15:81000696-81000718 CTGGGGGAGCGGACAGGGGAAGG - Intergenic
1130981499 15:88814876-88814898 CAGGAGAGGAGGACAGGGGATGG - Intronic
1132078654 15:98845546-98845568 CGAGAGAAGAGGAGAGAGGAGGG - Intronic
1132207495 15:99996342-99996364 CTAGAGTACTGGAAAGGGGAGGG + Intronic
1132607775 16:800666-800688 CTTGAAAAGGTGACAGCGGAGGG + Exonic
1133039434 16:3052541-3052563 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133043277 16:3072174-3072196 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133454236 16:5929155-5929177 CTTGGGAAGCGGACAGGGAAGGG + Intergenic
1133470130 16:6066953-6066975 CCAGAGTAGGGGGCGGGGGAGGG + Intronic
1133922416 16:10165664-10165686 AGAGAGAAGAGGAGAGGGGAGGG + Intronic
1134048894 16:11123196-11123218 CCTGAGAAAGGGACAGGGGCTGG - Intronic
1134245409 16:12535919-12535941 CTAGAAAATGGGGCTGGGGAGGG + Intronic
1134398663 16:13889078-13889100 CCGGAGAAGGAGAAAGGGGAGGG - Intergenic
1134449426 16:14354283-14354305 ACAGGGAAGGGGAAAGGGGAGGG + Intergenic
1134856043 16:17520118-17520140 ATGGAGAAGGAGGCAGGGGAAGG + Intergenic
1135424961 16:22327931-22327953 GGAGAGAAGGGGACAGGGGAGGG - Intronic
1135920808 16:26647364-26647386 CTAGCGAAGGAGAGAGGGGAGGG - Intergenic
1136079509 16:27842528-27842550 CTAGAGAAGGGCACAGAGGAAGG - Intronic
1136498181 16:30656500-30656522 CTAGAGATGGTGACAGGGGTTGG + Intergenic
1136598422 16:31267397-31267419 TAAGAGAAGGGGAAAGTGGAGGG - Intronic
1136711818 16:32243702-32243724 CAAGACAAGGGGGCAGGGTAAGG - Intergenic
1136756098 16:32685705-32685727 CAAGACAAGGGGGCAGGGTAAGG + Intergenic
1136812015 16:33184668-33184690 CAAGACAAGGGGGCAGGGTAAGG - Intergenic
1136818491 16:33294748-33294770 CAAGACAAGGGGGCAGGGTAAGG - Intronic
1136825055 16:33351281-33351303 CAAGACAAGGGGGCAGGGTAAGG - Intergenic
1136830121 16:33450052-33450074 CAAGACAAGGGGGCAGGGTAAGG - Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1138071966 16:54001657-54001679 GGAGAGTAGGGGAAAGGGGAGGG - Intronic
1138242194 16:55436182-55436204 TGAGAGAAGGGAAGAGGGGAAGG + Intronic
1139341053 16:66268022-66268044 ACAGGGAATGGGACAGGGGAAGG + Intergenic
1139469815 16:67172101-67172123 CCAGAGAAGGAGGCAGAGGAGGG + Intronic
1139660289 16:68416266-68416288 CTAGAGCAGGGGAAAGGGTCGGG - Intronic
1139695753 16:68673436-68673458 CTAGAGAGAGAGAGAGGGGAGGG - Intronic
1139809043 16:69597184-69597206 CTAGAGAAGAGGGAAGGAGAGGG + Intronic
1139968248 16:70757474-70757496 CTGGAGAAGGGAAGACGGGAGGG + Intronic
1140279763 16:73543827-73543849 CTGGAGAAGGGGGTGGGGGAGGG + Intergenic
1140716364 16:77728922-77728944 GTAGAAGAGGGGACAGAGGAGGG - Intronic
1140761364 16:78111947-78111969 CAAGACAAGGGGGCAGGGTAAGG - Intronic
1140894947 16:79316746-79316768 CTGGAGATAGGGACAGAGGAAGG + Intergenic
1141281133 16:82630465-82630487 ATAGAAAAGGGGAGAAGGGAGGG - Intronic
1141341714 16:83209818-83209840 CAGGAGAAAGGGTCAGGGGAAGG + Intronic
1141428320 16:83957617-83957639 CTGGAGTGGGGGAGAGGGGAAGG - Intronic
1142177185 16:88650699-88650721 CGAGAGAAGGGAATGGGGGAGGG + Intronic
1142212198 16:88813482-88813504 CTGGAGGAGGGGCCTGGGGAGGG + Intergenic
1202990593 16_KI270728v1_random:7638-7660 CAAGACAAGGGGGCAGGGTAAGG - Intergenic
1203058236 16_KI270728v1_random:946057-946079 CAAGACAAGGGGGCAGGGTAAGG + Intergenic
1142526286 17:543908-543930 GGAGGGGAGGGGACAGGGGAAGG + Intronic
1143447248 17:7016800-7016822 CCAGAGAGGGGCAGAGGGGAGGG + Intronic
1143452935 17:7046944-7046966 CAAGACAAGGGGGCAGGGTAAGG + Intergenic
1143459385 17:7091511-7091533 CAAGACAAGGGGGCAGGGGAAGG + Intergenic
1143481201 17:7228169-7228191 CTAGAGAAGGTGAGGGTGGAAGG + Intronic
1143499947 17:7332755-7332777 CAAGACAAGGGGGCAGGGTAAGG + Intergenic
1143538700 17:7557283-7557305 CTTGAGATGGGCCCAGGGGAGGG - Exonic
1143714228 17:8755669-8755691 GGAGAGAAGGGAACAGGGGCTGG + Intronic
1144761724 17:17710999-17711021 GGAGAGAAGGGAGCAGGGGAGGG - Intronic
1145833396 17:27935719-27935741 CTAGAGAAGGGAACAGATGCAGG + Intergenic
1145901383 17:28492589-28492611 CTGGAGAAGTAGGCAGGGGAAGG + Intronic
1146280268 17:31540130-31540152 CTAGAGAGGGGGATAGTGGAGGG + Intergenic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146952277 17:36915134-36915156 CCAGGGAATGGGACAAGGGAAGG - Intergenic
1147189843 17:38731971-38731993 GTAGAGAGGGGCACAGGGGAAGG - Intronic
1147383684 17:40070079-40070101 CTAGAGAATGGGAGATGGGGTGG - Intronic
1147614471 17:41820084-41820106 CTGGGGCAGGGGGCAGGGGAAGG - Intronic
1147836804 17:43338603-43338625 CAAGACAAGGGGGCAGGGTAAGG + Intergenic
1147871781 17:43592594-43592616 CTAGAGATGGGGAGAGTGGCTGG - Intergenic
1147912317 17:43862970-43862992 CTGGAGAAGGGGTCGGGGGTGGG + Exonic
1147951121 17:44108613-44108635 CAAGAGATGGGGAGAGGGGGTGG + Intronic
1148232857 17:45947934-45947956 CTAGGGAATGGGAGTGGGGAAGG - Intronic
1148444211 17:47727798-47727820 CCAGAGAGGGGGGAAGGGGAGGG - Intergenic
1148550179 17:48545472-48545494 CTGGGGAAGGGGAGAAGGGAAGG - Intergenic
1148770709 17:50064395-50064417 CTGGAGAAGGGGAGTTGGGAGGG + Intronic
1148889642 17:50798616-50798638 CTAGGGAAGGGGTCAGGGGAGGG + Intergenic
1149772705 17:59333265-59333287 ATGGAGCTGGGGACAGGGGATGG - Intronic
1149930578 17:60750695-60750717 CTAGTGAGGGGGACAGGGTAAGG - Intronic
1150496409 17:65611234-65611256 CTAGAACAGGGGCTAGGGGAAGG + Intronic
1150931544 17:69590347-69590369 GTAGAGAAGGGGAGAAGAGAAGG - Intergenic
1150952987 17:69823025-69823047 CTAGAGAAGGAAAAAGAGGAGGG - Intergenic
1151049454 17:70960403-70960425 CTTGATAAGGGGAGAAGGGATGG + Intergenic
1151376137 17:73690330-73690352 CTAGAGATGAGGACAAGGGTGGG - Intergenic
1151786320 17:76276811-76276833 CGTGTGAAGGGGCCAGGGGAGGG - Intronic
1152127187 17:78454270-78454292 CAGGTGATGGGGACAGGGGAAGG + Intronic
1152202361 17:78954506-78954528 GTTGAGAAGGGGACGGGGGCAGG + Intergenic
1152256393 17:79242547-79242569 GGAGAGAAGAGGAGAGGGGAGGG + Intronic
1152380599 17:79940762-79940784 GGCGTGAAGGGGACAGGGGACGG - Exonic
1152422214 17:80199994-80200016 CTCCAGGAGGGGACTGGGGATGG + Intronic
1152503837 17:80733485-80733507 CTAGAAATGGAAACAGGGGAAGG - Intronic
1152628149 17:81397646-81397668 CGAGCGCAGGGGTCAGGGGAGGG - Intronic
