ID: 1114530110

View in Genome Browser
Species Human (GRCh38)
Location 14:23390171-23390193
Sequence GCCCAGCTCGGCCACGCTGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 2, 1: 0, 2: 1, 3: 17, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114530105_1114530110 17 Left 1114530105 14:23390131-23390153 CCAGCTTCTGCTTCACCCGCTGC 0: 3
1: 3
2: 8
3: 155
4: 927
Right 1114530110 14:23390171-23390193 GCCCAGCTCGGCCACGCTGTCGG 0: 2
1: 0
2: 1
3: 17
4: 108
1114530107_1114530110 2 Left 1114530107 14:23390146-23390168 CCCGCTGCAGGTTGTCGATCTGC 0: 2
1: 2
2: 1
3: 5
4: 92
Right 1114530110 14:23390171-23390193 GCCCAGCTCGGCCACGCTGTCGG 0: 2
1: 0
2: 1
3: 17
4: 108
1114530108_1114530110 1 Left 1114530108 14:23390147-23390169 CCGCTGCAGGTTGTCGATCTGCT 0: 2
1: 2
2: 1
3: 6
4: 69
Right 1114530110 14:23390171-23390193 GCCCAGCTCGGCCACGCTGTCGG 0: 2
1: 0
2: 1
3: 17
4: 108
1114530104_1114530110 23 Left 1114530104 14:23390125-23390147 CCTTCTCCAGCTTCTGCTTCACC 0: 3
1: 4
2: 13
3: 94
4: 963
Right 1114530110 14:23390171-23390193 GCCCAGCTCGGCCACGCTGTCGG 0: 2
1: 0
2: 1
3: 17
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114530110 Original CRISPR GCCCAGCTCGGCCACGCTGT CGG Exonic
901057305 1:6454643-6454665 GCCCATCTCGGCCGCCCTGTCGG + Intronic
901502721 1:9663389-9663411 GCCCATCTCTGCACCGCTGTGGG + Intronic
902331203 1:15731987-15732009 GGCCATCTCGGCCTCGCTCTCGG - Exonic
903791201 1:25894280-25894302 GCCCATCTCCACCAGGCTGTTGG + Intronic
906103763 1:43279524-43279546 CCCCAGCTCGGGCACCCTGTGGG + Intergenic
907013289 1:50985808-50985830 GCCCAGCTGGGCAACACAGTGGG - Intergenic
914344586 1:146787761-146787783 GCCCAGCAGGGCTACCCTGTAGG + Intergenic
915128108 1:153679585-153679607 GCCCAGCTACGCCAAGCTGGGGG + Exonic
916749950 1:167714563-167714585 TCCCTGCTCCTCCACGCTGTGGG + Intergenic
923237064 1:232044797-232044819 GCTCAGCTCAGCAAAGCTGTGGG + Intergenic
1065854800 10:29821345-29821367 GCCCAGCTCGGCCCTGCTTCAGG - Intergenic
1066059159 10:31707076-31707098 GCACAGCTCGGTGACGCTGGGGG - Intergenic
1067079649 10:43205817-43205839 GTCCAGCTCTACCACTCTGTGGG + Intronic
1072654359 10:97319833-97319855 GGCGAGCTCGGCCACGCAGTAGG - Exonic
1072706823 10:97687078-97687100 GCCCAGCTCGGCGCTGCGGTGGG - Exonic
1075468842 10:122672756-122672778 GCCAAGATTGGCCAAGCTGTAGG - Intergenic
1091791704 12:3275678-3275700 GCCCAGTTGGGCGATGCTGTGGG + Intronic
1095542358 12:43325340-43325362 CCCCAGCTCTGCCACACTCTAGG - Intergenic
1102206844 12:111096641-111096663 GGCCAGCTCAGCCACGGGGTGGG + Intronic
