ID: 1114525323

View in Genome Browser
Species Human (GRCh38)
Location 14:23364490-23364512
Sequence AAGAGAAGACAGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3340
Summary {0: 1, 1: 4, 2: 38, 3: 434, 4: 2863}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114525323 Original CRISPR AAGAGAAGACAGAGGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr