ID: 1114531061

View in Genome Browser
Species Human (GRCh38)
Location 14:23396783-23396805
Sequence GAACCCAGTGGCCATCCCTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114531061_1114531065 -2 Left 1114531061 14:23396783-23396805 CCTCAGGGATGGCCACTGGGTTC 0: 1
1: 1
2: 0
3: 17
4: 223
Right 1114531065 14:23396804-23396826 TCAGGATGCGATACCTGAGGAGG 0: 2
1: 0
2: 0
3: 3
4: 71
1114531061_1114531064 -5 Left 1114531061 14:23396783-23396805 CCTCAGGGATGGCCACTGGGTTC 0: 1
1: 1
2: 0
3: 17
4: 223
Right 1114531064 14:23396801-23396823 GGTTCAGGATGCGATACCTGAGG 0: 2
1: 0
2: 1
3: 4
4: 64
1114531061_1114531066 -1 Left 1114531061 14:23396783-23396805 CCTCAGGGATGGCCACTGGGTTC 0: 1
1: 1
2: 0
3: 17
4: 223
Right 1114531066 14:23396805-23396827 CAGGATGCGATACCTGAGGAGGG 0: 2
1: 0
2: 1
3: 4
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114531061 Original CRISPR GAACCCAGTGGCCATCCCTG AGG (reversed) Exonic
900371315 1:2333374-2333396 GTCCCCAGTTGCCATCGCTGGGG - Intronic
901129416 1:6952948-6952970 GAACCCAGTGTCCACCACGGTGG - Intronic
904042582 1:27593132-27593154 GACCCTAGGGGCCTTCCCTGAGG - Intronic
904698940 1:32346882-32346904 GAACCTAGTCCCCATCTCTGGGG - Intergenic
904774500 1:32898394-32898416 GAACCCAATGTCCATCACTAGGG - Intronic
905633278 1:39530946-39530968 GGAGCCAGTGGGCAGCCCTGGGG + Intergenic
906264212 1:44416681-44416703 GTGCCCAGGGTCCATCCCTGGGG - Intronic
910233791 1:85013193-85013215 GAACCCAGGGGCCAGCGCAGTGG - Intronic
910457948 1:87417879-87417901 AAACACAGTGGTCATACCTGAGG + Intergenic
911077880 1:93896517-93896539 GCACATAGTGGCCACCCCTGCGG - Intronic
911281054 1:95929562-95929584 CAACCCAATGGCCATCAATGGGG - Intergenic
912802828 1:112731570-112731592 GAACCCAGAAGCCATCCAAGTGG - Intergenic
913398147 1:118395754-118395776 GAACCCAGGGGCCTTCACTCAGG - Intergenic
917255815 1:173115203-173115225 AAACCCTGTGGCCATCCTTTGGG + Intergenic
917635937 1:176936266-176936288 CAACCAAGTGGCCATCTCTCAGG - Exonic
920122607 1:203670005-203670027 GAGCCCTGTGTCCATCACTGTGG + Intronic
922534654 1:226370872-226370894 CCACCCAGCGGCCTTCCCTGGGG + Intronic
922789517 1:228303491-228303513 GAACACAGTCCCCATCTCTGAGG - Intronic
922823647 1:228502176-228502198 GAACCCTGTGGGCATCTCTTTGG - Intergenic
923377313 1:233377547-233377569 GAACCCTGTGCTCTTCCCTGTGG - Intronic
923850100 1:237784933-237784955 CAACCCAGTCCCCATGCCTGAGG + Exonic
924122676 1:240818037-240818059 GAACCCAATTCCCATCACTGAGG + Intronic
1065146915 10:22778971-22778993 GTACCCAGAGGCAATCCCTAGGG - Intergenic
1067157971 10:43798829-43798851 GGACCCAGTGTCCATCACGGGGG - Intergenic
