ID: 1114532221

View in Genome Browser
Species Human (GRCh38)
Location 14:23403210-23403232
Sequence CGGAGTGAGTGGAGGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 846
Summary {0: 1, 1: 0, 2: 8, 3: 49, 4: 788}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114532221 Original CRISPR CGGAGTGAGTGGAGGGAGAA GGG Intronic
900072850 1:787598-787620 AGGAGTCAGTGAAGGGAGACGGG - Intergenic
900109855 1:1000758-1000780 CGGAGTCAGCGGACGGCGAAGGG + Intergenic
900269761 1:1781062-1781084 TGGGGAGGGTGGAGGGAGAAGGG + Intergenic
900562658 1:3315137-3315159 CGGAGTGAAGCGGGGGAGAAAGG - Intronic
901091226 1:6642940-6642962 GGGAGTGAGTCGAGAGAGAAGGG + Intronic
901800051 1:11703355-11703377 CGGAGAGAGATGAGGGAGAGGGG + Intronic
904031248 1:27534790-27534812 GGGAGGGGGTGGAGGGAGATGGG + Exonic
904082971 1:27883586-27883608 CAGAGTGAGTGGAGGAAGATGGG - Intronic
904358061 1:29954250-29954272 CGGGGGGAATGGAGGGAGACTGG + Intergenic
905060841 1:35137707-35137729 GAGAGTCAGTGGAGGGAGATAGG + Intergenic
905151526 1:35931391-35931413 GGGAGTGCTTCGAGGGAGAACGG - Exonic
905499460 1:38425407-38425429 CAGAGTCAGTGAAGGGAGATAGG - Intergenic
906158690 1:43630539-43630561 CGTAGTTGGAGGAGGGAGAAGGG - Intergenic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
907347621 1:53795955-53795977 CAGAGTGAGTGAGGGGAGAGTGG - Intronic
907921591 1:58919202-58919224 AGGAGTGAGCAGAAGGAGAATGG + Intergenic
908000145 1:59671522-59671544 CAGAGTAGGTGGAGGGAGGAAGG + Intronic
908655130 1:66380487-66380509 CGTAGTGAGTGGGAGGAGCAGGG + Intergenic
909498272 1:76304331-76304353 GAGGGAGAGTGGAGGGAGAAAGG - Intronic
909631396 1:77773030-77773052 GGGAGTGAGTGGAGGCAGCCAGG - Intergenic
909685433 1:78343151-78343173 TGGAGTTGGTGGAGGGGGAAGGG - Intronic
910170386 1:84370822-84370844 GGGAGTGGGTGGTGGGGGAAGGG + Intronic
911036640 1:93557264-93557286 GGGAGTGAGAGAGGGGAGAAAGG - Intergenic
911037879 1:93569462-93569484 GGGAGTGGGTGTAGGGAGCAGGG - Intronic
911297340 1:96133789-96133811 GGGAGTGAGAGAGGGGAGAAAGG - Intergenic
911489399 1:98543533-98543555 TGGGGTGAGGGGAGGGGGAAGGG + Intergenic
912303117 1:108536848-108536870 AGGAGGGAGAGGAGGGAGACGGG + Intergenic
912755540 1:112321769-112321791 CAGAGGGAGTGGAGAGAGGATGG - Intergenic
913008551 1:114659744-114659766 CGGAGGGAGGGAAGGAAGAAAGG - Intronic
913051895 1:115124322-115124344 CAGAGAGAGAGGAGAGAGAAAGG + Intergenic
913380082 1:118201154-118201176 AGGAGAGAGAGGAGGGAGAGGGG - Intergenic
913577992 1:120196843-120196865 GGCAGTGGGTGGAGAGAGAATGG + Intergenic
913578699 1:120204301-120204323 AGGAGGTAGGGGAGGGAGAATGG - Intergenic
913629474 1:120694068-120694090 AGGAGGTAGGGGAGGGAGAATGG + Intergenic
913630178 1:120701509-120701531 GGCAGTGGGTGGAGAGAGAATGG - Intergenic
914334392 1:146701365-146701387 CGGAGGGAGCAGAGGGAGAGTGG - Intergenic
914559908 1:148808263-148808285 GGCAGTGGGTGGAGAGAGAATGG + Intronic
914560628 1:148815742-148815764 AGGAGGTAGGGGAGGGAGAATGG - Intronic
914612206 1:149314473-149314495 AGGAGGTAGGGGAGGGAGAATGG + Intergenic
914612925 1:149321952-149321974 GGCAGTGGGTGGAGAGAGAATGG - Intergenic
914855420 1:151346946-151346968 GGGATTGAATGGAGGGGGAAGGG - Intronic
914976651 1:152370576-152370598 CGGGGTGGGGGGAGGGAGGAGGG + Intergenic
915267264 1:154727971-154727993 CCTAGCGAGAGGAGGGAGAATGG - Intronic
915735289 1:158080753-158080775 AGGAAAGAGTGAAGGGAGAAGGG - Intronic
915851745 1:159331748-159331770 TGGAGTGAGGGGAGGGGGGAGGG - Intergenic
915875681 1:159609742-159609764 CGGAGTGGGGGGAGGGTGGAGGG + Intergenic
916481621 1:165219435-165219457 TGTTGTGAGTGGAGGGAGGAGGG + Intronic
917176738 1:172244006-172244028 TGGGGTGAGGGGAGGGGGAAGGG - Intronic
917637132 1:176948294-176948316 GGGAGGGAGAGGGGGGAGAATGG + Intronic
917961597 1:180149948-180149970 ATGTGTGTGTGGAGGGAGAAGGG - Intergenic
918056020 1:181022729-181022751 CGGGGTGGGCGGAGGGAGACCGG - Exonic
919180211 1:194070755-194070777 CGGAGTGTGTGAAGAGGGAAAGG + Intergenic
920387401 1:205578722-205578744 CTGAGAGAGGGGAGGGGGAAAGG - Intronic
921357545 1:214299989-214300011 AGGAGAGAGGGGAGGGAGCAAGG + Intronic
921604126 1:217136226-217136248 CGGAGTGAGTGGGAGGGAAAGGG + Intronic
921767015 1:218983812-218983834 CGGAGTGAGTGCCAGGAGCAGGG + Intergenic
922268439 1:224010531-224010553 AGGAGTCAGTGAAGGGAGACAGG - Intergenic
922719477 1:227893029-227893051 GGAAGTGACTGGAGGGAGAGTGG - Intergenic
922722677 1:227906618-227906640 GGGAGTAGGAGGAGGGAGAAGGG - Intergenic
922817267 1:228458789-228458811 CGGAGGGAGGGGATGGAGAGGGG - Exonic
922820786 1:228484067-228484089 AGGAAGGAGTGGAGGGAGAGAGG - Intergenic
923259877 1:232258360-232258382 TGTGGTGAGGGGAGGGAGAAGGG + Intergenic
923514344 1:234681901-234681923 TAGAGAGGGTGGAGGGAGAATGG + Intergenic
923650369 1:235867375-235867397 AGGAGTCAGGAGAGGGAGAAAGG + Intronic
924581898 1:245330559-245330581 GAGAGGGAGTGGAGGGAGAGTGG + Intronic
924581907 1:245330582-245330604 GGGAGGGAGTGGAGGGAGAGTGG + Intronic
924831570 1:247600985-247601007 CCCAGAGAGTGGAGGGTGAAAGG + Intergenic
1063362402 10:5469160-5469182 GGGAGGGAGTGGAGGGAGAAAGG - Intergenic
1063581510 10:7312077-7312099 TGGAGTGGGGGGAGGGAGGAGGG + Intronic
1064165309 10:12980538-12980560 AGGAGGGGGTGGAGGAAGAAAGG + Intronic
1065742608 10:28810849-28810871 CGGGGAGCGGGGAGGGAGAAGGG + Intergenic
1066155452 10:32672103-32672125 AGGAATGTGTGGAGGGAGCATGG + Intronic
1066241356 10:33538866-33538888 GTGAGTGAGTAAAGGGAGAAAGG + Intergenic
1067284766 10:44899469-44899491 CAGAGTGTGTGGAGGAAGGATGG + Intergenic
1067366213 10:45631210-45631232 CGGAGGCAGAGGCGGGAGAATGG + Intronic
1067526309 10:47040817-47040839 TGGAGTAAAGGGAGGGAGAAAGG + Intergenic
1067833214 10:49622012-49622034 AGGAGGGAGGGGAGGCAGAAGGG + Intronic
1068459211 10:57304971-57304993 GAGAGTGAGTGGTGGGAGGAAGG - Intergenic
1070187455 10:74078888-74078910 AGGTGTTGGTGGAGGGAGAAGGG + Intronic
1071461787 10:85903702-85903724 TGGAGAGAGTGGTGGGAGAGGGG - Intronic
1071481565 10:86068917-86068939 GGGGGTGATTGGAGGCAGAATGG - Intronic
1071519261 10:86318999-86319021 CGGAGACAGTGAAGGTAGAAGGG + Intronic
1071541113 10:86485062-86485084 GGGGGTGAGTGGGGGGAGATGGG - Intronic
1071726012 10:88198978-88199000 TGGAATGAGTGCAGGGAGAGAGG - Intergenic
1071748537 10:88448999-88449021 TGCAGTGCGGGGAGGGAGAAGGG + Intronic
1072211839 10:93253259-93253281 CGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1072394473 10:95024683-95024705 TGGAGTGGGGGGAGGGGGAAGGG + Intergenic
