ID: 1114529294

View in Genome Browser
Species Human (GRCh38)
Location 14:23385831-23385853
Sequence CTAAGTGAGCACATCTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 87}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114529294_1114529297 5 Left 1114529294 14:23385831-23385853 CCTGGCTAGATGTGCTCACTTAG 0: 1
1: 0
2: 1
3: 3
4: 87
Right 1114529297 14:23385859-23385881 CTGGCTTTTCTAGATGTCCTGGG 0: 1
1: 0
2: 3
3: 21
4: 312
1114529294_1114529298 21 Left 1114529294 14:23385831-23385853 CCTGGCTAGATGTGCTCACTTAG 0: 1
1: 0
2: 1
3: 3
4: 87
Right 1114529298 14:23385875-23385897 TCCTGGGCTCTGCACTCAGTAGG 0: 1
1: 1
2: 7
3: 49
4: 330
1114529294_1114529296 4 Left 1114529294 14:23385831-23385853 CCTGGCTAGATGTGCTCACTTAG 0: 1
1: 0
2: 1
3: 3
4: 87
Right 1114529296 14:23385858-23385880 TCTGGCTTTTCTAGATGTCCTGG 0: 1
1: 0
2: 3
3: 18
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114529294 Original CRISPR CTAAGTGAGCACATCTAGCC AGG (reversed) Intronic
900880019 1:5374111-5374133 CTGAGTGAGGACAGCCAGCCTGG + Intergenic
901388688 1:8928251-8928273 TAAAGTGAACACTTCTAGCCAGG + Intergenic
902491465 1:16785186-16785208 CTAAGTGACACCTTCTAGCCAGG - Intronic
904586331 1:31583008-31583030 CTAGGTGATCCCATCCAGCCTGG - Intronic
909007569 1:70295158-70295180 GTAAGTGACCACATCAAGTCAGG - Intronic
912131782 1:106612015-106612037 CTAAGTGAGCACATACTGCTGGG + Intergenic
913385525 1:118254305-118254327 CTAAGTGGGGACATTTAGCTGGG + Intergenic
913669451 1:121082248-121082270 CAAAGTGAGCACAGCTGCCCAGG - Intergenic
914021206 1:143869646-143869668 CAAAGTGAGCACAGCTGCCCAGG - Intergenic
914659698 1:149777570-149777592 CAAAGTGAGCACAGCTGCCCAGG - Intergenic
922820601 1:228482811-228482833 CTAAGTGGGGACACCCAGCCAGG - Intergenic
923528980 1:234797356-234797378 CTAAGTGACACCTTCTAGCCAGG + Intergenic
1065009108 10:21405750-21405772 CTAAGTGAAAACAGCTGGCCCGG + Intergenic
1069579866 10:69558727-69558749 CTCAGTGAGAACCTCCAGCCTGG - Intergenic
1070489487 10:76963316-76963338 CTAATTCAGCAGATCTGGCCTGG - Intronic
1078702317 11:13698267-13698289 CCAAGAGAGCAGATCTTGCCTGG - Intronic
1085573841 11:77584778-77584800 TTAAGAAAGCACAGCTAGCCGGG - Intronic
1089681109 11:120119454-120119476 CTCAGTAAGCACGTCCAGCCAGG + Intronic
1094281977 12:28750245-28750267 GTAAGTGATTCCATCTAGCCTGG + Intergenic
1104520604 12:129471281-129471303 CAAAGTGAGCACATGTTGCTGGG - Intronic
1105013422 12:132771300-132771322 CGACATGAGCACATCTGGCCTGG + Exonic
1106728259 13:32509287-32509309 CTGATTGAGCATATCTAACCTGG - Intronic
1114529294 14:23385831-23385853 CTAAGTGAGCACATCTAGCCAGG - Intronic
1115455470 14:33596889-33596911 CTAAATGAGCCCAGCCAGCCTGG - Intronic
1116282709 14:42928960-42928982 CCAAGTGGGCACAGCTAGGCTGG + Intergenic
1117139080 14:52767863-52767885 CTAAATCAGCAATTCTAGCCTGG - Intronic
1124142597 15:27089694-27089716 CGAAGGGAGGACATCTTGCCAGG + Intronic
1126445274 15:48736174-48736196 CTAGGTGAAGGCATCTAGCCTGG - Intronic
1128159323 15:65413165-65413187 CTAAGTGAGCAGATCCTGCTGGG + Intronic
1133421980 16:5653799-5653821 CTAAGAGGGCACATATGGCCTGG - Intergenic
1137412099 16:48237474-48237496 CTAAGTCATCACTTCTTGCCTGG + Intronic
1137430603 16:48415242-48415264 CTAAGATAGCACCTCTAGGCTGG - Intronic
1138390114 16:56664104-56664126 ACAAGTGAGAACATCTGGCCTGG + Intronic
1150952737 17:69821519-69821541 CTGTGTGTGCACACCTAGCCAGG - Intergenic
1154409547 18:14130472-14130494 ATAAGTGAGCAAATCTATACAGG + Intronic
1158559398 18:58500939-58500961 CTAAATGAGCAAATGCAGCCAGG + Intronic
1158837726 18:61348730-61348752 GTAAGAGAGCACAACTAGCATGG + Intronic
1162131476 19:8528696-8528718 CTAAGTGTTCTCATCTGGCCCGG - Intronic
1164417622 19:28059717-28059739 TTAACTGAGTACATCTGGCCTGG + Intergenic