1069629352 10:69888496-69888518 GACCCCAGTGGCCTTCCCCAGGG + Intronic
1074206473 10:111287205-111287227 GATTCCAGTGGCCATCCATAGGG - Intergenic
1075631502 10:124003399-124003421 AAAACCACTGGCCTTCCCTGAGG + Intergenic
1076050470 10:127329357-127329379 CACCCCAGTGTCCATCCCTCAGG - Intronic
1076512657 10:131023422-131023444 CAACCCAGGGGCCATCCTGGAGG - Intergenic
1077013981 11:391980-392002 GATCCCTGTGACCAGCCCTGAGG - Intergenic
1077206885 11:1349081-1349103 GCACGCAGAGGCCATCCCCGGGG - Intergenic
1078362635 11:10680964-10680986 GAACTCACTGACCCTCCCTGAGG - Intronic
1078603897 11:12758164-12758186 CACCCCAGTGTCCCTCCCTGAGG - Intronic
1083681626 11:64354264-64354286 GACCCCATTGGCCTTCCCTGAGG + Intronic
1083731458 11:64654613-64654635 GAAGCCTCTGGCCATCCCTCTGG + Intronic
1084516567 11:69640965-69640987 GAGCCCAAAAGCCATCCCTGAGG - Intergenic
1084662061 11:70551818-70551840 GAACCCAGAGTCCAGGCCTGCGG - Intronic
1084705410 11:70813450-70813472 GGCCCCTGTGGCCATCCCAGGGG + Intronic
1088511546 11:110580536-110580558 TAAGCCAGTGGCCATTTCTGTGG - Exonic
1088626833 11:111735685-111735707 GGAGCCATTGGACATCCCTGGGG - Intronic
1089744999 11:120610474-120610496 GAAGCCAGACACCATCCCTGCGG - Intronic
1090310577 11:125733091-125733113 GAACCTAGTGGCCTACTCTGTGG - Intergenic
1090751466 11:129749902-129749924 GAACCCAAAGGCCATCACGGAGG + Intergenic
1090858715 11:130634236-130634258 GAATCCTCTGGGCATCCCTGTGG + Intergenic
1096398301 12:51283913-51283935 GAACCCAGAGGCCAAGGCTGCGG + Intronic
1096658358 12:53105560-53105582 GGACCCAGGAGCCATCCCTGGGG + Exonic
1096849629 12:54427277-54427299 GAACCCAGCCCCCCTCCCTGAGG - Intergenic
1098219456 12:68253148-68253170 GAACCCACTGTTTATCCCTGAGG - Intronic
1101005045 12:100393253-100393275 GATCCCTGTGGAAATCCCTGTGG - Intronic
1105064141 12:133181990-133182012 GACCCTGGTGGCCATCCCTACGG - Exonic
1105279033 13:18952611-18952633 GAGCCCAGTGGGCAGCCTTGGGG + Intergenic
1107441367 13:40430282-40430304 AAACCAAGTGGAAATCCCTGGGG - Intergenic
1108518120 13:51221957-51221979 GAACCTCGTGGCAAGCCCTGGGG + Intergenic
1109490267 13:63088523-63088545 GAAGCCAGTGGCCAACCCATGGG + Intergenic
1111613238 13:90632309-90632331 AAACCCAGTGGGCATTCATGGGG - Intergenic
1113381904 13:109812194-109812216 GGATCCATTGGCCATCACTGGGG - Intergenic
1114531061 14:23396783-23396805 GAACCCAGTGGCCATCCCTGAGG - Exonic
1114536416 14:23425784-23425806 GAACCCAGCGGCCATCCCTGAGG - Exonic
1116741243 14:48757770-48757792 GATGCCAGTGGCAATCCTTGAGG + Intergenic
1118824610 14:69368834-69368856 GAAGACAATGGGCATCCCTGTGG + Intergenic