1072630997 10:97146461-97146483 AGGAGGGAGTCAAGGGAGAAGGG - Intronic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1073290883 10:102412668-102412690 GGGAGGGAGTGGAGGGACATGGG + Intronic
1073359856 10:102889664-102889686 CGGGGGGGGTGGAGGGAGGAAGG - Intronic
1073500349 10:103931531-103931553 AGGATTGAGTAGAGGGAAAATGG + Intergenic
1073531013 10:104232100-104232122 CGGAGGGAGAGGAGGGAGGAGGG + Intronic
1073546377 10:104353126-104353148 CAGAAAGAGTGGAGGCAGAAGGG + Intergenic
1073597796 10:104817606-104817628 AGGAGGGAGAGGAGGAAGAAGGG - Intronic
1073630290 10:105141404-105141426 CAGAGAGGGTGGAGGGAGATTGG + Intronic
1073685700 10:105751367-105751389 GGGAGTGAAAGGAGAGAGAATGG + Intergenic
1074126237 10:110530708-110530730 AGGGGTGAGTGGAAGGGGAAAGG - Intergenic
1074436950 10:113442351-113442373 CTGAGGTAGTGGAGAGAGAAAGG - Intergenic
1074463162 10:113657161-113657183 CGGGGAGAGTGGAGAGAAAAGGG + Intronic
1076007084 10:126956435-126956457 CTGAGTGAGTGGGAGGAGAGGGG + Intronic
1076377399 10:130000946-130000968 GGGAGTGGGTGGAGGCTGAAGGG - Intergenic
1076738298 10:132468418-132468440 GGGAGTTCGGGGAGGGAGAAGGG + Intergenic
1076898422 10:133325363-133325385 CGGGGTGGGGGGCGGGAGAAAGG + Intronic
1077252876 11:1568322-1568344 CAGAGGGAGGGGAGGGAGGAGGG + Intronic
1077354347 11:2108268-2108290 CAGAGGGAGTGAAGGGAGAGAGG + Intergenic
1077423033 11:2461834-2461856 CTGGGTGGGTGGAGAGAGAAAGG + Intronic
1078706367 11:13747669-13747691 GGGAGGGAGTTGAGAGAGAAAGG - Intergenic
1080366607 11:31581348-31581370 GAGAGTGAATGGAGGTAGAAGGG + Intronic
1080571202 11:33558532-33558554 AGGAGGGTCTGGAGGGAGAAGGG + Intronic
1080729779 11:34937464-34937486 CGGGGTGGGTGGAAGGAGCAAGG + Intronic
1080807533 11:35668100-35668122 TGGAGAGAGTGAAGGGGGAAGGG + Intronic
1080994600 11:37583158-37583180 AGGAGTCAGTGAAGGGAGATGGG + Intergenic
1081201261 11:40218831-40218853 CAGAGTGAGTGTGTGGAGAAAGG - Intronic
1081207351 11:40291677-40291699 GTGCGTGGGTGGAGGGAGAAAGG - Intronic
1081287450 11:41288483-41288505 GAGAGTGGGTGGAGGGAGATAGG + Intronic
1081773938 11:45665327-45665349 CGGAGGAAGAGGAGGGAGGAGGG - Exonic
1081814881 11:45933411-45933433 GGGAGTGGCTGGAGGGAGCAGGG - Intronic
1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG + Intronic
1082834173 11:57639769-57639791 CTTAGGGAGTGCAGGGAGAAAGG - Intergenic
1083477871 11:62925775-62925797 GGGAGGGAGTGGGGGGAGAGAGG - Intergenic
1083508561 11:63185278-63185300 TGGGGTGAGGGGAGGGGGAAGGG - Intronic
1084036703 11:66515709-66515731 CTGAGTGACTGGATGGACAAAGG - Exonic
1084494005 11:69493647-69493669 AGGAGTGAGTGGATGGAGGACGG - Intergenic
1084582540 11:70032886-70032908 GGGAGAGAGAGAAGGGAGAAAGG + Intergenic
1084682364 11:70673784-70673806 CCTAGTGAGTGGAGGGAGGTTGG - Intronic
1084794241 11:71494149-71494171 GGGAGTGAGGGGTGGGTGAATGG - Intronic
1084805775 11:71578015-71578037 AGGAGTGTGTGGAGGGTGTATGG - Intergenic
1084918681 11:72451099-72451121 GGGAGGGAGTGGTGGGAGACGGG + Intergenic
1085200296 11:74697757-74697779 AGGAGGGAGAGGAGGAAGAAAGG + Intronic
1085696008 11:78705274-78705296 CAGAGTCAGTGGAGGGAGAGAGG + Intronic