1102240643 12:111322535-111322557 GACCAGCTCGGCCAGGCAGTGGG + Exonic
1103403378 12:120658468-120658490 TCCCAGCTCCGCCAGGCTGGGGG - Intronic
1104921525 12:132293092-132293114 GGCCGGCTCGGCCCCACTGTGGG - Intronic
1113682032 13:112251225-112251247 GCCCACCAAGGCCACGCTGGGGG + Intergenic
1114530110 14:23390171-23390193 GCCCAGCTCGGCCACGCTGTCGG + Exonic
1114535540 14:23419959-23419981 GCCCAGCTCGGCCACGCTGTCGG + Exonic
1119520568 14:75281394-75281416 GCTCAGCTCACCCACGCTGCTGG + Exonic
1119777415 14:77257690-77257712 GCCCATCTTGGCCAAGCTGGGGG - Exonic
1122120499 14:99550908-99550930 GTCCAGCTCGACCAAGCTGCTGG + Intronic
1123057014 14:105575459-105575481 AGCCAGCCTGGCCACGCTGTTGG - Intergenic
1123630840 15:22258547-22258569 GCCCAGGTCGGCCGGGTTGTTGG - Intergenic
1124477004 15:30044468-30044490 GCCCGCCTCGGCCACGCCGTAGG - Intergenic
1129384529 15:75188632-75188654 CCACTGCTCGGCCAGGCTGTGGG - Intergenic
1132517402 16:372228-372250 GCCCAGCGCTGCCACGAGGTGGG + Exonic
1132844069 16:1992026-1992048 GCGCAGCTCGGGGCCGCTGTCGG - Exonic
1133023338 16:2976537-2976559 GCCCAGCAGGGACAGGCTGTAGG + Intronic
1133203091 16:4216746-4216768 CCCCAGCTCGGCCCCTCTGAAGG - Intronic
1135196810 16:20401736-20401758 GCCCAGCTCAGCCACCGTGGAGG + Intronic
1139908260 16:70381127-70381149 TCCCACCTCGGCCGCGCTGTGGG - Exonic
1139989406 16:70927545-70927567 GCCCAGCAGGGCTACCCTGTAGG - Intronic
1141935764 16:87236875-87236897 GCCCAGTTAGGTCAGGCTGTGGG + Intronic
1141972202 16:87492020-87492042 GCCCAGGTCGGCCGGGTTGTTGG + Exonic
1142061890 16:88035720-88035742 CCCCATCTCGGCCACACTGGGGG - Intronic
1142291726 16:89196290-89196312 GCCCAGCCCGGCCCCCCTGTGGG + Exonic
1142291758 16:89196371-89196393 GCCCAGCCCGGCCCCCCTGTGGG + Intronic
1142291791 16:89196452-89196474 GCCCAGGCCGGCCCCTCTGTGGG + Intronic
1142742799 17:1940807-1940829 GCCCCGCTCTGCCACCCTGAGGG + Intronic
1143462147 17:7110524-7110546 GCACAGCTGGGCTACCCTGTGGG - Intronic
1146716350 17:35089484-35089506 GGCCAGCCCGGCCCCGCCGTCGG - Intronic
1146788058 17:35735195-35735217 CCCCAGCACGGCCACCCGGTAGG - Exonic
1148197186 17:45722406-45722428 GCCCAGCTGGGCCAGCCTGGTGG - Intergenic
1148711101 17:49681558-49681580 GCCCAGCCTGGACAAGCTGTTGG - Intergenic
1151472839 17:74328444-74328466 CTCCAGCTCTGCCACGCTGATGG - Exonic
1151585040 17:75003701-75003723 GCCCCGCTTGCGCACGCTGTTGG - Exonic
1152597601 17:81245623-81245645 GCCCAGCTCCGCCAGGCTGCGGG - Exonic
1154046465 18:10910335-10910357 GCCCAGCTCGGCCTCCCAGAGGG - Intronic