1121544471 14:94753326-94753348 AAGGCCAGTGGACATCCCTGTGG + Intergenic
1122077758 14:99246638-99246660 GAACACAATGGCCTTCCCCGAGG - Intronic
1122202561 14:100131398-100131420 CCACCCAGTAGCCATCACTGAGG - Intronic
1122313746 14:100813506-100813528 GCACCCTGTGGCCCTCACTGTGG + Intergenic
1123058027 14:105581620-105581642 GGACGCAGTGCCCAGCCCTGGGG - Intergenic
1125243679 15:37607667-37607689 AAACACTTTGGCCATCCCTGAGG - Intergenic
1125504840 15:40261730-40261752 GAAACCAGAGGCCATCACTTAGG - Intronic
1125613276 15:40987285-40987307 GAAACCAGAGGCCTCCCCTGAGG - Intronic
1126667388 15:51087583-51087605 GAAGCCAGTGGCTGCCCCTGTGG + Intronic
1128756727 15:70188307-70188329 GTAACCAGTGACCATCCCTTGGG - Intergenic
1129933939 15:79433543-79433565 GAACCATGCCGCCATCCCTGAGG + Intronic
1131700407 15:94929465-94929487 GAGGCCAGTGGCAATCCCTAAGG + Intergenic
1133353702 16:5120357-5120379 GGACACTGTGGCCAGCCCTGAGG + Intergenic
1135419171 16:22293324-22293346 GAACCCACTAGCCATGGCTGTGG + Intergenic
1136537898 16:30911071-30911093 GAACCCATAGTGCATCCCTGGGG + Intergenic
1137586435 16:49666720-49666742 GCACCCAGCGGCCCTCCCTGGGG - Intronic
1138173645 16:54876326-54876348 GATCCTAGAGGCCATCCCTCTGG - Intergenic
1138427887 16:56948424-56948446 AAACCCTGTGGCCTTCCCTGAGG + Intergenic
1139724643 16:68887283-68887305 CCACCCAGTGGCCACCCCAGAGG + Intronic
1140859396 16:79005949-79005971 TTACCCACTGGCCATTCCTGGGG + Intronic
1141195534 16:81858026-81858048 TAACCCACTTGTCATCCCTGTGG + Intronic
1142069571 16:88083764-88083786 GGTCCCAGTGCCCATCCCTCCGG - Intronic
1142287893 16:89178889-89178911 GAAGCCAGTGGCGGTGCCTGTGG - Intronic
1143136289 17:4714501-4714523 GCAACCAGTGGCCATTACTGGGG + Intronic
1143505709 17:7363853-7363875 GAACCTAGTCACCATCTCTGAGG + Intergenic
1144949179 17:18984872-18984894 GGCCCCAGTGGCCCTCCATGTGG - Intronic
1146305301 17:31725724-31725746 GAACTCAGTGGGCAGCCCAGAGG + Intergenic
1146932015 17:36784352-36784374 AAACCCAGAACCCATCCCTGGGG + Intergenic
1147220332 17:38925143-38925165 GATCTCAGTGGGCTTCCCTGAGG - Intergenic
1147243992 17:39108833-39108855 GAACTCAGGGGCCCTCCCAGGGG - Intronic
1148321976 17:46762145-46762167 TAAGGCAGTGGCCACCCCTGCGG + Intergenic
1149374003 17:56025456-56025478 CAACCCAATGCCCATCGCTGAGG + Intergenic
1149563570 17:57626471-57626493 GTGCCCAGTGGCCAGCCCAGTGG + Intronic
1151821409 17:76498958-76498980 GAACCCAGTTGCCCACCCTCAGG - Intronic
1153294678 18:3534284-3534306 GGAACCAGTGGCCATCCCGGTGG + Exonic
1154388482 18:13916745-13916767 AAAACCGGTGGCCAGCCCTGGGG + Intergenic