1085750852 11:79160069-79160091 GTGAGTGAGTGCATGGAGAAGGG - Intronic
1087196565 11:95309771-95309793 CAGAGTCAGTGAAGGGAGATAGG - Intergenic
1087527154 11:99330164-99330186 GGGAGGGAGGGGAGGGAGGAGGG + Intronic
1088339331 11:108745134-108745156 GGGAGTGAGTGGAAGGAGAAGGG - Intronic
1088351264 11:108890963-108890985 CAGAGGGAGAGCAGGGAGAAAGG - Intronic
1088423439 11:109674211-109674233 CTGAGTGAGGGGATGGACAATGG - Intergenic
1089504356 11:118953631-118953653 GGGGGGGATTGGAGGGAGAAGGG + Intronic
1089735934 11:120550283-120550305 TGGAGTGAGTGGGAGGAGGATGG + Intronic
1090785643 11:130044902-130044924 AGGAGGGAGAGGAGGGAGACGGG + Intergenic
1091397968 12:165590-165612 TGGGGCGAGTTGAGGGAGAAGGG + Intronic
1092686952 12:11059154-11059176 ATGAGAGAGAGGAGGGAGAATGG - Intronic
1092943945 12:13436027-13436049 CAGAGGGAGTGGGGGGAAAAGGG - Intergenic
1092996979 12:13959711-13959733 CTGATTGAATGAAGGGAGAAGGG + Intronic
1093094545 12:14957866-14957888 GAGAGAGAGAGGAGGGAGAAGGG + Intronic
1094292180 12:28863807-28863829 GGGAGGGAGGGGAGGGAGGAAGG - Intergenic
1094695524 12:32814464-32814486 GGGAGGGAGAGCAGGGAGAACGG - Intronic
1094713683 12:32990426-32990448 TGGGGTTAGTGGAGAGAGAAGGG - Intergenic
1095051064 12:37554663-37554685 AGGAGTGGGTGGAGGGAACATGG + Intergenic
1095222767 12:39637089-39637111 AGGAGAGAAGGGAGGGAGAAGGG - Intronic
1095841040 12:46693247-46693269 GGGATTGAGGGGAGGGTGAATGG + Intergenic
1096162183 12:49387787-49387809 GGGAGTGTGGGGAGGGAGCAGGG + Intronic
1096700601 12:53380436-53380458 CGGAGGGAAGGGAGGGAGACGGG + Intronic
1097083808 12:56453053-56453075 CTGGGTGAGTGAAGGGAGAGGGG - Exonic
1097086853 12:56475146-56475168 AGGAGTGGGTGTTGGGAGAAGGG + Exonic
1097113416 12:56679709-56679731 CGGAGTGACAGGCTGGAGAACGG + Intronic
1097223416 12:57463191-57463213 CTGAGTGAGGGGAGGGGTAAGGG - Intronic
1097282669 12:57854275-57854297 AGGAGTGCGAGGAGGGAGAGGGG + Intergenic
1097542507 12:60957308-60957330 GAGAGTCAGTGGAGGGAGATAGG + Intergenic
1097925101 12:65118523-65118545 CCGAATGAGTAGAGAGAGAAAGG + Intronic
1098213055 12:68186349-68186371 AGGAGAGGGTGGAGGGAGATTGG + Intergenic
1098527791 12:71506298-71506320 AGGTGTGTGTTGAGGGAGAAGGG - Intronic
1098880613 12:75913687-75913709 GGGAGGGAGTGGAAGGAAAAAGG - Intergenic
1098917866 12:76275899-76275921 CAGAGAGAGGGGAGGGAGGAAGG + Intergenic
1099034538 12:77569374-77569396 GGGAGGGAGAGGAGGGAGATGGG - Intergenic
1099541945 12:83922108-83922130 CTGAGTGAGTGGTGAGTGAATGG - Intergenic
1099561020 12:84174073-84174095 TGGAGGGGGTGGAGGCAGAAGGG + Intergenic
1100679671 12:96906147-96906169 GGGAGTGGGGGCAGGGAGAATGG - Intergenic
1101360554 12:104022289-104022311 CAGAGTGACTGCAAGGAGAAGGG + Intronic
1101443885 12:104723471-104723493 CGGAGTGAGTGTCGGGAAAGGGG - Intronic
1101541582 12:105670431-105670453 TGGAGTGAGTTGAGTGAGGAAGG + Intergenic
1101847969 12:108378595-108378617 GGGAGTGAGGGAAGGGAGCAAGG + Intergenic
1101878005 12:108608154-108608176 CAGAGTGAGTTAGGGGAGAAGGG + Intergenic
1102243652 12:111341614-111341636 AGGAGAGTGAGGAGGGAGAAAGG + Intronic
1102495074 12:113314117-113314139 CGTAGAGAATGGATGGAGAATGG + Intronic
1102991683 12:117320716-117320738 CATAGTGAGTGGAGGGAGAGTGG - Intronic
