ID: 1114531091

View in Genome Browser
Species Human (GRCh38)
Location 14:23396927-23396949
Sequence TGCCCCAGAGCTCATAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 1, 2: 3, 3: 23, 4: 112}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114531091_1114531101 24 Left 1114531091 14:23396927-23396949 CCTGTTCTATGAGCTCTGGGGCA 0: 1
1: 1
2: 3
3: 23
4: 112
Right 1114531101 14:23396974-23396996 GTCCCCGTAGAGGATGCGGTTGG 0: 2
1: 0
2: 0
3: 3
4: 60
1114531091_1114531092 -1 Left 1114531091 14:23396927-23396949 CCTGTTCTATGAGCTCTGGGGCA 0: 1
1: 1
2: 3
3: 23
4: 112
Right 1114531092 14:23396949-23396971 ACCCTCATACCCACCTCTGCCGG 0: 2
1: 0
2: 3
3: 13
4: 159
1114531091_1114531098 14 Left 1114531091 14:23396927-23396949 CCTGTTCTATGAGCTCTGGGGCA 0: 1
1: 1
2: 3
3: 23
4: 112
Right 1114531098 14:23396964-23396986 TCTGCCGGAAGTCCCCGTAGAGG 0: 2
1: 0
2: 0
3: 5
4: 31
1114531091_1114531100 20 Left 1114531091 14:23396927-23396949 CCTGTTCTATGAGCTCTGGGGCA 0: 1
1: 1
2: 3
3: 23
4: 112
Right 1114531100 14:23396970-23396992 GGAAGTCCCCGTAGAGGATGCGG 0: 2
1: 0
2: 1
3: 7
4: 114
1114531091_1114531102 25 Left 1114531091 14:23396927-23396949 CCTGTTCTATGAGCTCTGGGGCA 0: 1
1: 1
2: 3
3: 23
4: 112
Right 1114531102 14:23396975-23396997 TCCCCGTAGAGGATGCGGTTGGG 0: 2
1: 0
2: 1
3: 2
4: 50
1114531091_1114531104 26 Left 1114531091 14:23396927-23396949 CCTGTTCTATGAGCTCTGGGGCA 0: 1
1: 1
2: 3
3: 23
4: 112
Right 1114531104 14:23396976-23396998 CCCCGTAGAGGATGCGGTTGGGG 0: 2
1: 0
2: 0
3: 8
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114531091 Original CRISPR TGCCCCAGAGCTCATAGAAC AGG (reversed) Intronic
901424014 1:9169721-9169743 TGTCCCTGAGCTCACAGACCAGG + Intergenic
901916222 1:12502556-12502578 TGACTCAGAGCTCCTGGAACAGG - Intronic
902218032 1:14946982-14947004 TGCCCCACACCTCACAGAGCAGG - Intronic
902232893 1:15039345-15039367 AGCCCCAGAGCTCATAGGACTGG + Intronic
903536665 1:24071453-24071475 AGCCCCAGAGCTCTTAGAAGAGG - Intronic
903884914 1:26535490-26535512 TGCCCCACCCCTCCTAGAACAGG - Intronic
903925399 1:26827496-26827518 TGCCCCAGGGCTTCTTGAACAGG + Intronic
906185315 1:43858127-43858149 TTCCCCAGAGCTAAGAGAAATGG + Intronic
907126117 1:52052586-52052608 GGCCCCAGTCATCATAGAACAGG + Intronic
909869116 1:80717188-80717210 TGCCTCAAAGCTTACAGAACGGG + Intergenic
912283480 1:108342716-108342738 TGCCCAAATGCTCCTAGAACTGG + Intergenic
913578978 1:120207364-120207386 TGCCCCAGAGCTCACAGAGAGGG - Intergenic
913629195 1:120691005-120691027 TGCCCCAGAGCTCACAGAGAGGG + Intergenic
914560907 1:148818799-148818821 TGCCCCAGAGCTCACAGAGAGGG - Intronic
914611927 1:149311411-149311433 TGCCCCAGAGCTCACAGAGAGGG + Intergenic
916215634 1:162390663-162390685 TGCCCCTGAGCTCAGAGACCTGG - Intergenic
917752251 1:178064603-178064625 TGCCCCTGAGCTGCTGGAACAGG - Intergenic
919946464 1:202322728-202322750 TGCCCCAGAACTCAGAAGACAGG - Intergenic