1157391940 18:47310264-47310286 GACCACACTGGCCATCACTGAGG + Intergenic
1162345264 19:10114900-10114922 GAGCCCTGTGGCCAGCGCTGTGG - Exonic
1163820233 19:19492240-19492262 GGACCCAGTGCCCACCCCTGTGG - Intronic
1164683016 19:30148496-30148518 GAACTCAGTCTCCAGCCCTGTGG + Intergenic
1164770175 19:30802199-30802221 GATGCCCGTGGCCCTCCCTGGGG - Intergenic
1166326891 19:42056550-42056572 GAACCCTCTCGCCCTCCCTGAGG - Intronic
925272245 2:2620202-2620224 GAGCCCTTTGACCATCCCTGAGG + Intergenic
926586421 2:14690856-14690878 GCACCCACTGGCCCTACCTGTGG + Intergenic
927996811 2:27492673-27492695 GTCCCCACTGGCCTTCCCTGAGG + Exonic
929819230 2:45259983-45260005 GAGCCCAGCGGCCAGCCCTCAGG - Intergenic
930593999 2:53363596-53363618 GGACCCAGTCTCCAACCCTGGGG - Intergenic
932565254 2:72902021-72902043 GAACCCCGTGGCCTTCCTTCTGG - Intergenic
934113490 2:88764259-88764281 CCACCCAGAGGCCATCCCAGGGG + Intergenic
934670235 2:96208073-96208095 GAACCCTGGGGCCTGCCCTGTGG - Intronic
934750054 2:96788449-96788471 GAACCCAGCTGCCCTCCCCGAGG + Intronic
935707613 2:105870325-105870347 GAAGGGAGTTGCCATCCCTGAGG - Intronic
937849666 2:126621142-126621164 GAGCTCAGTGCCCCTCCCTGTGG - Intergenic
937984671 2:127633133-127633155 AACCCCAGTGACCATCACTGGGG - Intronic
938341445 2:130539190-130539212 AAACCCAGCCCCCATCCCTGTGG - Exonic
938348384 2:130581519-130581541 AAACCCAGCCCCCATCCCTGTGG + Intronic
938378700 2:130824921-130824943 GGACCCAGTGTCCATCCCACAGG + Intergenic
940911247 2:159211928-159211950 CAACCCAGTTGCCATGCCCGGGG + Intronic
942251031 2:174047906-174047928 GATCCCAGTGGTGAGCCCTGGGG - Intergenic
943454239 2:188083322-188083344 GATCTAAGTGGACATCCCTGGGG + Intergenic
945321139 2:208424951-208424973 GAACCAAGAGGCCAAGCCTGAGG + Intronic
946334892 2:219029955-219029977 GACCCCAGGGGCCTCCCCTGGGG - Intronic
947568542 2:231212586-231212608 AAACCCAGTGCCCATTCCTGAGG - Intronic
947834594 2:233166310-233166332 TGACCCAGTGCCCAGCCCTGAGG - Intronic
948144564 2:235698991-235699013 GAGCCCCGTGCCCATACCTGTGG + Intronic
949045836 2:241872305-241872327 GGATTCAGTGGCCATGCCTGGGG + Exonic
1169091859 20:2865732-2865754 GCCCCCTGTGGCCCTCCCTGGGG - Intronic
1169932578 20:10850538-10850560 CATCCCAGTGTCCATCCCTGTGG - Intergenic
1171401971 20:24879570-24879592 GAGCCCAGTGGCCATTGCTGAGG - Intergenic
1171849084 20:30295429-30295451 GAGCCCTGTGTCCCTCCCTGAGG + Intergenic
1172029918 20:31974803-31974825 GAACTCAGTGACCATCCATGAGG + Intronic
1174578566 20:51554970-51554992 AAAGCCAGGGACCATCCCTGTGG + Intronic
1175866305 20:62179010-62179032 GAAGCCACTGGCCAAGCCTGGGG - Intronic