1152788230 17:82263364-82263386 CTAGAGAAGGTGCCATGGGCAGG + Intronic
1153030817 18:711634-711656 CTCTAGACGGGGGCAGGGGAGGG + Intronic
1153262663 18:3239463-3239485 CAAGAGCATGGGCCAGGGGATGG + Intergenic
1153737839 18:8090942-8090964 CTAGGGAAGAGGACTGGGAAAGG - Intronic
1153761363 18:8335239-8335261 CTGAAGGAGGGGAGAGGGGAGGG - Intronic
1154052424 18:10973708-10973730 AAAGAGAAGGGGACGGGGCAAGG + Intronic
1154308981 18:13253186-13253208 CCCGAGAAGGTGACAGGAGAAGG + Intronic
1155307510 18:24492867-24492889 CGAGAGATGGGGGCAGGGGGAGG + Intergenic
1156472206 18:37384384-37384406 CTGGGGATGAGGACAGGGGAGGG + Intronic
1156495064 18:37520189-37520211 CCAGAGCTGGGGCCAGGGGAAGG - Intronic
1156519357 18:37708727-37708749 ATAGAGAAGTGGAGAGAGGAAGG - Intergenic
1157566553 18:48682592-48682614 AGATAGAAGGGGATAGGGGAAGG - Intronic
1157803177 18:50637477-50637499 CTAAAGTAAAGGACAGGGGATGG + Intronic
1158647902 18:59264217-59264239 CTGGAGAAGCGGACTGGGCAAGG + Intergenic
1158721952 18:59933009-59933031 CTGGGGATGGGGACTGGGGAGGG - Intergenic
1159033497 18:63255190-63255212 CTAGAGAAGGTGACAAGTGCTGG - Intronic
1159545922 18:69839395-69839417 CTAGGGAAGGAGTTAGGGGAGGG - Intronic
1159627398 18:70710626-70710648 CACCAGAAGGGGACAGAGGATGG - Intergenic
1160403651 18:78629536-78629558 CTAGAGATGAGGACAGAGGACGG + Intergenic
1160674638 19:383347-383369 CCTGAGAGAGGGACAGGGGAGGG - Intergenic
1160684588 19:427624-427646 ACAGGTAAGGGGACAGGGGACGG + Intronic
1160684628 19:427774-427796 ACAGGTAAGGGGACAGGGGACGG + Intronic
1160844235 19:1159575-1159597 GAAGAGCAGGGGACAGTGGAGGG + Intronic
1160914987 19:1492050-1492072 CTAGAGATTTGGAAAGGGGAAGG - Intronic
1160965472 19:1745357-1745379 GAAGAGAAGGGGATTGGGGAGGG - Intergenic
1161030693 19:2056591-2056613 GGAGAGAAGGGGACGAGGGAAGG - Intergenic
1161142705 19:2657999-2658021 CAAGACAAGGGGGCAGGGTAAGG - Intronic
1161245799 19:3251088-3251110 GGGGAGGAGGGGACAGGGGATGG + Intronic
1161251706 19:3284425-3284447 CTAGGGAAAGGGGTAGGGGAGGG - Intronic
1161342911 19:3752692-3752714 CTCGAGAAGCGGCGAGGGGAGGG - Exonic
1161748858 19:6079482-6079504 CTATAGAAAGGGACAGCAGATGG + Intronic
1161750495 19:6092712-6092734 CCAGAGGAGGGGCCGGGGGAGGG + Intronic
1161870977 19:6869727-6869749 CAAGACAAGGGGGCAGGGTAAGG - Intergenic
1161946093 19:7438024-7438046 GGAGAGAAGAGGAGAGGGGAAGG - Intronic
1162008115 19:7792820-7792842 CAAGACAAGGGGGCAGGGTAAGG + Intergenic
1162068231 19:8138358-8138380 GGTGAGGAGGGGACAGGGGAGGG - Intronic
1162224207 19:9206164-9206186 CAAGACAAGGGGGCAGGGTAAGG - Intergenic
1162373156 19:10290736-10290758 TGAGAGAAGGGGACCCGGGATGG - Intronic
1162461803 19:10818044-10818066 CTTTAGAAGGGGCTAGGGGAGGG - Intronic
1162576293 19:11500943-11500965 TTGGAGAAGTGGACAGGAGAGGG - Intronic
1162796431 19:13089830-13089852 GAAGAGAGGGGGCCAGGGGAGGG - Intronic
1162952764 19:14081767-14081789 CCAGAATAGGGGGCAGGGGAGGG - Exonic
1162982490 19:14248614-14248636 CTGGGGAGGGGGAGAGGGGATGG - Intergenic
1163187463 19:15649133-15649155 CCAGAGAAGGGGACAGAGCTGGG - Intronic
1163217324 19:15890438-15890460 CCAGAGAAGGGGACAGAGCTGGG + Intronic
1163351206 19:16777564-16777586 GGAGAGGAGGGGATAGGGGAGGG + Intronic
1163752461 19:19085833-19085855 GGAGAGGAGGGGAGAGGGGAGGG + Intronic
1163831259 19:19548201-19548223 CTAGGGAAGGGGACAGGGCTGGG - Intergenic
1163992157 19:21008710-21008732 CAAGACAAGGGGGCAGGGTAAGG - Intergenic
1164442214 19:28287870-28287892 AGAGAGAAGGGGACTGGGAAGGG + Intergenic
1164839607 19:31382546-31382568 TTGGAGAGAGGGACAGGGGATGG + Intergenic
1164853176 19:31501294-31501316 AATGAGAAGGGGACAGGAGAGGG - Intergenic
1164911868 19:32019441-32019463 GGAGAGAAGGGGAGAAGGGAAGG + Intergenic
1164977608 19:32585304-32585326 CTGGTGATGGGGACTGGGGATGG + Intronic
1165209943 19:34226350-34226372 AAAGAGATGGGGACAGGAGAGGG - Intronic
1165428721 19:35759604-35759626 GTAGAGAGGGGGACAAGGGCAGG - Intronic
1165911320 19:39230023-39230045 GGAGAGAAGGGGAAAGGAGAGGG + Intergenic
1166239247 19:41478580-41478602 AAAGAGGCGGGGACAGGGGATGG + Intergenic
1166241892 19:41500092-41500114 AGAGAGGCGGGGACAGGGGATGG + Intergenic
1166259198 19:41626269-41626291 CTAGAGGAGGTGTCAGGGGAGGG - Intronic
1166266440 19:41687495-41687517 CTAGAGAAGGTGTCAGGGAAGGG - Intronic
1166270295 19:41709363-41709385 CTAGAGGAGGTGTCAGGGAAGGG + Intronic
1166281500 19:41797299-41797321 CTAGAGGAGGTGTCAGGGGAGGG + Intronic
1166300691 19:41910534-41910556 GTGGAGCAGGGGACAGGGAATGG - Intronic
1166411906 19:42561101-42561123 CTAGAGGAGGTGTCAGGGGAAGG - Intronic
1166782817 19:45351263-45351285 CTGGAGACAGGCACAGGGGATGG - Exonic
1166881793 19:45934519-45934541 TTAGCGATGGGGACAGGTGAGGG + Exonic
1166963344 19:46513215-46513237 CAAGAGATGGGGACAGGGCTTGG + Intronic
1167239640 19:48335918-48335940 AAAGAGAAGAGGAGAGGGGAAGG + Intronic
1167329000 19:48842722-48842744 CAAGAGAAAGGGACTGGAGAAGG - Intronic
1167440691 19:49507049-49507071 GAAGAGAAGAGGAGAGGGGAAGG - Intronic
1167477633 19:49710142-49710164 CTAAAGATGGGGATAGGGGCTGG - Intronic
1167486530 19:49766487-49766509 GTAGAGAAGGAAAGAGGGGAGGG - Intergenic
1167705968 19:51081499-51081521 CTAGGTACAGGGACAGGGGAGGG + Intronic
1167895613 19:52578410-52578432 CAAGACAAGGGGGCAGGGTAAGG - Intronic
1167927711 19:52834918-52834940 CAAGACAAGGGGGCAGGGTAAGG + Intronic
1168304553 19:55428554-55428576 CTAGCTGAGGGGTCAGGGGATGG - Intergenic
1168562169 19:57393664-57393686 ATAGAGGAGAGGAGAGGGGAGGG + Intronic
1168726413 19:58584963-58584985 CAAGACAAGGGGGCAGGGTAAGG - Intergenic
925710177 2:6731493-6731515 CTAGGGAAGGCCACAGGTGAAGG + Intergenic
926435549 2:12834080-12834102 CTACAGAATGGGACAGGGCAGGG + Intergenic
926631545 2:15141144-15141166 AAAGAGAAGGGAAAAGGGGATGG - Intergenic
927100434 2:19783795-19783817 GTAGTGATGGGGACAAGGGAAGG - Intergenic
927652019 2:24919012-24919034 CTAGAGAAGTGGACTGGGAACGG + Exonic
927693053 2:25221927-25221949 CTAGAGAAGAGGAAAGGGAAAGG + Intergenic
927731739 2:25479371-25479393 CTAGGAAATTGGACAGGGGAGGG + Intronic
927900761 2:26816731-26816753 ATAGGGGAGGGGACAGAGGATGG + Intergenic
928140712 2:28726639-28726661 ATAGGGATGGGGACAGGGGTGGG - Intergenic
928649069 2:33386047-33386069 CTAGGGAAGCGGGCAGTGGAGGG - Intronic