1103005643 12:117418121-117418143 AGGAGGGAGAGGAGGGGGAAAGG + Intronic
1103048543 12:117759639-117759661 AGGGCTGAGGGGAGGGAGAATGG - Intronic
1103696840 12:122822503-122822525 GGGAGGGAGTGGATGGGGAAAGG - Intronic
1103834465 12:123807905-123807927 GGGAGAGAGAGGAGAGAGAAGGG + Intronic
1103884621 12:124191331-124191353 AGGAGTGAGTGGGGGGAGGGTGG - Intronic
1104010859 12:124929102-124929124 AGGAGTGAGGGGAGGGGGCAAGG + Intergenic
1104357642 12:128101752-128101774 GTGAGTGAGTGAAGGGTGAAGGG - Intergenic
1104939456 12:132388039-132388061 CAGAGAGAGGGGAGGGAGATGGG + Intergenic
1106247441 13:27961596-27961618 AGAAGAGAGTGGAGGCAGAAAGG + Intergenic
1106327430 13:28707400-28707422 TGGAGTGGGGGGAGGGAGGAGGG + Intronic
1107358603 13:39594967-39594989 TGGGGTGGGTGGAGGGAGGAGGG + Intronic
1107437807 13:40396039-40396061 GGAAGTGAGTGGTGGGAGAGCGG - Intergenic
1108708579 13:53011861-53011883 GGGAGTGGGATGAGGGAGAAAGG - Intergenic
1108756037 13:53503408-53503430 CGGGGTAGGTGGAAGGAGAAAGG - Intergenic
1109439855 13:62355311-62355333 GGGAGGGAATGGATGGAGAAAGG + Intergenic
1109993846 13:70095816-70095838 TGGGGGGGGTGGAGGGAGAAGGG - Intronic
1111616765 13:90669845-90669867 TGGGGTGAGTGGAGGGCGGAGGG + Intergenic
1112228146 13:97561280-97561302 TGGAGTGAGTGGGAGGAAAAAGG + Intergenic
1112591351 13:100766035-100766057 GGGAGTGAGTGGAGTTTGAAAGG + Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113595679 13:111530227-111530249 GGGTGGGAGTGGAGGCAGAAAGG + Intergenic
1113618074 13:111695102-111695124 CGGAGAGAGTGGAGGGAGAGCGG - Intergenic
1113623607 13:111780363-111780385 CGGAGAGAGTGGAGGGAGAGCGG - Intergenic
1113646982 13:112005084-112005106 TGCAGTGAGTGGAGGGAGTGGGG - Intergenic
1113654995 13:112062581-112062603 GGGGGTGTGTGGAAGGAGAACGG - Intergenic
1113741380 13:112714463-112714485 CGGGGAGTGAGGAGGGAGAAAGG - Intronic
1113743410 13:112726145-112726167 CGGCGTGCGTGCAGGGAGAGGGG + Intronic
1113813941 13:113158992-113159014 CGGGGAGAGGGGAGGGGGAAAGG + Intronic
1113847014 13:113397994-113398016 CGGGGGGAAGGGAGGGAGAAGGG + Intergenic
1114261395 14:21039162-21039184 GGGAGGGAGTGAAGGGGGAAGGG - Intronic
1114532221 14:23403210-23403232 CGGAGTGAGTGGAGGGAGAAGGG + Intronic
1114599052 14:23939671-23939693 CAGAGTCAGTGAAGGGAGATGGG + Intergenic
1114765065 14:25361458-25361480 TGGAGTGGGTGGAGGGGGCAGGG + Intergenic
1116029181 14:39550342-39550364 CGGGGTGAGGGGAGGGAGGATGG - Intergenic
1116036462 14:39633679-39633701 TGGAGTGAGGGGAGGGGGGAGGG - Intergenic
1117853586 14:60003170-60003192 TGGAGTTAGTGGAGTTAGAATGG + Intronic
1118324104 14:64769833-64769855 CAGAGAGAGAGGAGGGAGCACGG - Intronic
1118477207 14:66128619-66128641 GGGAAGGAGTGGAGGAAGAAGGG - Intergenic
1118803902 14:69217680-69217702 TGGAGTGGGGGGAGGGGGAAGGG - Intronic
1118970689 14:70634914-70634936 CAGAGTGAGTGTGGAGAGAAAGG + Intergenic
1119188677 14:72663738-72663760 GGGAGGGAGAAGAGGGAGAATGG + Intronic
1119229660 14:72970213-72970235 CGGAGTGGGTGGAGGGTCAGAGG - Exonic
1119294267 14:73520528-73520550 CGAAGTGAGAGAAGGGAGAAGGG + Intronic
1120028070 14:79608371-79608393 TGGAAATAGTGGAGGGAGAAAGG + Intronic
1120582553 14:86270813-86270835 GAGAGTGAGTGAAGGGAGATAGG - Intergenic