1160555318 18:79720862-79720884 GTCCAGCTTGGCCACAGTGTTGG + Intronic
1160996025 19:1882197-1882219 GCCCATCTCTGCCACCCTATGGG + Intronic
1161065677 19:2236180-2236202 GCCCAGCTCGGCCGCCATCTCGG + Exonic
1162043047 19:7981954-7981976 GACCAGCCCGACCCCGCTGTGGG + Intronic
1162182879 19:8882734-8882756 GCCCAGCTCAGTGATGCTGTGGG + Exonic
1162183748 19:8888753-8888775 GCCCAGCTCAGTGATGCTGTGGG + Exonic
1162329218 19:10017129-10017151 GTCCAGCTGGGCCACGGTGAGGG - Exonic
1163426864 19:17245086-17245108 GCCCGGCTCGGCGTCGCTGGCGG + Exonic
1164634469 19:29782167-29782189 GCCCAGCTCTGGCATGCAGTAGG + Intergenic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1165902135 19:39173932-39173954 GCGCAGCTCGGGCAAGCTGGTGG + Exonic
1168011752 19:53538580-53538602 GCCCAGCACGGCCATGCTACGGG - Intronic
1168013750 19:53554977-53554999 GCCCAGCACGGCCACGCTGCCGG - Intronic
925099282 2:1231688-1231710 CCCTATCTCAGCCACGCTGTGGG - Intronic
928199696 2:29239752-29239774 GCCCAGCACAGACACGCCGTGGG + Exonic
929456503 2:42069739-42069761 GCCCAGCCCAGCCAGGCTGGAGG + Intergenic
931849483 2:66237902-66237924 CCCCAGCTCAGCTAGGCTGTGGG + Intergenic
933764481 2:85697438-85697460 GCCCAGCTCTGCCACCCTGCAGG - Intronic
938266116 2:129929513-129929535 TCCCAGGTCGGCCACTCTGTGGG - Intergenic
938909785 2:135875835-135875857 GCCCTGCTGGGCCACGCAGCCGG - Intronic
945119467 2:206443421-206443443 GCCCCGCTCGGGCGCGCTCTCGG + Intergenic
945755917 2:213846932-213846954 TCCCATCTCGTCCAGGCTGTGGG + Intronic
948405194 2:237712084-237712106 GCCCAGCTCTGCCACACGGCAGG - Intronic
1172481054 20:35271617-35271639 GCCCAGCTCCCCCAGGCTGTGGG - Exonic
1172603536 20:36199771-36199793 GCCAAGCTTGGCCTGGCTGTGGG + Intronic
1173374940 20:42474784-42474806 CCCCAGCTAGGCAACGCTGATGG - Intronic
1173597212 20:44266445-44266467 TCCCAGCTCTGCCATGCTCTCGG + Intronic
1174182064 20:48681196-48681218 GCCCAGCTGGGCCAAGGGGTGGG - Intronic
1175869380 20:62201028-62201050 GCCCAGCTCGGCCTCCGCGTAGG - Exonic
1180785042 22:18542458-18542480 GCCAAGCTTGGCCTTGCTGTGGG + Intergenic
1180988525 22:19919719-19919741 GCGCAGCTCAGCCACTGTGTGGG - Intronic
1181128625 22:20716491-20716513 GCCAAGCTTGGCCTTGCTGTGGG + Intronic
1181241945 22:21481812-21481834 GCCAAGCTTGGCCTTGCTGTGGG + Intergenic
1182455493 22:30447846-30447868 GCCCAGCTCAGCCATGCCCTAGG + Intergenic
1183586081 22:38753827-38753849 GCTCAGCTCTGACAGGCTGTAGG + Intronic
969232242 4:5839852-5839874 GCCCAGCTCCACCACATTGTCGG + Intronic
969368714 4:6716679-6716701 GCCCAGCTCGGCCTCGGCCTTGG - Exonic