929139792 2:38656805-38656827 ATAAGAAAGGGGACAGGGGAGGG - Intergenic
929175001 2:38967300-38967322 CTGGAGAAGGGGGAAGAGGAAGG + Intronic
929605374 2:43230553-43230575 CCAGAAAAGGGGAGAGGGGAGGG + Intergenic
929783987 2:44976016-44976038 CTACTGAAGGGGACTGGAGAAGG - Intergenic
930314993 2:49786580-49786602 CTAGAGAAAGGTTGAGGGGAGGG - Intergenic
931085271 2:58823225-58823247 CAAGACAAGGGGGCAGGGTAAGG - Intergenic
931116700 2:59173562-59173584 CAAGACAAGGGGACAGGGTAAGG - Intergenic
931309827 2:61066833-61066855 CAAGAGAAGGGGGTCGGGGAGGG + Intronic
931668483 2:64626646-64626668 CTGGAGGAGGTGGCAGGGGAGGG - Intergenic
931966128 2:67536779-67536801 CACGAGAACGGAACAGGGGATGG - Intergenic
931994180 2:67824015-67824037 CTAGAGGAGTGGAGAGGAGAGGG - Intergenic
932040531 2:68294529-68294551 CTACAGAAGGGGAATGGCGAAGG + Intronic
932434239 2:71693923-71693945 CTGGAAAATGGGACAGGGCAGGG + Intergenic
932571574 2:72941120-72941142 GGAGAGAAAGGGAGAGGGGAGGG - Intergenic
932849789 2:75173162-75173184 CCAGGTAAGGGGTCAGGGGATGG + Intronic
932921648 2:75921541-75921563 CTGGGGAAGGGAAAAGGGGAGGG + Intergenic
932924317 2:75954305-75954327 GTAGAGAAGAGGGAAGGGGAGGG - Intergenic
933091632 2:78126540-78126562 ATAGAGAAGGCCACAAGGGAAGG - Intergenic
933166743 2:79085062-79085084 CTAGAGACTGAGACAGGTGAAGG + Exonic
933296565 2:80497746-80497768 GTGGAGAAGGTCACAGGGGAAGG + Intronic
933818860 2:86091470-86091492 ATACACAAGGGGACAGGGAAAGG + Intronic
933833917 2:86231121-86231143 CCAGAGAAGGGGACTGTGCAGGG - Intronic
934307375 2:91838659-91838681 CCAGAGAAGGGCAGAGGGAAAGG + Intergenic
934325882 2:92014054-92014076 CCAGAGAAGGGCAGAGGGAAAGG - Intergenic
934621128 2:95807859-95807881 CTAAAGAAGGGGCCAGTGAATGG - Intergenic
934812318 2:97290960-97290982 CTAAAGAAGGGGCCAGTGAATGG + Intergenic
934825376 2:97416963-97416985 CTAAAGAAGGGGCCAGTGAATGG - Intergenic
935277057 2:101484181-101484203 CTAGGGAAGGAGAAGGGGGAAGG - Intergenic
936028824 2:109054817-109054839 CTGGAGAGGGGGCCAGGGCAGGG - Intergenic
936060613 2:109293464-109293486 AGAGAGAAGGGGGCAGGGTAGGG - Intronic
936168400 2:110145042-110145064 CTAGAGAAGGCGGCATGGGGAGG - Intronic
936933267 2:117812270-117812292 CTTGGGAAGGGGTCTGGGGATGG - Intergenic
937457372 2:122054223-122054245 CTAGAGGAGGCGAAAGGAGAAGG - Intergenic
937867346 2:126762561-126762583 CTAGAGGTGGGGTTAGGGGAGGG - Intergenic
938122635 2:128644731-128644753 GTAGAGAGGGAGAAAGGGGAAGG - Intergenic
938657341 2:133447626-133447648 GAAGAGAAGGGGGAAGGGGAAGG - Intronic
939026052 2:137014911-137014933 GTAGGGAAGGACACAGGGGAGGG - Intronic
939069241 2:137518949-137518971 CTGGAAAAGGGGAAAGGGGCTGG + Intronic
939382615 2:141455556-141455578 ATGGAGATGGGGACAGGGGTAGG + Intronic
940864487 2:158804475-158804497 CCAGAGAAGGGGGCAGGAGGGGG + Intronic
941126166 2:161586056-161586078 CTAGAGTAGGGAGCGGGGGAGGG - Intronic
941699723 2:168591840-168591862 TTAGAGAAGGGGACTGTGGAGGG + Intronic
942086722 2:172450662-172450684 ATAGAGAAGGGGGCCGGGCATGG + Intronic
942787805 2:179720387-179720409 AGAGAGCAGGGGAGAGGGGAGGG + Intronic
942787823 2:179720432-179720454 GGAGAGCAGGGGAGAGGGGAGGG + Intronic
943233788 2:185291727-185291749 CAAGACAAGGGGGCAGGGTAAGG - Intergenic
943266490 2:185738841-185738863 CTAGAGAAGGAGAGCGGGGCGGG + Exonic
943388394 2:187230628-187230650 CTAGATAAGAGGAAAGAGGAAGG + Intergenic
944465204 2:199993724-199993746 GTAGAGAAGGGGACTGGGGGTGG + Intronic
944976732 2:205062026-205062048 TTAGAGAAGCGTACAAGGGAAGG - Intronic
946021916 2:216646213-216646235 ATGGAGAAGAGGACAGTGGAAGG + Intronic
946105668 2:217367559-217367581 CTACAGCTGGGGAAAGGGGAAGG - Intronic
946306159 2:218858218-218858240 CTAAAGAAGGGGAAGGGGGCAGG - Intergenic
946488676 2:220126278-220126300 CCAGGGAAGGGGAAAAGGGAAGG + Intergenic
946531797 2:220578320-220578342 CTTGAGAAAGGGAAAGGAGATGG + Intergenic
946587040 2:221201316-221201338 GTAGAGCAGGGAACAGGAGATGG + Intergenic
947710310 2:232309882-232309904 CTTGAGGAGGGGACAGAGCAGGG + Intronic
947974393 2:234352515-234352537 CAAGACAAGGGGACAGGGTAAGG - Intergenic
948086332 2:235252433-235252455 CAAGGGAAAGGGACAGGAGAAGG + Intergenic
948813161 2:240495616-240495638 CAAGACAAGGGGGCAGGGTAAGG - Intronic
948996476 2:241582622-241582644 CAAGTCAAGGGCACAGGGGAGGG + Intergenic
949027288 2:241772236-241772258 CAAGACAAGGGGGCAGGGTAAGG + Intergenic
1168736636 20:145698-145720 CTAGAGCAGGAGACAGAGGCTGG - Exonic
1169355157 20:4899291-4899313 CTTGCCAAGGGGGCAGGGGAAGG + Intronic
1169607137 20:7334398-7334420 ATACAGAAGGGAACTGGGGAAGG + Intergenic
1169768184 20:9171954-9171976 CTTGACAAGTTGACAGGGGAAGG - Intronic
1169798552 20:9492487-9492509 CTAGAGTAGAGAAGAGGGGAGGG + Intergenic
1169834756 20:9865770-9865792 CTAGACAAGGGGTCATGGGAGGG + Intergenic
1170057180 20:12219293-12219315 CTAGAGTTGGGGATGGGGGAAGG + Intergenic
1170243044 20:14191571-14191593 ATAGAGAAGGGTAGAGGAGAGGG + Intronic
1171217607 20:23363158-23363180 CTGGAGAAGGGGAGAGGGGTGGG + Intronic
1171284543 20:23926276-23926298 CTAGTGAAGAGGACAGGGAGAGG + Intergenic
1171334939 20:24375624-24375646 CTAGAGCTGGGTACAGGTGAAGG + Intergenic
1171796845 20:29573073-29573095 CCAGAGAGGGGCACTGGGGATGG - Intergenic
1171851403 20:30311090-30311112 CCAGAGAGGGGCACTGGGGATGG + Intergenic
1172352768 20:34256245-34256267 CAAGACAAGGGGGCAGGGTAAGG - Intronic
1172438305 20:34946111-34946133 AGAGAGAATGGGACAGGGGTAGG + Intronic
1172474684 20:35227375-35227397 CTGGAGAAGGGGGAGGGGGAGGG + Intronic
1172659227 20:36556014-36556036 CTAGAGAATGGGGCAAGGTAAGG + Intergenic
1172670233 20:36630070-36630092 CCAGAGAATGGGCCAGGGGAGGG + Intronic
1173019859 20:39258058-39258080 ATAGGAAAGGGGAGAGGGGAGGG - Intergenic
1173215044 20:41073274-41073296 AAAGAGAACGGGTCAGGGGAAGG + Intronic
1173550641 20:43930984-43931006 CTAGTGAAGGGGATAGAGGAGGG - Intronic
1173554538 20:43956221-43956243 CTAGGGAAGGGGACAGGACCAGG - Intronic
1173596049 20:44258939-44258961 CAAGAGTAGGGGACAGGGGAGGG - Intronic
1173851173 20:46219239-46219261 GTAGAGAAGGGGTCAGGAGGGGG - Intronic
1174130738 20:48341841-48341863 GGAGAGGAAGGGACAGGGGATGG - Intergenic