927435074 2:23059740-23059762 CTACCTGAGCACATCTAGTCAGG + Intergenic
930175035 2:48292942-48292964 CCAAGTGACCACTTCTACCCAGG - Intergenic
930746803 2:54892927-54892949 CTAAGTGTCCACATTTATCCTGG - Intronic
931876252 2:66516549-66516571 GTATGTGTGCACTTCTAGCCTGG + Intronic
932658253 2:73628966-73628988 ATCAGTGAGCACAACTGGCCTGG - Intergenic
932664883 2:73689014-73689036 ATCAGTGAGCACAACTGGCCTGG - Intergenic
938092836 2:128444553-128444575 CAAAGAGAGCCCATCTGGCCTGG + Intergenic
939090160 2:137770864-137770886 CAAAATGAGAACATCTAGCCTGG + Intergenic
942728516 2:179037097-179037119 CCAAGTGGGGACATCTGGCCAGG + Intronic
946214229 2:218171435-218171457 CCAAGGGCACACATCTAGCCAGG - Intergenic
1170085250 20:12524367-12524389 CTAAGGGAACACATCTGGCAAGG - Intergenic
1173626944 20:44480084-44480106 GTCAGTGAGCACACATAGCCCGG - Exonic
1176371438 21:6064230-6064252 CTAAGTGAAAACAGCCAGCCTGG - Intergenic
1176863681 21:14029383-14029405 ATAAGTGAGCAAATCTATACAGG - Intergenic
1178570427 21:33730748-33730770 CTAAGATAGCACCTCCAGCCTGG - Intronic
1179752081 21:43474309-43474331 CTAAGTGAAAACAGCCAGCCTGG + Intergenic
1183059668 22:35328394-35328416 CCAAGTGTCCACATATAGCCCGG - Intronic
1183621101 22:38973348-38973370 CTACGTGAGCATATCCAACCCGG + Intronic
1185105127 22:48864442-48864464 CAAAGACAGCACATCCAGCCTGG + Intergenic
952887956 3:38023049-38023071 CTCACTGTGCACAGCTAGCCTGG - Intronic
953076340 3:39573954-39573976 CTGAGTGAGAACTTCTATCCCGG - Intergenic
956555478 3:70517653-70517675 GTAAGTGAGCAACTCTAGCCTGG - Intergenic
966087112 3:176081147-176081169 ATAATTGAGCACATGAAGCCAGG - Intergenic
972974799 4:44620900-44620922 TTAAATGAGCTCATCTAGCAGGG + Intergenic
975826129 4:78321184-78321206 CTAAGTGAGCAAAACTAGTAAGG - Intronic
984229372 4:177075579-177075601 CAAAGTGAGAACTTCTATCCCGG - Intergenic
984356985 4:178673741-178673763 CTTATTGAGCACATTGAGCCTGG + Intergenic
985044983 4:185931514-185931536 CTAAGTGGGAACATCAAGGCCGG + Intronic
985391630 4:189496709-189496731 CCAAGTGCACACATCTAGGCCGG - Intergenic
985944205 5:3163983-3164005 CTGGGTGAGCACATCTGGGCTGG + Intergenic
990772532 5:59265231-59265253 CTAAGGAAGCACAACTAGGCAGG - Intronic
997386686 5:133479159-133479181 GTAAGTGAGCAAATCAAGGCAGG - Intronic
1001651795 5:173321021-173321043 CTAAGTCAGCATCTCTAGGCAGG - Intronic
1003252594 6:4443848-4443870 ATAAGCCACCACATCTAGCCTGG + Intergenic
1005285942 6:24326952-24326974 CAAAGTGAGCCCATCTATCTGGG - Intronic
1008891831 6:56502595-56502617 CAGAGTGAGCACTTCTAACCAGG + Intronic
1009216839 6:60931375-60931397 CTAAGTGAATTCCTCTAGCCTGG - Intergenic
1011065306 6:83319782-83319804 CTAACTGGGCACATGTTGCCAGG - Intronic
1011284242 6:85706491-85706513 CTGAGTGTGCACACCCAGCCAGG + Intergenic
1017469486 6:154725401-154725423 ATAAGTGACCACACCTGGCCTGG - Intergenic
1026200140 7:68207295-68207317 CTAAGTGGGCAGAGCCAGCCTGG + Intergenic
1031358170 7:120814383-120814405 CTGATTGAGCACATCTGGGCTGG + Intronic
1032928328 7:136635949-136635971 CTAATTCAGCACTTCTTGCCAGG + Intergenic
1039242881 8:35575856-35575878 CCAAGTAATCGCATCTAGCCCGG + Intronic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1039828620 8:41195314-41195336 CTGAGGGAGCACATCCAGGCTGG - Intergenic
1040699918 8:50050482-50050504 ACAAGTAAACACATCTAGCCTGG - Intronic
1042760807 8:72269622-72269644 CTAATTGAGTACACCTATCCAGG + Intergenic
1044743385 8:95350071-95350093 CAAAGTGAGCAGATCTAGCCTGG + Intergenic
1055972885 9:81929220-81929242 CTAACTGAGCACATCAAGTGTGG + Intergenic
1055974638 9:81944292-81944314 CTAACTGAGCACATCAAGTGTGG + Intergenic
1196070112 X:111511202-111511224 CTAAGTAGTCATATCTAGCCAGG - Intergenic
1199818639 X:151422937-151422959 TTTAGTGAGCACAGCTACCCTGG + Intergenic