921420756 1:214945196-214945218 TGCACCAGATCTCACAAAACAGG - Intergenic
1063068464 10:2634610-2634632 TGCCCCAGCCCACATAGAAGTGG - Intergenic
1064999613 10:21326780-21326802 TGCCTAAGAGCTTATAGAGCAGG + Intergenic
1066132333 10:32406542-32406564 AGCTCCAGAACTCATAGAAATGG + Intergenic
1067061903 10:43081964-43081986 GGCCCCAGAGCTCAGAGAAGGGG - Intronic
1067289592 10:44931532-44931554 TGCCCATGAGGTCAGAGAACAGG + Intronic
1069771224 10:70901641-70901663 TGCCCCACAGCCCGTAGATCAGG + Intergenic
1071616860 10:87082561-87082583 AGCCCCAGAGCCAACAGAACAGG + Intronic
1076324656 10:129611803-129611825 TGCCTCTGAGCTCCTAGAGCTGG + Intronic
1079198501 11:18353649-18353671 TGCCTCAGTGCTCATAAAAACGG - Intronic
1083491725 11:63018988-63019010 GGCACCATAGCTCCTAGAACGGG - Intergenic
1083768001 11:64851352-64851374 TGCCCCAGAGTTCATAGCCCTGG - Intergenic
1089257432 11:117201214-117201236 ATCCCCAGTGCTCAGAGAACTGG + Intronic
1091102278 11:132886363-132886385 GGCCCCAGGCATCATAGAACAGG - Intronic
1094220412 12:27986887-27986909 TGCACCAAAACTCATAGAATTGG + Intergenic
1095049805 12:37545556-37545578 CGCCCCAGAGCTTTTACAACTGG + Intergenic
1096486708 12:51987230-51987252 TGCCCCGGTGCGCATAGCACGGG + Intronic
1097064494 12:56310913-56310935 TTCCACAGAGCTACTAGAACAGG + Intronic
1097684839 12:62681493-62681515 TGCCCCAGAGGTCCTTGAACTGG - Intronic
1097982372 12:65747423-65747445 TGACCCACTGCTCACAGAACTGG + Intergenic
1101850034 12:108394379-108394401 TGCCCCGGAGCTCATGGCTCTGG + Intergenic
1103249703 12:119488983-119489005 TCCCACAGAGCACATAGAAGAGG - Intronic
1104663721 12:130632559-130632581 GGCCCCAGAGCAAAGAGAACAGG - Intronic
1106170508 13:27284301-27284323 GGCACCAGAGCCCATGGAACTGG - Intergenic
1107027980 13:35823078-35823100 TCCCCCAGAGCTCAAAGAAAGGG + Intronic
1108467252 13:50728679-50728701 TGCCCCAAAGATTACAGAACAGG + Intronic
1113536017 13:111066858-111066880 TTCCCCAGAGCTCGTGGAAGGGG - Intergenic
1114531091 14:23396927-23396949 TGCCCCAGAGCTCATAGAACAGG - Intronic
1114536444 14:23425928-23425950 TGCACCAGAGCTCATAGAACAGG - Intronic
1115110133 14:29811569-29811591 AGCCCCACAGGTCTTAGAACAGG - Intronic
1116059953 14:39910360-39910382 TGCACCAGAGTTCAGAGAAGGGG - Intergenic
1120850425 14:89164406-89164428 TTCCCCAGAACTCTTAGAAATGG - Intronic
1123713392 15:23007933-23007955 TGCCCCTGACCTCTCAGAACTGG - Intronic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1125161928 15:36654128-36654150 TGCCCCAGTGCTCCTGGACCTGG + Exonic
1127743449 15:61938129-61938151 AGCCCCAGGCCTCATATAACAGG + Intronic
1131385973 15:92007733-92007755 TGCCCCAAAACTTACAGAACAGG - Intronic
1131668200 15:94592386-94592408 TGCCACAGAGATCATAGAACAGG - Intergenic
1131996086 15:98134304-98134326 TGCCACAGAGCTCACAGTCCTGG + Intergenic
1132014646 15:98304969-98304991 TAACCCAGAGTACATAGAACAGG + Intergenic