1174141184 20:48415017-48415039 AAAGAGAAGGGCCCAGGGGATGG + Intergenic
1174436640 20:50511330-50511352 TTAGAGAAGGGGATCAGGGAAGG + Intronic
1174476022 20:50795990-50796012 CTTGGGATGGGGATAGGGGACGG + Intronic
1174490184 20:50887429-50887451 CAAGAGGAGGGGACGCGGGAAGG - Intergenic
1174599797 20:51715033-51715055 CTTTAAAAGGGGATAGGGGAAGG - Intronic
1174736954 20:52973469-52973491 CCAGAGAAGGCGAGAGAGGACGG - Intronic
1174839987 20:53892712-53892734 AAAGAGAAGGGGAAAGGGAAAGG - Intergenic
1174932874 20:54834451-54834473 CTGGAGAAGGGGAAAGGAGGAGG + Intergenic
1175221931 20:57422198-57422220 CAGGAGCAGGGAACAGGGGAGGG - Intergenic
1175503632 20:59467188-59467210 CCAGGGAAGGGGAATGGGGAGGG + Intergenic
1175614703 20:60387407-60387429 CTAGAGACTGGGAAGGGGGAAGG + Intergenic
1175674050 20:60931755-60931777 GACGAGAAGGGGGCAGGGGAGGG - Intergenic
1175724019 20:61304615-61304637 CTAGAGAAAAGGACAGCAGAAGG + Intronic
1175912681 20:62412304-62412326 TGAGAGAAGGAGCCAGGGGATGG - Intronic
1176045836 20:63092167-63092189 CTGGAGAAGGGGACCAGGGGCGG + Intergenic
1176595291 21:8687841-8687863 CCAGAGAAGGGCAGAGGGAAAGG - Intergenic
1176675710 21:9775424-9775446 GTAGAGATGCGGGCAGGGGATGG - Intergenic
1177317991 21:19485420-19485442 CTTGCTAAGGGGAAAGGGGAAGG - Intergenic
1177815292 21:25969893-25969915 TTAGAGAAGAGAAGAGGGGAGGG + Intronic
1178133960 21:29605210-29605232 TCAGAGATGCGGACAGGGGAGGG - Intronic
1178517165 21:33257809-33257831 CTGGAAAAGGGGACATGGGCAGG + Intronic
1178929216 21:36803035-36803057 CTAGTTAAGGGGACAGGGTTAGG - Intronic
1178931674 21:36824437-36824459 TCAGAGAAGGGAAAAGGGGAGGG + Intronic
1179275943 21:39891669-39891691 CAAGACAAGGGGGCAGGGTAAGG + Intronic
1179554142 21:42162029-42162051 CCAGAGAAGGGGAGCAGGGAGGG + Intergenic
1179970281 21:44833106-44833128 CAAGACAAGGGGGCAGGGTAAGG - Intergenic
1180112039 21:45663272-45663294 CAAGACAAGGGGGCAGGGTAAGG - Intronic
1180144999 21:45913928-45913950 CTAGGAAAAGGGACAGGAGAGGG - Intronic
1180246943 21:46554751-46554773 CCAGAAAAGGGGGCAGCGGAGGG - Intronic
1180278146 22:10664995-10665017 CCAGAGAAGGGCAGAGGGAAAGG - Intergenic
1180585395 22:16883848-16883870 CCAGAGAAGGGCAGAGGGAAAGG - Intergenic
1180800258 22:18628444-18628466 CTAGGGAAGGGGCCAGGGAGGGG - Intergenic
1180851490 22:19024008-19024030 CTAGGGAAGGGGCCAGGGAGGGG - Intergenic
1180992754 22:19947444-19947466 CAAGACAAGGGGGCAGGGTAAGG + Intronic
1181140019 22:20797484-20797506 GCAGAGAATGGGACAGAGGAAGG + Intronic
1181221458 22:21366822-21366844 CTAGGGAAGGGGCCAGGGAGGGG + Intergenic
1181321090 22:22006888-22006910 CTAGAGAAAAGGAGAGGGAATGG + Intergenic
1181841822 22:25669832-25669854 CCAGAGCTGGTGACAGGGGATGG - Intronic
1181997422 22:26893713-26893735 ACAGAGAAGAGGAGAGGGGAAGG + Intergenic
1182321803 22:29482504-29482526 GTGGAGAAAGGGACAGGGGTTGG + Intronic
1182756808 22:32687023-32687045 CTATAGGAGGGGAGAGGTGATGG - Intronic
1183080028 22:35450417-35450439 AGAGGGAAAGGGACAGGGGAGGG - Intergenic
1184073745 22:42163089-42163111 CTCAAGGAGGGGACAGGGCAGGG + Intronic
1184197341 22:42938792-42938814 CAAGAGAAGACGACAAGGGAAGG + Intronic
1184221603 22:43104107-43104129 CAAGGCAAGGGGGCAGGGGAAGG + Intergenic
1184255125 22:43282093-43282115 GTTGAGAAGGGCACCGGGGACGG + Intronic
1184369297 22:44072375-44072397 CAAGGGAAGGGGACTGGAGAAGG + Intronic
1184561858 22:45268396-45268418 CTGGAGGAGGGGACAGAGGGAGG - Intergenic
1184648953 22:45910919-45910941 CTGGAGCAGGGGACAGAAGAGGG - Intergenic
1184652603 22:45925975-45925997 CGGGAGACAGGGACAGGGGAGGG - Intronic
1184681934 22:46077062-46077084 TCAGAGAAGGGACCAGGGGATGG - Intronic
1184742682 22:46438186-46438208 CCAGAGAAGGGGGCCGGGGAAGG + Intronic
1184753445 22:46502404-46502426 AGAGGGAAGGGGAAAGGGGAGGG + Intronic
1184753463 22:46502455-46502477 AGAGGGAAGGGGAAAGGGGAGGG + Intronic
1185386573 22:50534615-50534637 CAAGACAAGGGGACAGGGTAAGG - Intergenic
950198274 3:11025215-11025237 AAATAGGAGGGGACAGGGGAAGG + Intronic
950698955 3:14726878-14726900 CTGGAGAGGGGCAAAGGGGAGGG - Intronic
950991479 3:17442863-17442885 GAAGAGAAGGGGAGAGGAGAGGG + Intronic
951303910 3:21034452-21034474 CTAGACAAGGGAACGAGGGAGGG - Intergenic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
952423083 3:33148732-33148754 CTAGCAAAGGGGACCTGGGAGGG + Intergenic
952708259 3:36401888-36401910 AAAGGGAAGGGGAAAGGGGATGG + Intronic
952729807 3:36626838-36626860 CTACAGGAGGGGCCAGAGGAAGG + Intergenic
953429203 3:42823274-42823296 CTAGGCAAGGTGGCAGGGGAGGG - Intronic
953449456 3:42994264-42994286 CTAGAGAAGGGGCCCTGGGAGGG + Intronic
953536326 3:43779614-43779636 CAAGAGAAGAGGACAGAGAAGGG - Intergenic
953691254 3:45121669-45121691 CTAGAGATGGGGAGAGGGAATGG + Intronic
953900114 3:46835209-46835231 CTAGGCAAGGGGGCAGGGTAAGG + Intergenic
953956693 3:47236854-47236876 CAAGAGCAGAGGGCAGGGGAAGG + Intronic
954013363 3:47663169-47663191 GGAGAGGAGGGGAGAGGGGAGGG + Intronic
954036625 3:47854388-47854410 GGAGAGGATGGGACAGGGGACGG + Intronic
954106424 3:48412075-48412097 CTGGGGAAGGGGACAGGACATGG + Intronic
954124155 3:48518870-48518892 CCAGGGAAGGGGAGAGGGGGCGG + Exonic
954672651 3:52299030-52299052 AGAGAGAAGAGGAGAGGGGAGGG + Intergenic
955104866 3:55888321-55888343 CTTGAGAGTGGGAAAGGGGAAGG - Intronic
955718864 3:61860953-61860975 ACAGAGATGGGGACAGGGAAGGG - Intronic
956779442 3:72592606-72592628 TGAGAGAAGGGAGCAGGGGATGG + Intergenic
956912120 3:73828826-73828848 CTTGGGAAGGGGACATGGGAAGG + Intergenic
956939918 3:74146651-74146673 ATGGAGAAGGGGACAGAGAAGGG - Intergenic
957036573 3:75298750-75298772 CTAGAGATGAGGACAGGGCAGGG + Intergenic
957089364 3:75713853-75713875 CAAGACAAGGGGGCAGGGTAAGG + Intronic
957265955 3:77966111-77966133 CTGGAGTAGGGGGAAGGGGAAGG + Intergenic
957668512 3:83268924-83268946 CTAGAGGAGGGAAGAAGGGAGGG - Intergenic
958981056 3:100720494-100720516 CTATGGAAGGGGGCAGGAGAAGG + Intronic
959856184 3:111161686-111161708 ATGGAGCAGGGTACAGGGGATGG - Intronic
960660626 3:120054225-120054247 CTAGGGAAGGAGAGAGAGGAGGG - Intronic
961067168 3:123885004-123885026 TTAAAAAAGGGGAAAGGGGAGGG + Intergenic
961073654 3:123961564-123961586 CCAGAGGATGGGACAGGGGTAGG + Intergenic