1121557703 14:94850848-94850870 AGGAAGGAGTGGAGGGAGGAAGG + Intergenic
1121629968 14:95414647-95414669 GGGAAGGAGAGGAGGGAGAAAGG - Intronic
1121709905 14:96030154-96030176 CTGAGTGAGTGGACACAGAAGGG + Intergenic
1122329195 14:100901635-100901657 CAGAGTGAGTGGAAGGAGCGAGG - Intergenic
1122422304 14:101585230-101585252 GGGAAAGAGGGGAGGGAGAAAGG - Intergenic
1122594363 14:102879012-102879034 CCCAGTGAGTGGAGGGTGATGGG + Intronic
1122915113 14:104854985-104855007 AGGGGGGAGTGGAGGGTGAATGG + Intergenic
1122915192 14:104855188-104855210 AGGGGTGAATGGAGGGAGAGTGG + Intergenic
1122915237 14:104855339-104855361 AGCAGGGAGTGGAGGGTGAAGGG + Intergenic
1122915258 14:104855398-104855420 AGGGGTGAATGGAGGGAGAGTGG + Intergenic
1122925482 14:104897635-104897657 CGCAGGGAGTGGAAGGACAAGGG - Intergenic
1123181326 14:106473227-106473249 GGGGGTGAGTGGAGGGGAAATGG - Intergenic
1202945569 14_KI270726v1_random:23473-23495 GGGGGTGAGTGGAGGGGAAATGG + Intergenic
1124787850 15:32698674-32698696 CAGAGTGGCTGGAAGGAGAAGGG + Intergenic
1125437698 15:39665069-39665091 CGATGGGAGTGGTGGGAGAAGGG - Intronic
1125822751 15:42646940-42646962 AGGCCTGAGTAGAGGGAGAAAGG + Intronic
1126115897 15:45207270-45207292 AGGAGAGAGTGGAGGGTGAGAGG + Intergenic
1126348067 15:47717400-47717422 CCGAGTGCGTGGAGGGAGCCAGG + Intronic
1126799270 15:52285458-52285480 AGGAGGGAGAGGAGGGAGACGGG - Intronic
1126800453 15:52293269-52293291 AGGAGTGAGAGGAAGCAGAAGGG - Intronic
1127298996 15:57634288-57634310 GGGAGGAAGTGGTGGGAGAAAGG + Intronic
1127908107 15:63392191-63392213 AGGAGTGAGTGGGAGGAGGATGG - Intergenic
1128118129 15:65125285-65125307 AGGAGTGAGTAGAAGGGGAAGGG - Intronic
1128285387 15:66432342-66432364 AGGAGGTAGAGGAGGGAGAAAGG + Intronic
1128332402 15:66764058-66764080 CTGAGTGAGTGGTGGGTGATTGG + Intronic
1128350420 15:66884898-66884920 CGGAGTGAGGGGAGCTAGATGGG + Intergenic
1128350744 15:66886841-66886863 CGAGGTGAGTGGGGGCAGAAGGG + Intergenic
1128591976 15:68906216-68906238 CCCAGGGAGTGGAGGGAGATGGG - Intronic
1128637793 15:69314301-69314323 AGGAGGGACAGGAGGGAGAAGGG - Intronic
1129234269 15:74214349-74214371 TGGGGTGAGTGGAGGGAGGCAGG - Intergenic
1130091789 15:80827277-80827299 GGGAGTGAGTAGTGGGAGAAGGG + Intronic
1130398315 15:83524647-83524669 CGGGGTGAGGGGATGAAGAAAGG - Intronic
1130855996 15:87840725-87840747 GGGAGGGAGGGGAGGAAGAAAGG + Intergenic
1131039550 15:89250545-89250567 TGGAGTGAGGGGAGGGGGGAGGG + Intronic
1131176122 15:90210843-90210865 AGGAGTGAGTGGAAGGTGAGAGG + Intronic
1131529378 15:93179008-93179030 AGGAGGGAGTTGAGGGGGAAGGG + Intergenic
1131646273 15:94348466-94348488 CAGAGAGAGAGGAGAGAGAAAGG - Intronic
1132340071 15:101072809-101072831 GGGAGTCAGTGAAGGGAGATAGG - Intronic
1132343510 15:101092753-101092775 CTCAGTGAGAGGAGGGAGACAGG + Intergenic
1133215800 16:4291737-4291759 CAGAGAGAGTGGAGGGTCAAAGG + Intergenic
1133507477 16:6426297-6426319 GGGAGAGAGAGAAGGGAGAAGGG + Intronic
1133589554 16:7229562-7229584 GGGAGGGAGGGGAAGGAGAAAGG + Intronic
1134040394 16:11063965-11063987 AGGAGGGATTGGAGGAAGAAAGG + Intronic
1134183412 16:12065049-12065071 CTGAGTGTTGGGAGGGAGAAAGG + Intronic
1134268842 16:12715977-12715999 GGAAGAGAGTAGAGGGAGAAGGG + Intronic