969487579 4:7480840-7480862 ACCCAGGGAGGCCACGCTGTGGG - Intronic
969629869 4:8329900-8329922 GCCCAGGTCTGCCAGCCTGTGGG - Intergenic
971244025 4:24912729-24912751 TCCCAGCTCGGCCTCTCTGGGGG + Intronic
975373941 4:73620491-73620513 GCCCAGCTGAGCCATGCTCTGGG - Exonic
986768860 5:10953479-10953501 TCCCAGCTCCTCCATGCTGTAGG + Intergenic
997013471 5:129904912-129904934 GCTCAGCTCCGCCACCCTGGGGG - Exonic
998331648 5:141332690-141332712 GCCCAGGTCGGCCAGGATGTCGG - Exonic
998332476 5:141340977-141340999 GCCCAGGTCGGCCAGGATGTCGG - Exonic
998333032 5:141346039-141346061 GCCCAGGTCGGCCAGGATGTCGG - Exonic
998336443 5:141376089-141376111 GCCCAGGTCGGCCAGGATGTCGG - Exonic
1004228867 6:13813829-13813851 GCCCTGCTCGGCCGCGGTGGCGG - Intronic
1006448735 6:34093745-34093767 GCCGAGCTGGGCCATGCTTTTGG - Intronic
1006448736 6:34093756-34093778 GCCCAGCTCGGCCACCCAGCTGG + Intronic
1007610081 6:43143510-43143532 GCCCAGCACGGCAATGATGTAGG - Exonic
1007977669 6:46118096-46118118 GCCCAGCTCACCCAGGCTGCAGG + Intergenic
1015737867 6:136420340-136420362 GCCCAGCCCGGCCGCGAAGTGGG + Intronic
1019526129 7:1481272-1481294 CCCCAGCCCGGCCAGGCTTTTGG - Intronic
1019594332 7:1851388-1851410 TCCCAGCACGGCCTCCCTGTCGG - Intronic
1025610512 7:63072526-63072548 GCCCAGCTTGCCCAGGCGGTTGG + Intergenic
1026707675 7:72709377-72709399 ACCACGCTCGGCCACGCTTTTGG - Intronic
1032000598 7:128262730-128262752 GGCCAGCTGGGGCAGGCTGTGGG + Intergenic
1032080876 7:128857913-128857935 GGCCAGCACTGCCACCCTGTGGG - Intronic
1032091373 7:128913247-128913269 GGCCAGCACTGCCACCCTGTGGG + Intergenic
1035751802 8:2001794-2001816 CACCACCTCGGCCACGTTGTCGG - Exonic
1037125204 8:15340112-15340134 GCCCCGCTTTGCCAGGCTGTTGG + Intergenic
1039952257 8:42181548-42181570 GACCACCTCCACCACGCTGTTGG + Intronic
1045847840 8:106658206-106658228 GCCCAGGTCGGCCGCGCGGGAGG - Intronic
1049218056 8:141416793-141416815 GCACAGCTGGGCCAGGCTGATGG + Intronic
1049651346 8:143771340-143771362 CCCCGGCTCGGCCGCGCTGGGGG + Intergenic
1057228417 9:93304513-93304535 GCCCACCTCGGTCTCCCTGTGGG - Intronic
1059530570 9:115031635-115031657 GCTCAGGTCTGCCAGGCTGTAGG + Exonic
1061572797 9:131488034-131488056 GGCCAGCTCAGCCAGGCTGCTGG + Exonic
1061964345 9:134004648-134004670 GGCCAGCTGGGCCACACTCTGGG - Intergenic
1062022057 9:134324550-134324572 ACCCAGCTAGGCCACACGGTTGG + Intronic
1203771058 EBV:50401-50423 GCCCACCGCGGCCCCGCCGTCGG - Intergenic
1199133283 X:144220052-144220074 GCCCAGCAATGCCACACTGTGGG - Intergenic