961080305 3:124021207-124021229 CTAGAGATGAGGACAGGGCAAGG + Intergenic
961126706 3:124425117-124425139 ATAGAGAAGGGTAGAGGGGAGGG + Intronic
961155701 3:124677838-124677860 CTTGAGAAGGGCACGGTGGATGG - Intronic
961599204 3:128046096-128046118 CTTGAGAAGGAGAAAGGGGAGGG - Intergenic
961825561 3:129597408-129597430 CTGGAGAAGGGCACAGGCAAGGG + Intronic
962188971 3:133290185-133290207 CTAGACAAGGTGACCAGGGAAGG + Intronic
962522051 3:136206513-136206535 ATAAAGGAGGGGACAGAGGAAGG - Intergenic
962838083 3:139206331-139206353 CCAGAGCAGGTGACAGGAGATGG - Intronic
963821414 3:149899044-149899066 CTAGAGTAGTGAACAAGGGAGGG + Intronic
964744294 3:159997837-159997859 CAAGAGAAGGAGATAGGTGATGG - Intergenic
964846473 3:161049616-161049638 CTGTAGAATGGGATAGGGGATGG + Intronic
965368686 3:167832723-167832745 CCAGATAAGGGGACAGGGTAAGG - Intergenic
965434710 3:168635422-168635444 TTAAAGAAGGGGACAGGTGTTGG - Intergenic
965602788 3:170471387-170471409 GTAGAGAAGGGGTCAGGGGAGGG - Intronic
965607649 3:170512568-170512590 GTAGAAAAGGGGAGAGGAGAAGG - Intronic
965638788 3:170811517-170811539 GTAGGGAAGAGGATAGGGGATGG + Intronic
965908338 3:173739172-173739194 CTAGAGAATGGGACGTGTGAAGG + Intronic
966233527 3:177674713-177674735 GTAGAGAGAGGGAGAGGGGAAGG - Intergenic
967019230 3:185507973-185507995 CTTCACATGGGGACAGGGGATGG - Exonic
967151923 3:186658780-186658802 GCAGAGAAGGGGTCAGGGCACGG - Intergenic
967254225 3:187573290-187573312 CTAGAGAAGGGATCACTGGAAGG - Intergenic
967328484 3:188266501-188266523 GAAGAGAAGAGGAGAGGGGAGGG + Intronic
968091615 3:195901554-195901576 CTAAGGAAGGTGAGAGGGGAGGG - Intronic
968846853 4:3048014-3048036 CAAGACAAGGGGGCAGGGTAAGG - Intergenic
968880154 4:3294381-3294403 CTAGAGAAGGCGACGTGGGGAGG + Intronic
969045685 4:4334923-4334945 CAAGACAAGGGGGCAGGGTAAGG + Intergenic
969538897 4:7773702-7773724 CCAGAGAATGGGACGGGGCATGG - Intronic
970354239 4:15236407-15236429 CGTGAGAAGGGGAAAGGGGCTGG + Intergenic
970992015 4:22223549-22223571 TTAGAGAGGGAGACCGGGGAAGG - Intergenic
971162190 4:24144695-24144717 ATAGAAAAGGGGAAAGTGGAGGG - Intergenic
971363213 4:25955447-25955469 CTAGGGAAGGGGCCAGAGGCAGG - Intergenic
971451239 4:26803907-26803929 AAAGAGAAGGGGACGGGGGAGGG + Intergenic
971636645 4:29068717-29068739 AGGGAGAAGGGGAAAGGGGAGGG - Intergenic
972234881 4:37120319-37120341 ATAGGGAAGGGGACATGGGTGGG - Intergenic
972427675 4:38949685-38949707 CCAGAGAAGGGGAAGGGAGAAGG - Intergenic
972739901 4:41879228-41879250 CTAGGGAAGGGGATAGAGGGAGG + Intergenic
975617102 4:76257455-76257477 AGAGAGAAGGGGACACTGGAAGG - Intronic
975785986 4:77888853-77888875 TTGGAGTAGGGGACGGGGGAGGG - Intronic
976165606 4:82251543-82251565 CTAGGGATGGGGGCAGAGGATGG + Intergenic
976221802 4:82762171-82762193 CAAAAGAAGAGGAGAGGGGAGGG + Intronic
976259035 4:83128430-83128452 GAAGAGAAAGGGAAAGGGGAAGG - Intronic
978233095 4:106424386-106424408 GCAGAGAAGGGGACAGAAGAGGG - Intergenic
978245580 4:106568574-106568596 TTGGAGTAGGGGGCAGGGGAGGG - Intergenic
978360631 4:107927903-107927925 CAAAAGAGGGGGGCAGGGGAAGG - Intergenic
978413918 4:108455559-108455581 ACAGAGAAGAGGACTGGGGATGG - Intergenic
978738677 4:112113291-112113313 CTACATCAGGGGATAGGGGAAGG + Intergenic
978847294 4:113288816-113288838 GAGGAGAAGGGGTCAGGGGAGGG - Intronic
979295685 4:119030654-119030676 CTGGAGAAGGCGTCAGGGGGAGG - Exonic
979403966 4:120286123-120286145 CTAGAGATGGTGGCAGGTGAGGG - Intergenic
979441978 4:120760955-120760977 CTGGAGAAGTGGGCAGGTGAAGG + Intronic
979826215 4:125236156-125236178 TCAGAGAAGGGGCCAGTGGAGGG - Intergenic
980816836 4:137958783-137958805 GGAGAGAAGGAGACAGGTGATGG - Intergenic
980882329 4:138724558-138724580 ATAGAGAAGGGGAAAGAGGCAGG - Intergenic
981023038 4:140048790-140048812 CTAGGGAATGGGGCAAGGGAAGG - Intronic
981175038 4:141671880-141671902 CTGGAGAAGGGTGCATGGGATGG + Intronic
981308926 4:143276843-143276865 CTAAAGAAGGGTAGAGGGGGAGG - Intergenic
981419452 4:144532669-144532691 CTAAAAATGGGGACAGGTGAAGG + Intergenic
981695004 4:147551139-147551161 CCAGAGAAGGTGAGAGGGGGAGG + Intergenic
982099441 4:151953742-151953764 ATAGAGAAGGGGTGTGGGGAAGG - Intergenic
982422112 4:155209686-155209708 CTAGGAATGGGGGCAGGGGAGGG - Intronic
983210584 4:164954017-164954039 TTGGTGAAGGGGACAGGGGTAGG - Intergenic
983351255 4:166592973-166592995 CCAGAGAAGAGGCCAGTGGATGG + Intergenic
983700099 4:170581403-170581425 CCACAGAAGGGGCCAGGGGTAGG + Intergenic
984183074 4:176508929-176508951 GCAGAGAAGGGGACAGGGCAGGG + Intergenic
984190218 4:176596614-176596636 CTGGAGAGAGGGATAGGGGAAGG - Intergenic
984251696 4:177343512-177343534 GTAGAGCTGGGGGCAGGGGAGGG + Intronic
985309802 4:188585535-188585557 CTTAAGAAGAGGAGAGGGGAGGG + Intergenic
985326980 4:188781959-188781981 CTAGAGGAGGGGGCTGGAGAAGG - Intergenic
985399830 4:189583264-189583286 GTAGAGATGGGGGCAGGGGATGG + Intergenic
985939921 5:3127156-3127178 CTAGAGCTGGGGACAGCGGCAGG - Intergenic
988206679 5:28145391-28145413 CCAGAAAAGGGGACATGAGAGGG - Intergenic
988706208 5:33728279-33728301 CGAGAGAAGTGGAAAGGGGGAGG + Intronic
988996340 5:36718304-36718326 CTGGAGTAGGGGACTGGGAAGGG - Intergenic
990805278 5:59653872-59653894 AGAGAGAAGGGGAGAGGAGAAGG + Intronic
990907380 5:60819008-60819030 GAAGAGAAGAGGAGAGGGGAGGG + Intronic
991253222 5:64586438-64586460 CAAGTGAAAGGGACAGGGGTAGG - Intronic
992502886 5:77359134-77359156 CGGGAGGAGGGGACAGGGGTGGG + Intronic
992658629 5:78935942-78935964 GGAGAGAAGGGGGGAGGGGAGGG - Intronic
993144669 5:84078969-84078991 CTAGAGGACGGGGCAGGGGTGGG - Intronic
994801566 5:104383705-104383727 CTAGACAGGGGAACGGGGGAGGG - Intergenic
995342545 5:111075372-111075394 CTAGACAATGGGGCAGGGGAGGG + Intronic
996464478 5:123783416-123783438 CTTGGGAAGGTGAAAGGGGAGGG + Intergenic
996629701 5:125612682-125612704 CTAGAGAACAGGAAAGAGGAAGG + Intergenic
996631904 5:125643025-125643047 CTGGAGGAGGTGGCAGGGGAGGG - Intergenic
996798355 5:127375627-127375649 CTAGAGCAGGGAAGAGGGGAGGG - Intronic
997064698 5:130547229-130547251 TTAGGGAAGGCAACAGGGGAGGG - Intergenic
997423655 5:133788168-133788190 CTGGAGAAGGGGACGTGAGATGG + Intergenic