1134350595 16:13434279-13434301 CTGAGTCAGTGGACTGAGAAAGG - Intergenic
1134534081 16:15011285-15011307 CTGAGTAATTCGAGGGAGAAAGG + Intronic
1134690609 16:16188835-16188857 ACGAGGGAGTGGATGGAGAAGGG + Exonic
1135063764 16:19292074-19292096 GGGGCTGAGTGGAGTGAGAAGGG - Intronic
1135258527 16:20961345-20961367 TGGGGTGCGGGGAGGGAGAAAGG + Intronic
1135484653 16:22853532-22853554 GGGAGTGAGGGGAGGAAGAGGGG - Intronic
1135812238 16:25598763-25598785 CAGAGTGAGTGAGGGGAGAGTGG + Intergenic
1135951013 16:26914116-26914138 CTGAGTGAATGGTGGGAGAACGG + Intergenic
1135986726 16:27189600-27189622 CGAAGTGAGTGCTGGGAGCAGGG - Intergenic
1136026305 16:27471150-27471172 CTGAGTGCGGGGAAGGAGAATGG + Intronic
1136037843 16:27554013-27554035 GGGAGGGAGAGGAGAGAGAAAGG + Intronic
1136246336 16:28978315-28978337 AGGAATGAGAGGAGGGAGAGAGG - Intronic
1136590159 16:31213836-31213858 AGGTGGGAGTGGGGGGAGAAAGG + Intergenic
1136935645 16:34461371-34461393 GGGAGGGAGGGAAGGGAGAAAGG - Intergenic
1136964173 16:34887199-34887221 GGGAGGGAGGGAAGGGAGAAAGG + Intergenic
1137049951 16:35700636-35700658 TGGAGTGGGTGGAGGGGGTAGGG + Intergenic
1137963908 16:52912225-52912247 GGGAGTGGTGGGAGGGAGAAAGG + Intergenic
1138027574 16:53534435-53534457 GTGAGTGAGTGGAGGGGGAGGGG + Intergenic
1138159860 16:54743456-54743478 TGGAGGCAGTGCAGGGAGAAAGG - Intergenic
1138215469 16:55201414-55201436 GGGAGGGAGGGGAGGAAGAAAGG - Intergenic
1138560781 16:57799904-57799926 CTGAGCCTGTGGAGGGAGAAGGG + Intronic
1138699503 16:58847048-58847070 CAGAGGGAGAGGAGGGAGAGGGG + Intergenic
1138781089 16:59788009-59788031 GGGAGGGAGTGGAGGCAGATTGG - Intergenic
1139552225 16:67680552-67680574 GGAAGTGAGAGGAGGGGGAAGGG - Intronic
1139652501 16:68369499-68369521 GGGAGTGAGGGGTGGGAGTAAGG + Intronic
1139755716 16:69141979-69142001 CGGGGTGAGGGGAGGGGGGAGGG - Intronic
1139861955 16:70029442-70029464 CTGAGTAATTCGAGGGAGAAAGG - Intergenic
1139999225 16:71009867-71009889 CGGAGGGAGCAGAGGGAGAGTGG + Intronic
1140859771 16:79008683-79008705 TGGAGGGAGTGAAGGGAGTAGGG - Intronic
1141141661 16:81500409-81500431 GGGAGGGAGGGGAGGGAGGAGGG - Intronic
1141169071 16:81679950-81679972 AGGAGTTTGTGGAGCGAGAAAGG - Intronic
1141757784 16:86004020-86004042 TGGAGAGAGAGGAGGCAGAAGGG + Intergenic
1141927400 16:87178513-87178535 GGCAGAGAGAGGAGGGAGAAAGG - Intronic
1141927408 16:87178546-87178568 GGCAGAGAGAGGAGGGAGAAAGG - Intronic
1142020770 16:87780856-87780878 AGGCGTGGGTGGAGGGAGGAAGG - Intergenic
1142535726 17:616588-616610 CCGAGTGAGTTCAGGCAGAAAGG + Intronic
1143326511 17:6102035-6102057 CGCAGGGAGAGGAGGAAGAAAGG + Intronic
1144084322 17:11794924-11794946 TGGGGTGGGGGGAGGGAGAAGGG + Intronic
1144235651 17:13258025-13258047 AGGAGGCAGTGGAGGGGGAAGGG - Intergenic
1144513936 17:15902028-15902050 GGGGCTGAGGGGAGGGAGAATGG - Intergenic
1144678279 17:17175645-17175667 GGGAGTGGGTGGAGTGAGATGGG - Intronic
1145772320 17:27502345-27502367 CCCAGTGGGTGGAGGGAGAGTGG + Intronic
1145925583 17:28644673-28644695 AGGGGTGGGTGGAGGGGGAAAGG + Intronic
1146273123 17:31497567-31497589 CGGAGAGAGAGGAGGAAGAGTGG + Intronic
1146329497 17:31916369-31916391 CGGAGGCTGTGGAGGGAGAATGG - Intergenic