1133322884 16:4925165-4925187 TGTCCCAGAGCCCAGAGAAGGGG + Intronic
1134126837 16:11621837-11621859 TGCCCCGGAGCTCTGAGAGCAGG - Intronic
1134915383 16:18065591-18065613 TGCTCCAGATCTTATAGAAAAGG - Intergenic
1136362864 16:29792360-29792382 TGCCCCAGGGCTCACAGTCCAGG - Intronic
1138747647 16:59382093-59382115 TACCCTAGAGCTCCTAGATCAGG + Intergenic
1143560242 17:7689402-7689424 TGCCCCAGAGCTGGGAGAAGCGG + Intronic
1147653083 17:42072898-42072920 TGTCCCAGAGCTCAGGGAAGGGG + Intergenic
1155074143 18:22340559-22340581 TGCAGCAGAGCTCCGAGAACAGG + Intergenic
1161688066 19:5713438-5713460 TGCCCCAGTGGTCACAGGACCGG + Intronic
1161824668 19:6554382-6554404 TGGCCCAGGTCTCATAGAACTGG - Intergenic
1167766091 19:51483428-51483450 GGACCCAGACCTCAGAGAACTGG - Intronic
925912375 2:8582314-8582336 AGGCCCAGAGCCCAGAGAACAGG + Intergenic
926805813 2:16709896-16709918 AGCCCCAGACCTCATAGAAAAGG - Intergenic
928044563 2:27916213-27916235 AGCCCCAGAGTTCAGAGAATAGG + Intronic
932311521 2:70746238-70746260 GCCCTCAGAGCTCATAGAAGAGG - Intronic
935356187 2:102202123-102202145 TGCCGCAGAGCTCAGAGTTCTGG + Intronic
936008998 2:108912822-108912844 TGCCACAGAGCTCATGGATCTGG + Intronic
937294582 2:120802091-120802113 GGCCCCAGACCTCAAATAACTGG - Intronic
938553644 2:132403235-132403257 TGCCCAACAGCTCAAAGAAGAGG + Intergenic
940910439 2:159205254-159205276 TGCCCCAGAGCACAGGGAGCTGG + Intronic
941460073 2:165760318-165760340 TGCCCCAGACCTAATATAAAGGG + Intronic
942632494 2:177966236-177966258 TGCCCCAAAGCTCCTAGATCTGG - Intronic
947858116 2:233338253-233338275 GGCCACAGAGCTCAGAGAAGGGG + Intronic
948487911 2:238292463-238292485 TGCCCTAGAGATCACAGAGCTGG + Intergenic
949040492 2:241846330-241846352 TTCCCCTGAGCTCATAAAGCTGG + Intergenic
1169119206 20:3085114-3085136 TGCCCCACAGCTCCTAGGCCAGG - Intergenic
1174111094 20:48198352-48198374 TGCCCCCGAGAGCATAGACCAGG + Intergenic
1174553100 20:51375575-51375597 TGCCCCAGTGCTGATAGCTCTGG - Intergenic
1176091270 20:63319624-63319646 TGCCCCAGAGCTGGGGGAACGGG - Intronic
1179263027 21:39775314-39775336 TGCTCCAGAGCACATAGGACTGG + Intronic
1180728315 22:17962421-17962443 TGACCCAGGGCTCTTAGAGCCGG + Intronic
1182746030 22:32606124-32606146 TGCCCCTGAGATCATAGATGTGG - Intronic
1184362356 22:44025971-44025993 TGCCCCGGAGCACATAGAACAGG + Intronic
1184995209 22:48200255-48200277 TGCCGCAGAACTCATAGTCCAGG - Intergenic
952167869 3:30770656-30770678 GGCCCATGAGCTCAGAGAACTGG + Intronic
953512891 3:43560920-43560942 TGCCCCAGAGATGACAGAACGGG - Intronic
955092837 3:55769321-55769343 TGCCCCAGAGCTCTTAATCCAGG - Intronic
958161381 3:89819592-89819614 TGCCCAAAAGCTCTTAGATCTGG + Intergenic
960951447 3:123001064-123001086 CCCCCCAGAGCTCAAAGTACTGG + Intronic
964117474 3:153151328-153151350 TGCCCCAGAGTTCATGAACCTGG + Intergenic
968067306 3:195765651-195765673 TGCCACAGAACAAATAGAACTGG + Intronic