997645143 5:135477029-135477051 CAAGAGAAGGAGAGAGGGGAGGG - Intergenic
997669828 5:135661608-135661630 CTTGAGAAAAGGACCGGGGAGGG - Intergenic
997696159 5:135862694-135862716 TTAGAGATGGGGACATGGGATGG + Intronic
997889826 5:137665851-137665873 AAAGGGAAGGGGAAAGGGGAAGG + Intronic
998365715 5:141629469-141629491 CTAGAGGCAGGGACAGGAGAGGG + Intronic
999287396 5:150402349-150402371 CCTGAGCAGGGGGCAGGGGAGGG - Intronic
999382191 5:151129178-151129200 CTACAGAAGGAGGCAGGGGCTGG - Intronic
999991916 5:157057822-157057844 CCAGAGAATGGGGTAGGGGAAGG - Intronic
1000015562 5:157272673-157272695 TGAGAGACGGGGGCAGGGGAGGG - Intronic
1000113862 5:158135190-158135212 ATAGGGAAGGAGAGAGGGGATGG + Intergenic
1000444172 5:161299605-161299627 AAAGAGGAAGGGACAGGGGAAGG - Intronic
1000828455 5:166074824-166074846 GAAGAGAAGAGGAGAGGGGAGGG - Intergenic
1000909791 5:167008037-167008059 GTAGAGAAGAGGAACGGGGAAGG - Intergenic
1001073328 5:168605549-168605571 TGAGAGAAGGGGATAGGGCAGGG + Intergenic
1001107955 5:168871458-168871480 CAAGAGGAAGGGACAGGGCAGGG + Intronic
1001559128 5:172658078-172658100 CAAGACAAGGGGGCAGGGTAAGG - Intronic
1001683372 5:173575256-173575278 CTAGTGCAAGGGACAGGAGAGGG + Intergenic
1001835151 5:174825293-174825315 CTAGAGAATGGGAAAGGACATGG - Intergenic
1002650969 5:180693368-180693390 ATAGTGAAGGGGCCAGCGGACGG + Intergenic
1002739208 5:181422273-181422295 CTAGAGAAAAGGACAGTGAATGG - Intergenic
1002845733 6:942800-942822 CAAGACCAAGGGACAGGGGATGG - Intergenic
1003326222 6:5093367-5093389 CTAGAGCATGTGACAGTGGAGGG + Intergenic
1003517799 6:6832339-6832361 CCACAGAAGGGCACATGGGAAGG + Intergenic
1003982781 6:11405075-11405097 ATGGGGAAGGGGATAGGGGAAGG + Intergenic
1004030196 6:11860726-11860748 CTGTAGAGGGGGACAGGGGCAGG - Intergenic
1004710250 6:18162953-18162975 CTGGAGAAGGGGACCGTGGCAGG + Intronic
1004752788 6:18581006-18581028 TTAGAGCAGGTGTCAGGGGAGGG + Intergenic
1005033129 6:21530025-21530047 CTGCAGAAGGAGACAGGGCAAGG - Intergenic
1005289951 6:24369958-24369980 CTTGAGCAGGGGACTGGGGGAGG + Intergenic
1005354532 6:24969705-24969727 CAAGTGAAGGGGAGAGTGGAGGG - Intronic
1005561076 6:27041368-27041390 AGAGAGAAAGGGAGAGGGGAAGG + Intergenic
1005576493 6:27194621-27194643 CAAGACAAGGGGGCAGGGTAAGG + Intergenic
1005922190 6:30412046-30412068 CAAGACAAGGGGGCAGGGTAAGG - Intergenic
1006368687 6:33631341-33631363 CAAGACAAGGGGGCAGGGTAAGG + Intronic
1006652437 6:35562814-35562836 CTGGAGAAGGAGAAAGGGAAGGG + Intergenic
1006911505 6:37566384-37566406 AGAGAGAAGGGGAGTGGGGAGGG + Intergenic
1006967604 6:38004451-38004473 ATGGAGAGGGGGAGAGGGGAAGG - Intronic
1007125263 6:39420965-39420987 CTAGAGAAGCAGACAGGACATGG + Intronic
1007360396 6:41351407-41351429 TGAGGGAAGGGGACAGTGGAGGG + Intergenic
1007404424 6:41625838-41625860 CAAGAGAGGGGGACAGAGGAAGG - Intergenic
1007551596 6:42733988-42734010 CAAGACAAGGGGGCAGGGTAAGG + Intergenic
1007593492 6:43037663-43037685 CTAGACTTGGGGTCAGGGGAAGG - Exonic
1007701698 6:43769838-43769860 ATATTGAAGGGGGCAGGGGAAGG - Intergenic
1008307242 6:49918234-49918256 GGAGAGGAGAGGACAGGGGAGGG - Intergenic
1009045897 6:58237432-58237454 CTAGAGGAGGGTCCAGAGGAGGG - Intergenic
1009390777 6:63140633-63140655 AAAGAGAAGGGAAGAGGGGAAGG + Intergenic
1009400419 6:63248191-63248213 CTAGGCATTGGGACAGGGGATGG + Intergenic
1009781732 6:68280089-68280111 CTTGAGAAATGGAGAGGGGAGGG + Intergenic
1010373824 6:75142823-75142845 CTAGAGAAGGACACAGAGAAAGG - Intronic
1011268206 6:85548160-85548182 CTGGAGATGGGGAATGGGGATGG + Intronic
1011309306 6:85964441-85964463 GCAGAGAAGGGGACTGGAGAGGG + Intergenic
1011713255 6:90076783-90076805 CCAGAGAAGGGCACGGAGGAAGG - Intronic
1011733525 6:90290766-90290788 CTGCAGAAAGTGACAGGGGAGGG + Intronic
1012382305 6:98634671-98634693 CTAGAGAAGAGAGCAGAGGAGGG + Intergenic
1012873290 6:104696523-104696545 CTGCAGAAGAGGAAAGGGGAAGG + Intergenic
1012953314 6:105541657-105541679 CTAGAGAAAGGTATGGGGGAAGG - Intergenic
1013612863 6:111811560-111811582 CCAGAGAAGGGGATAAGGGTGGG - Intronic
1013765674 6:113571837-113571859 CTAGTGATGGGGGCAGGGGATGG + Intergenic
1013780722 6:113725928-113725950 ATAGAGCAGGGGCCAGGTGAGGG - Intergenic
1014472520 6:121834115-121834137 GTAGAGAAGGTCACAGGAGAAGG - Intergenic
1014987443 6:128029202-128029224 CAAGAGAGGGAGACAGGAGAGGG - Intronic
1015512465 6:134052193-134052215 GGAGAGAAGGGGACAGGGTCTGG - Intronic
1015730429 6:136341313-136341335 GTAGAGATGGGCACGGGGGAGGG + Intergenic
1015835604 6:137417085-137417107 CCACAGAAGGGGACAGCTGAAGG - Intergenic
1016903474 6:149125662-149125684 CTAGAGTGAGGGACAGGGGAAGG + Intergenic
1017041816 6:150314259-150314281 CTGCAGAAGGGGAGAGGGGAGGG + Intergenic
1017553970 6:155543170-155543192 TCAGAGAAGGGGACAGGAGAAGG - Intergenic
1017805222 6:157939949-157939971 CTAGAGTTGGGGGCAGGGGCAGG + Intronic
1017929390 6:158939106-158939128 CCAGAGAAGGCGGCAGGAGAAGG - Intergenic
1018071633 6:160169932-160169954 CTTGAGAAGTGTACAGGGGAGGG + Intergenic
1018318813 6:162584890-162584912 AAAGAGAAGAGGAGAGGGGAGGG - Intronic
1018438486 6:163785621-163785643 ATATAGAAGGGGAAAGGGCATGG + Intergenic
1018839421 6:167507833-167507855 GTAGAAGAGGGAACAGGGGAAGG - Intergenic
1018839520 6:167508079-167508101 GGAGAAGAGGGGACAGGGGAAGG - Intergenic
1018911004 6:168101033-168101055 CTAGGGGAGGGGACAGGGGAAGG + Intergenic
1019081067 6:169430064-169430086 CTGCAGAAGGGCACAGGGCATGG + Intergenic
1019168954 6:170117801-170117823 CTGGAGAAGGGGTCAGGGCCAGG - Intergenic
1019244318 6:170697832-170697854 CTAGAGAAAAGGACAGTGAATGG - Intergenic
1019423177 7:960863-960885 CAAGACAAGGGGGCAGGGTAAGG + Intronic
1019928151 7:4206566-4206588 CTAGAGATGGGGAGAAAGGAAGG + Intronic
1019964085 7:4484702-4484724 AGAGAGAAGGGGAGAGAGGAGGG + Intergenic
1020014884 7:4825105-4825127 CTAGAAGAGGGCAGAGGGGAAGG + Intronic
1020014907 7:4825189-4825211 CTAGAAGAGGGCAGAGGGGAAGG + Intronic
1020083180 7:5297225-5297247 ACAGAGAAGGGGACAGAGAAGGG - Intronic
1020887889 7:13842262-13842284 CCAGAGAAGTGGACTGGGCAGGG - Intergenic
1021144132 7:17064794-17064816 CTATAGAAGGAAGCAGGGGAGGG - Intergenic
1021522680 7:21553149-21553171 TTAGAAAAGGCAACAGGGGAGGG - Intronic