1175974987 20:62706402-62706424 GACTCCAGTGGCCATTGCTGTGG + Intergenic
1180163156 21:46006965-46006987 GAACCCAGTGTGCAGCCCAGGGG - Intergenic
1180855842 22:19044228-19044250 GAAGCCAGAGGCCAGCCCAGGGG + Intronic
1181163897 22:20973506-20973528 GAACCCACTGGCCATTCTCGAGG - Exonic
1182098604 22:27642313-27642335 GAGCCCCGTGGCCATCTCTGCGG - Intergenic
1182861469 22:33563102-33563124 GAAGTGAGTGGCCATGCCTGTGG - Intronic
1185008675 22:48300695-48300717 AAACCCACTGTCCAGCCCTGCGG + Intergenic
1185297002 22:50059217-50059239 GAGCCCAGTGGCATTCCCCGGGG - Intergenic
949329697 3:2908070-2908092 TATCCCTGTGGACATCCCTGAGG + Intronic
949399514 3:3651370-3651392 GAATCCAGTTGCCATCTTTGAGG - Intergenic
950725573 3:14914745-14914767 GAGGCCAGAGGCCATGCCTGAGG - Intronic
952738273 3:36711287-36711309 GAAACCAGTGGCCAGTACTGTGG - Intergenic
953125554 3:40088681-40088703 GAAACCAGAGCCCATCTCTGTGG + Intronic
953243905 3:41173822-41173844 CAAACCAGTGGTCATCACTGGGG + Intergenic
960532360 3:118779379-118779401 GAGTCCAGTGGGCAGCCCTGTGG - Intergenic
960958561 3:123052781-123052803 GAACTCAATGGCCATTCCTCTGG + Intergenic
963778752 3:149465718-149465740 GAACCCCGTGGCCATGTCTCAGG - Intergenic
968595614 4:1480907-1480929 CCACCCTGTGGCCAGCCCTGGGG - Intergenic
968646811 4:1745257-1745279 GGACCAAGTGGCCAGCTCTGAGG - Intergenic
969666623 4:8561026-8561048 AAGCCCAGAGGCCTTCCCTGAGG - Intronic
971089726 4:23327321-23327343 GAACCCTGTGCACATACCTGAGG + Intergenic
971498582 4:27293898-27293920 GAACCCAGTTGTCATCTGTGAGG + Intergenic
972165740 4:36281880-36281902 GACCACAGTGGCCATCCAAGTGG - Intronic
973014441 4:45119848-45119870 TAACCCAGTGGCTATCACTTAGG - Intergenic
973211812 4:47623625-47623647 GAACCCAGTGGACATATCTGTGG - Exonic
985669568 5:1200570-1200592 GGACCCCGTGGTCAGCCCTGTGG + Intergenic
986290752 5:6397098-6397120 CTGCCCAGTGGCCAGCCCTGTGG - Intergenic
986312745 5:6566696-6566718 GAATACAGTGCCCATCCCTTTGG + Intergenic
987758696 5:22130607-22130629 GATCCCACTGGACATCTCTGAGG + Intronic
989001127 5:36762024-36762046 GAACCCAGCGGGCAGCACTGGGG - Intergenic
989368469 5:40681047-40681069 CAGCCCAGTGACCATCCCGGCGG + Exonic
990242309 5:53827573-53827595 GAATCCTGTTGCCATCTCTGGGG - Intergenic
991749454 5:69784745-69784767 GATCCCACTGGACATCTCTGAGG + Intergenic
991801034 5:70364554-70364576 GATCCCACTGGACATCTCTGAGG + Intergenic
991827566 5:70645487-70645509 GATCCCACTGGACATCTCTGAGG - Intergenic
991893397 5:71364046-71364068 GATCCCACTGGACATCTCTGAGG + Intergenic
993899441 5:93574406-93574428 GAACCCAGTCGCTTTCTCTGTGG - Intergenic