969694941 4:8729210-8729232 TGGCCCAGAGCTCATGGAAGGGG + Intergenic
972630691 4:40839354-40839376 TGCACCAGAGCCCATGTAACTGG + Intronic
975648520 4:76568873-76568895 TGGCCAAGATCTCACAGAACGGG - Intronic
976863285 4:89691906-89691928 TGTCACAGAGGTCATAGAATTGG + Intergenic
977654143 4:99502809-99502831 TGCCCCAGAGCCGATAGAAATGG - Intergenic
978060968 4:104337914-104337936 TACCCCAGAGCTCCTAGATCTGG - Intergenic
978654162 4:111047031-111047053 TGACCCAGAGCCCATTGAAGGGG + Intergenic
978856811 4:113402990-113403012 TGGTTCAGAACTCATAGAACAGG - Intergenic
987551298 5:19385060-19385082 TGGCCCACAGCTGATAGAGCTGG + Intergenic
990483898 5:56238634-56238656 TGCCCCAAAGCTCCTACATCTGG + Intergenic
999671307 5:153960925-153960947 GGCCCCAGGGCTCATGGAACTGG - Intergenic
1002456085 5:179345862-179345884 TGCCCCAGAGCACAGAGACAGGG - Intergenic
1005969891 6:30752633-30752655 TGCCCATGAGCTCATAAAAGAGG + Intergenic
1007820701 6:44558716-44558738 TGCCCCAGAGGTCCAAGATCAGG + Intergenic
1008046771 6:46859265-46859287 TGCCCCAGAGGTCAAAGTATGGG + Exonic
1008457334 6:51726237-51726259 TGCCCCTGAGTTAATGGAACCGG - Intronic
1012920294 6:105215553-105215575 TCCTCCAGAGCACATAAAACAGG - Intergenic
1015765943 6:136716611-136716633 TGCACCACAGCTCATTGACCAGG + Intronic
1016753491 6:147658137-147658159 GACCCCAGAGGTCATAGGACTGG - Intronic
1018036543 6:159887254-159887276 TGCCCCAGAGATCATCGCAGTGG - Intergenic
1018280003 6:162175207-162175229 TGTCCCAGAGGTCATAGAGCAGG + Intronic
1021792319 7:24217914-24217936 GGCCCCAGACATCATGGAACAGG + Intergenic
1040987593 8:53313598-53313620 TGCCACAGAGATGATAAAACAGG + Intergenic
1042108021 8:65349201-65349223 TGCCTCAGAGCTGGTACAACTGG - Intergenic
1045378850 8:101602877-101602899 TGCCCCGGAGCTCAGAGGAATGG + Intronic
1045542618 8:103101170-103101192 TGCCCCAGAGCTCCTATCCCAGG - Intergenic
1047225656 8:122953657-122953679 TGGCCGAGAGCCCAAAGAACGGG + Exonic
1047988899 8:130265149-130265171 TTCCCCAGAGCACCTAGAGCAGG + Intronic
1053901017 9:42795628-42795650 TGCCCCAGAGGTCAAAGTATGGG - Intergenic
1054260627 9:62861935-62861957 TGCCCCAGAGGTCAAAGTATGGG + Intergenic
1055646114 9:78362885-78362907 TGTACCAGAGCTCAGAAAACAGG - Intergenic
1056169111 9:83965670-83965692 TGCGCCAAAGCTAATATAACTGG + Intergenic
1058752290 9:108051375-108051397 TGCCCAGGAGCTCAGAGAGCTGG + Intergenic
1061659175 9:132116955-132116977 TGCCCCAGGACACACAGAACTGG + Intergenic
1061856035 9:133442511-133442533 TGCCCCACAGCTCACCGAGCAGG - Exonic
1188406062 X:29811151-29811173 TACCCCATACCTCATATAACAGG - Intronic
1189290205 X:39879525-39879547 TGCCACAGAGCCCAGAGAAAAGG + Intergenic
1193665764 X:84314418-84314440 TGCCCCAGATCTCAGAGAAAAGG - Intergenic
1194078943 X:89433426-89433448 TGCCCCAAAGTTCTTAGATCTGG - Intergenic
1197129019 X:122982280-122982302 TGCCCTAGAGTTCATAAAACTGG + Intergenic
1200431566 Y:3088748-3088770 TGCCCCAAAGTTCTTAGATCTGG - Intergenic