1021581031 7:22153665-22153687 CCAGAGATGCGGGCAGGGGAGGG - Intronic
1021695239 7:23269909-23269931 ACAGAGAAGGGGAGAGAGGAAGG - Intronic
1021974065 7:25994842-25994864 CAAGAGAAGAAGAAAGGGGAAGG + Intergenic
1022088395 7:27090982-27091004 CTAGAGGAGGGGGCAGGAGAAGG + Intergenic
1022301297 7:29105161-29105183 TTAGAGAAGGGGACATGGACTGG - Intronic
1022873885 7:34507904-34507926 GTAGAGAAGGGGAAAGGGGAGGG - Intergenic
1023087505 7:36586083-36586105 CTAGAGAAGGCAAGAAGGGATGG - Intronic
1023153995 7:37229476-37229498 ATAGAGAAGGAGACAGAGGCTGG + Intronic
1023788698 7:43734778-43734800 CAAGACAAGGGGGCAGGGTAAGG + Intergenic
1023913979 7:44574791-44574813 GAAGAGAAGGGGAGGGGGGAGGG - Intronic
1024174040 7:46819974-46819996 CAAGACAAGGGGGCAGGGTAAGG + Intergenic
1024920158 7:54546332-54546354 CGGGAGGAGGGGAGAGGGGAAGG + Intronic
1025041466 7:55649779-55649801 CCTGAGAGGGGGACAGGGAAGGG - Intergenic
1026057840 7:67000224-67000246 TTAGAGAATGGGACTGGGCACGG - Intronic
1026355486 7:69553564-69553586 CTGGAGAAGGGAAGTGGGGAAGG - Intergenic
1026455676 7:70570627-70570649 ACAGAGAAGGGTAAAGGGGAAGG - Intronic
1026720262 7:72824811-72824833 TTAGAGAATGGGACTGGGCACGG + Intronic
1027249356 7:76389502-76389524 CTGGACAAGGGGACTGGGGGAGG - Exonic
1027464960 7:78503671-78503693 GGAGAGGAGAGGACAGGGGAGGG - Intronic
1029229739 7:99056710-99056732 CAAGAGAAGGGGGCCGGGCATGG + Intronic
1029290415 7:99498351-99498373 CTGGAGAAGGATAGAGGGGAAGG + Intronic
1029575785 7:101402426-101402448 CCAGAGAAGGGGAAAGGGGAAGG - Intronic
1030091262 7:105861135-105861157 GCAGAGAAGGGGGCAGGGAAAGG + Intronic
1030379977 7:108800765-108800787 CAGGAGGAGGGGAGAGGGGAAGG - Intergenic
1031581056 7:123475553-123475575 CTAGACATGGGGACTGGGGTAGG + Intronic
1031912485 7:127532730-127532752 AAAGAGAAGGGGAAAGGGAAGGG + Intergenic
1032030137 7:128476558-128476580 CTAGGGAAGGGGACCAGGCAGGG - Intergenic
1032122084 7:129163946-129163968 AAAGAGAAAGGGAGAGGGGAGGG + Intronic
1032188680 7:129750012-129750034 CTAGAGAAGTCCACAGGGCAGGG - Intronic
1032199299 7:129808127-129808149 ATAGAGAAGAGGGAAGGGGAGGG - Intergenic
1032254154 7:130283852-130283874 CTAGAGAAGGAGAAAAAGGATGG + Intronic
1032388948 7:131543424-131543446 AAAGAGCAGGGGACAAGGGATGG - Intronic
1033129698 7:138735288-138735310 GTACAGGTGGGGACAGGGGAAGG - Intronic
1033201122 7:139371125-139371147 CTACAAATGGGGGCAGGGGAAGG - Intronic
1033595138 7:142854127-142854149 CTAGAGAAGGGGTTAGAGGTGGG + Intergenic
1033621311 7:143064207-143064229 CTAGAGAAGGAGACAGACGAGGG - Intergenic
1033803748 7:144930638-144930660 CTAGAGAAGGAAGCAAGGGAGGG - Intergenic
1034189057 7:149199655-149199677 AAAGAGAAGGGGAAAAGGGAGGG - Intronic
1034417017 7:150970607-150970629 CTAGAGAAGGGAAAGGTGGAGGG + Intronic
1034439870 7:151081137-151081159 CTGGTGAAGGGGAGCGGGGAGGG - Exonic
1034558374 7:151864046-151864068 CTAGAGGAGAGGAGAGAGGAGGG + Intronic
1034560328 7:151876086-151876108 CTGGAGACGGAGAGAGGGGAGGG - Intronic
1035156765 7:156920566-156920588 CAAGACAAGGGGGCAGGGTAAGG + Intergenic
1035338386 7:158144625-158144647 CGAGAGAAGGGGAAGGGGAAGGG + Intronic
1035503807 8:110340-110362 CTAGAGAAAAGGACAGTGAATGG + Intergenic
1035998574 8:4576380-4576402 CTGGGGAATGGGACAGGGGAAGG - Intronic
1036148220 8:6274616-6274638 CTTGAGAAGAGAACAGGGGGCGG - Intergenic
1036445995 8:8822384-8822406 ACAGAGATGGGGGCAGGGGATGG + Intronic
1037025250 8:14027807-14027829 CAAGACAAGGGGGCAGGGTAAGG + Intergenic
1037431884 8:18822218-18822240 GTTGAGAAGGGGCCATGGGAAGG + Intronic
1037696494 8:21228540-21228562 CAAGAGAAGGGAACTGGGGAAGG + Intergenic
1037747644 8:21659680-21659702 CTGCAGAAGGAGACAGGGAAGGG - Intergenic
1037753406 8:21696922-21696944 AGAGGGAAGGGGACAGAGGAAGG + Intronic
1037787870 8:21913066-21913088 CCAGGGAAGGGGAAAGAGGATGG + Intronic
1037952607 8:23028693-23028715 CCTGAGAAGGTGTCAGGGGAAGG + Intronic
1037963455 8:23116529-23116551 CCTGAGAAGGTGTCAGGGGAAGG - Intronic
1037974670 8:23200851-23200873 CCTGAGAAGGCGTCAGGGGAAGG + Intronic
1038271750 8:26081309-26081331 CTGGAGGAGGGGACAGGGTCTGG - Intergenic
1038695909 8:29806076-29806098 TCAGGGAAGGGGAGAGGGGATGG - Intergenic
1039130341 8:34256972-34256994 GGAGAGAAGAGGAGAGGGGAGGG - Intergenic
1039476214 8:37840711-37840733 CCAGAGATGGGGAAAGGGAAGGG - Intronic
1040370390 8:46765330-46765352 GGAGAGAGGGGGACAGGAGAAGG - Intergenic
1040453686 8:47574745-47574767 CTTGAGAAGAGGAGAGGGGAGGG + Intronic
1041107759 8:54458764-54458786 CTAGGGAAGGGGTCGAGGGATGG - Intronic
1041433561 8:57811632-57811654 CTGGAGAAGGGCAAAGAGGAAGG + Intergenic
1041909451 8:63072858-63072880 AGAGAGAAGAGGAGAGGGGAGGG + Intronic
1041939857 8:63375024-63375046 GGAGAGCAGAGGACAGGGGAGGG - Intergenic
1042862286 8:73326840-73326862 CAAGAGAGGGGGATAGGGAATGG + Intergenic
1044878997 8:96702766-96702788 TTACAGAAGGAGAAAGGGGAGGG - Intronic
1045231963 8:100314486-100314508 CCAGGGAAGGGGCCAGGGGTAGG - Intronic
1045296007 8:100872159-100872181 CTGGAGAAGGGGGCTGGGGGTGG - Intergenic
1045307311 8:100969381-100969403 CAAGACAAGGGGGCAGGGTAAGG - Intergenic
1045474631 8:102542551-102542573 GAAGAGAAGGGGGAAGGGGAGGG - Intergenic
1045671888 8:104564531-104564553 TGAGAGTAGGGGACAGGGCAGGG + Intronic
1046292361 8:112179801-112179823 CAAGAGAAAGGGAGAGAGGAGGG + Intergenic
1046638929 8:116703712-116703734 CAAGACAAGGGGGCAGGGTAAGG - Intronic
1046915566 8:119674730-119674752 CTAGAGAAGGGGGTGCGGGATGG + Intergenic
1047537346 8:125731957-125731979 CTGGAGACGGAGACGGGGGAGGG + Intergenic
1047702649 8:127465159-127465181 CTAGAGAATAGGACTGGGGGAGG - Intergenic
1048728583 8:137412850-137412872 GCAGAGAAGGGGTCAGGGCATGG + Intergenic
1049013936 8:139906534-139906556 GTAGGGAAGGGCATAGGGGAGGG + Intronic
1049280842 8:141743387-141743409 CTGGAGAAGGGTAATGGGGAAGG + Intergenic
1049397707 8:142409282-142409304 AAAGAGAAGGAGAGAGGGGAAGG + Intergenic
1049635069 8:143683831-143683853 CAAGACAAGGGGCCAGGGTAAGG - Intergenic
1049672265 8:143875207-143875229 CCAGACATGGGGAGAGGGGATGG - Intronic
1049844543 8:144793478-144793500 CGTGAGAAGGAGACAGGAGAGGG + Intergenic
1050729814 9:8696185-8696207 AGAGAGAAGAGGACACGGGATGG + Intronic