995744847 5:115392750-115392772 GAATCCAGAGGCCCTCCCTCAGG + Intergenic
1000252204 5:159506394-159506416 CCACCCAGTGGCCTGCCCTGTGG + Intergenic
1000371308 5:160539363-160539385 GACTCCAGAGGCCATCCCTCTGG - Intergenic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1003749812 6:9042667-9042689 GATGCCAGTGGTCATGCCTGAGG - Intergenic
1003801070 6:9668135-9668157 GAACCCTGGGACCATCCCTCTGG + Intronic
1004905901 6:20236848-20236870 GTACCCAGTGTGCATCCATGTGG - Intergenic
1005341209 6:24845416-24845438 GAACCCATGGGCCCTCCATGTGG + Intronic
1005352469 6:24949794-24949816 GCACCCAGGGGCTTTCCCTGAGG - Intronic
1006396544 6:33791048-33791070 GAACCCTGTTGTCTTCCCTGTGG + Intergenic
1007695008 6:43726288-43726310 GAACCCACTGGCCACCCCCAAGG - Intergenic
1011408805 6:87044309-87044331 GAACCCAGGAGCCATGACTGTGG + Intergenic
1013301579 6:108809377-108809399 CAGCCCACTGGCCCTCCCTGCGG + Intergenic
1017314330 6:153012957-153012979 AAATCTAGTAGCCATCCCTGGGG - Intronic
1017529869 6:155278914-155278936 TAATCCAGTGGCTCTCCCTGGGG + Intronic
1017823153 6:158063319-158063341 AACCCCAGTGTCCATCCCAGTGG - Intronic
1018850905 6:167589490-167589512 CAACCCAGTGGCCAGCCCTCAGG + Intergenic
1018907831 6:168085531-168085553 GAGCCCAGTGGCCCGTCCTGGGG - Intergenic
1019073849 6:169371149-169371171 GGAACCAGTGACCATCCCTCTGG + Intergenic
1019088272 6:169502010-169502032 GGAGCCGGTGGCCATGCCTGGGG + Intronic
1019158992 6:170057205-170057227 AAAGCCTGTGGCCAACCCTGAGG + Intergenic
1019612919 7:1945977-1945999 GAACCCACTGGCCCTTCCTCTGG - Intronic
1020897972 7:13966292-13966314 GAATCCAGTGGCCTTGCCTTTGG + Intronic
1023637960 7:42231600-42231622 GAATCCAGTGGCCAGACGTGTGG - Intronic
1024012447 7:45280944-45280966 CAACCCAGTAGTCATACCTGTGG + Intergenic
1026110316 7:67454243-67454265 GAACCCAGTGACCACAGCTGAGG + Intergenic
1029518107 7:101040581-101040603 CACGCCAGTGGCCATTCCTGAGG + Exonic
1029714713 7:102319647-102319669 GAAACAAGTGGCTATCTCTGGGG - Intronic
1031079989 7:117249046-117249068 CAACCCACTGGCCATGCCTGGGG + Intergenic
1031959484 7:127975992-127976014 AACCACAGTGGCCATCTCTGAGG - Intronic
1032460055 7:132103496-132103518 GACCCCAGAGGCCATGACTGGGG + Intergenic
1033253423 7:139778607-139778629 GAACCCAGCGACCACCCCGGGGG - Intronic
1034245534 7:149641522-149641544 GATCCCCGTGACCATTCCTGGGG + Intergenic
1035159918 7:156943032-156943054 GAACCGAGTGGCAAAGCCTGCGG + Intergenic
1036214470 8:6867403-6867425 GAACCCAGCAGCCTTTCCTGAGG + Intergenic
1036787190 8:11695866-11695888 GACCACTGTGGCCATTCCTGTGG + Intronic
1036900376 8:12665450-12665472 GAAGCCACTGGCAAGCCCTGAGG - Intergenic
1038055183 8:23851351-23851373 GAACCCTGAAGCCATCACTGAGG - Exonic
1039742930 8:40398545-40398567 GCACCCAGAGGGCCTCCCTGAGG + Intergenic
1042866337 8:73359688-73359710 GGACCCAGTGCCCACCCGTGAGG + Intergenic
1045366218 8:101478504-101478526 GAACCCAGAGACCATGGCTGGGG - Intergenic
1047179726 8:122575601-122575623 GAAGCAAGTGACCAGCCCTGAGG + Intergenic
1049218616 8:141418797-141418819 GTTCTCAGTGCCCATCCCTGGGG + Intronic
1049494205 8:142922174-142922196 GAGCCCAGTGGCCCAGCCTGAGG + Intergenic
1052640842 9:31164719-31164741 CATCCCAGAGGCCCTCCCTGAGG + Intergenic
1053786806 9:41658149-41658171 GAGCCCTGTGTCCCTCCCTGAGG + Intergenic
1054158255 9:61656046-61656068 GAGCCCTGTGTCCCTCCCTGAGG - Intergenic
1054478028 9:65587051-65587073 GAGCCCTGTGTCCCTCCCTGAGG - Intergenic
1056100889 9:83299712-83299734 GAAGCCAGTGACCATTCCTGTGG - Intronic
1056104780 9:83336414-83336436 GAAACCAGTGGACATTCCTCGGG + Intronic
1056825367 9:89873199-89873221 CACCCCAGTGGCCAGGCCTGAGG + Intergenic
1057227702 9:93301317-93301339 GGAGCCAGAGGCCATGCCTGTGG + Intronic
1057392897 9:94654031-94654053 GAACCCAGCTGGCAGCCCTGGGG + Intergenic
1058668723 9:107342877-107342899 GCACCCAGTGGCAAAGCCTGGGG - Intergenic
1060408865 9:123386834-123386856 GAACCCACAGGCCATCCCAGGGG + Intronic
1060506362 9:124201061-124201083 GGAGTCAGTGGCCAGCCCTGTGG - Intergenic
1060966288 9:127714106-127714128 GAAGCCAGGGGCCCTCACTGGGG - Exonic
1061747471 9:132750881-132750903 TAACCCAGAGGCCAGCCCTGTGG + Intronic
1062454188 9:136627987-136628009 TAACACAGTGGCCATCTCGGGGG + Intergenic
1203665882 Un_KI270754v1:20459-20481 GAACCCTGAGGCAACCCCTGAGG + Intergenic
1203667031 Un_KI270754v1:26098-26120 GAACCCTGAGGCAACCCCTGAGG + Intergenic
1203668179 Un_KI270754v1:31737-31759 GAACCCTGAGGCAACCCCTGAGG + Intergenic
1187847419 X:23555139-23555161 GAACCTATCGGCCATGCCTGAGG + Intergenic
1187932992 X:24311241-24311263 GAACCCTGTGGCCCTGGCTGAGG + Intergenic
1187939219 X:24364921-24364943 GAACCCTGTGGCCCTGGCTGAGG - Intergenic
1188370957 X:29369150-29369172 GAACCCTGTGGCCTTGGCTGTGG + Intronic
1189360663 X:40348297-40348319 AAACTCAGTGGCCATCCATCAGG - Intergenic
1196081544 X:111637911-111637933 GGCTCCAGTGGCCATCCCTCTGG - Intergenic
1198810402 X:140530468-140530490 GAACCCAGAGGGCCTCCCTTAGG + Intergenic
1199708495 X:150451398-150451420 AGACCCAGGGGCCAGCCCTGTGG + Intronic
1199991429 X:152989735-152989757 GGACCCTGTGGCCTCCCCTGCGG + Exonic
1200034379 X:153318598-153318620 GCCCCCACTTGCCATCCCTGGGG - Intergenic