1051524768 9:18031602-18031624 CTGGGGAAGGGGAGATGGGAGGG + Intergenic
1051714241 9:19964793-19964815 CTACAGAAGACCACAGGGGAAGG - Intergenic
1051953571 9:22663091-22663113 GCAGAGAAGGGGTCAGGGCATGG + Intergenic
1052579102 9:30331351-30331373 GGAGAGGAGGGGAGAGGGGAGGG + Intergenic
1053694322 9:40621471-40621493 CCAGAGAAGGGCAGAGGGAAAGG - Intergenic
1053789180 9:41674376-41674398 CCAGAGAGGGGCACTGGGGATGG + Intergenic
1053941312 9:43251877-43251899 CCAGAGAAGGGCAGAGGGAAAGG - Intergenic
1054155959 9:61640385-61640407 CCAGAGAGGGGCACTGGGGATGG - Intergenic
1054177461 9:61885729-61885751 CCAGAGAGGGGCACTGGGGATGG + Intergenic
1054270514 9:63018657-63018679 CCAGAGAAGGGCAGAGGGAAAGG + Intergenic
1054305567 9:63420695-63420717 CCAGAGAAGGGCAGAGGGAAAGG - Intergenic
1054404313 9:64744682-64744704 CCAGAGAAGGGCAGAGGGAAAGG - Intergenic
1054437935 9:65230179-65230201 CCAGAGAAGGGCAGAGGGAAAGG - Intergenic
1054475730 9:65571387-65571409 CCAGAGAAGGGCACTGGGGATGG - Intergenic
1054492469 9:65791783-65791805 CCAGAGAAGGGCAGAGGGAAAGG + Intergenic
1054660070 9:67695079-67695101 CCAGAGAGGGGCACTGGGGATGG - Intergenic
1055764858 9:79651559-79651581 CTAGAGAAGAGTACAAGGGCAGG + Intronic
1055912473 9:81368217-81368239 GGAGAGAAGAGGAAAGGGGAGGG + Intergenic
1056085422 9:83144167-83144189 GTAAGGATGGGGACAGGGGAAGG + Intergenic
1056939912 9:90946182-90946204 ATTGAGAAGAGGGCAGGGGAAGG + Intergenic
1057143838 9:92745427-92745449 CTAAGGGTGGGGACAGGGGAGGG + Intronic
1057147601 9:92768648-92768670 CTACACAAGAGGAGAGGGGAAGG - Intergenic
1057972408 9:99570608-99570630 CTAGAGCAGGAAACACGGGATGG + Intergenic
1059081823 9:111258031-111258053 CTTGAGAAGGCTACAGAGGAAGG + Intergenic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059450191 9:114366713-114366735 GAAGAGAAGAGGAGAGGGGAAGG + Intronic
1059683217 9:116606303-116606325 CTAGAGGTGGGGGCAGGGGTAGG + Intronic
1059757280 9:117305245-117305267 CTAGGGAAGGAGTCAGAGGAGGG - Intronic
1059797599 9:117715740-117715762 AGTGAGAAGGGTACAGGGGAGGG - Exonic
1060187915 9:121575106-121575128 CCAGAGAGAGGGACAGGGAAAGG + Intronic
1060544135 9:124450519-124450541 CTGGAGCTGGGAACAGGGGAGGG + Intergenic
1060797829 9:126524642-126524664 CTGGAGACAGGGACAGTGGAGGG - Intergenic
1061055148 9:128218556-128218578 CTCCAGAAGCGGGCAGGGGAAGG - Intronic
1061214480 9:129213195-129213217 CTGGAGAAGAGGTCAAGGGAGGG - Intergenic
1061429735 9:130523560-130523582 CTAGAGAGGCGGGCAGGGCATGG + Intergenic
1061458880 9:130720273-130720295 ATAGAGAAGGGGACAGGGAATGG + Intronic
1061559451 9:131393751-131393773 CAAGAGAAGGGGCCTGGGAAGGG - Intergenic
1061922847 9:133791514-133791536 GGAGGGGAGGGGACAGGGGAGGG - Intronic
1062173830 9:135149752-135149774 CAAGACAAGGGGGCAGGGTAAGG + Intergenic
1062280143 9:135748228-135748250 CTCAAGAAGGGGCCAGGGGCCGG - Intronic
1062569772 9:137179701-137179723 CTGGAGAAGGGGGCAGGGCTGGG + Intronic
1203488237 Un_GL000224v1:78141-78163 CAAGACAAGGGGGCAGGGTAAGG - Intergenic
1203500858 Un_KI270741v1:20037-20059 CAAGACAAGGGGGCAGGGTAAGG - Intergenic
1203604506 Un_KI270748v1:47058-47080 CTAGAGAAAAGGACAGTGAATGG - Intergenic
1185756752 X:2659392-2659414 GAAGGGAAGGGGAGAGGGGAGGG - Intergenic
1185756762 X:2659414-2659436 GAAGGGAAGGGGAGAGGGGAGGG - Intergenic
1185756867 X:2659631-2659653 GAAGGGAAGGGGAGAGGGGAGGG - Intergenic
1185756877 X:2659653-2659675 GAAGGGAAGGGGAGAGGGGAGGG - Intergenic
1185756887 X:2659675-2659697 GAAGGGAAGGGGAGAGGGGAGGG - Intergenic
1185756897 X:2659697-2659719 GAAGGGAAGGGGAGAGGGGAGGG - Intergenic
1185756907 X:2659719-2659741 GGAGGGAAGGGGAGAGGGGAGGG - Intergenic
1185756915 X:2659736-2659758 GGAGGGAAGGGGAGAGGGGAGGG - Intergenic
1185887073 X:3792488-3792510 CAAGAGAAAGGAAGAGGGGAAGG + Intergenic
1186356827 X:8799652-8799674 CCAGGGATGGGGGCAGGGGAGGG - Intronic
1186357154 X:8800767-8800789 CCAGGGATGGGGGCAGGGGAGGG - Intronic
1186650520 X:11555358-11555380 CTGGATAAAGGGACATGGGAGGG + Intronic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1188546945 X:31318157-31318179 ATACAGTAGGGGGCAGGGGAAGG + Intronic
1189068941 X:37844338-37844360 CTGGGGAATGGGACTGGGGATGG - Intronic
1189683443 X:43540011-43540033 AGAGAGAAGGGAAGAGGGGAGGG + Intergenic
1190225102 X:48539424-48539446 CAAGAGAAGGGGGCGGGGAAAGG - Intergenic
1190957342 X:55208495-55208517 CTAGAGCAGGGGAGACGGGGAGG - Intronic
1191833230 X:65437281-65437303 ATAGAGCAGGGGAGTGGGGATGG - Intronic
1192333544 X:70199467-70199489 CAAGGGTAGGGGAGAGGGGAAGG + Intronic
1193248312 X:79257239-79257261 GTAGAAAAGGGAAGAGGGGATGG + Intergenic
1193612418 X:83648863-83648885 GTGGGGTAGGGGACAGGGGAGGG - Intergenic
1195626478 X:107009504-107009526 ATAGTGAAGGGGACAAGGGACGG + Intergenic
1195655297 X:107326811-107326833 ATAGTGAAGGGGACAAGGGACGG + Intergenic
1195676831 X:107513023-107513045 AGGGAGGAGGGGACAGGGGAGGG + Intergenic
1195681619 X:107551303-107551325 CTATTGAAGGGGGCATGGGAGGG + Intronic
1195682605 X:107560125-107560147 CTAGATCAAGGGACAGAGGAAGG - Intronic
1195940504 X:110163758-110163780 GTTGAGTAGGGGAGAGGGGATGG + Intronic
1196198404 X:112858885-112858907 CAAGGGAAGGGGAATGGGGAAGG - Intergenic
1196237455 X:113299798-113299820 AGAGGGGAGGGGACAGGGGATGG - Intergenic
1196237466 X:113299822-113299844 AGAGAGGAGGGGAGAGGGGAGGG - Intergenic
1196654366 X:118201645-118201667 CCAGAGAATGAGGCAGGGGATGG - Intergenic
1196725004 X:118887724-118887746 TTAGGGAAGGCAACAGGGGAGGG + Intergenic
1196754199 X:119143595-119143617 CTGGAGAAGAGGAAAGGGGGAGG - Intronic
1197715245 X:129701757-129701779 CTAGAGACTGGGCCAGGGGTTGG - Intergenic
1197836749 X:130702719-130702741 CTAGAGGAGAGGAAAGGAGACGG - Intronic
1198082424 X:133252372-133252394 GGAGAGAAGAGGAGAGGGGAGGG + Intergenic
1198082438 X:133252409-133252431 GGAGAGAAGAGGAGAGGGGAGGG + Intergenic
1198364245 X:135924761-135924783 CAAGAGAATGGGACGGGGCATGG + Intergenic
1199767519 X:150952129-150952151 CTAGGGCAGGGGGCAGGGGCAGG + Intergenic
1201192131 Y:11453386-11453408 CCAGAGAAGGGCAGAGGGAAAGG - Intergenic
1201473678 Y:14359064-14359086 CTAGAAAAGTGGAAAAGGGATGG + Intergenic
1201900132 Y:19040673-19040695 CTAGAGGAAGGGGAAGGGGAAGG - Intergenic