1147216476 17:38902164-38902186 CGGAGTCTGAGGTGGGAGAATGG - Intronic
1147430317 17:40366858-40366880 TGGAGGGAGTGGTGGGTGAAGGG - Intergenic
1148221335 17:45864659-45864681 CATAGAGAGGGGAGGGAGAAAGG - Intergenic
1148491323 17:48025588-48025610 CGGAGGGACAGGAGGGTGAAAGG - Intergenic
1148638379 17:49166359-49166381 GGGAGGGAGGGGAGGGAGAGGGG + Intronic
1148684962 17:49495986-49496008 CGGAGGGACTGGAGGCAGAGGGG + Intronic
1149420174 17:56502887-56502909 GGGAGTAGGTGGATGGAGAATGG + Intronic
1149762031 17:59240853-59240875 CTGAGTGAGTGGTGAGTGAATGG - Intronic
1149891272 17:60392175-60392197 AGGAGAGAGAGGAGAGAGAAGGG - Intronic
1150697735 17:67420371-67420393 GGGAGGGAGGGGAGGGAGGAAGG - Intronic
1150857862 17:68770467-68770489 TGGAGTGGGGGGAGGGAGGAAGG - Intergenic
1150859828 17:68790189-68790211 TGTAGTGAGGGGAGGGAAAAGGG - Intergenic
1151569828 17:74920727-74920749 TGGAGGGAGTGGAGGGGGGAGGG + Intronic
1151655655 17:75494823-75494845 CAGAGTTAGTGGTGGCAGAAGGG - Intronic
1151724247 17:75875365-75875387 CAGTGTGAGTGGAGGGGGCACGG + Intronic
1152249315 17:79203346-79203368 GGGGGTGGGTGGAGGGCGAAGGG + Intronic
1152249328 17:79203384-79203406 GGGGGTGGGTGGAGGGCGAAGGG + Intronic
1152249341 17:79203422-79203444 GGGGGTGGGTGGAGGGCGAAGGG + Intronic
1152249354 17:79203460-79203482 GGGGGTGGGTGGAGGGCGAAGGG + Intronic
1152249379 17:79203536-79203558 GGGGGTGGGTGGAGGGTGAAGGG + Intronic
1152249392 17:79203574-79203596 GGGGGTGGGTGGAGGGTGAAGGG + Intronic
1152249405 17:79203612-79203634 GGGGGTGGGTGGAGGGTGAAGGG + Intronic
1152493412 17:80653549-80653571 CGGGGTGAGTGCAGGCAGAGTGG + Intronic
1153580829 18:6571664-6571686 CAGAGAGAGTGGAAGAAGAAAGG - Intronic
1153762449 18:8344914-8344936 GGGAGAGGGAGGAGGGAGAAGGG + Intronic
1154971625 18:21415541-21415563 GAGAGCGAGGGGAGGGAGAATGG + Intronic
1155186207 18:23388813-23388835 AGGAGAGAATGAAGGGAGAAGGG - Intronic
1155586280 18:27369423-27369445 CGGAGGGAGGGAAGGAAGAAAGG + Intergenic
1155590379 18:27420632-27420654 AGAAGTGAGTGTAGAGAGAAGGG + Intergenic
1155980143 18:32171268-32171290 GGGAGTGAGAGAAAGGAGAAAGG - Intronic
1156036002 18:32769569-32769591 CGGAGGGAGGGGAGGGGGCAGGG - Intronic
1156276272 18:35585628-35585650 AGGAGGGGGTGGAGGTAGAAGGG - Intronic
1156682302 18:39605848-39605870 TGGAGTAAGGGGAGGGAAAAGGG - Intergenic
1156848538 18:41698672-41698694 CCCAGGGAGTGGAGGGAGATAGG + Intergenic
1157411633 18:47467844-47467866 AGGTGTGAGTGGAGGAAGCAAGG - Intergenic
1157464370 18:47931014-47931036 CGGAGGGAGCGGAGGAGGAAAGG + Intronic
1158333901 18:56394002-56394024 CTGAGTGAGAGCAGAGAGAAAGG - Intergenic
1158793924 18:60818415-60818437 TGGGGTGGGGGGAGGGAGAAGGG - Intergenic
1158846839 18:61453157-61453179 AGGAGTGAGTGGAGGTGGGAGGG - Intronic
1159084218 18:63769969-63769991 CAGTGTGAGTGGAAGGGGAAGGG + Intronic
1159544968 18:69828918-69828940 AGGAGAGAGTGAAGGGAGAAGGG + Intronic
1160017599 18:75156536-75156558 AGGAGTGAATGTAGGGAGGATGG + Intergenic
1160163686 18:76493269-76493291 CGAAGGGAGTGGAGGCGGAAAGG + Intronic
1160218271 18:76953287-76953309 AGCAGTGAGTGAAGGAAGAAAGG - Intronic
1160940515 19:1618519-1618541 CAGAGTGAGGAGAGGGAGAGAGG - Intronic
1161034515 19:2077006-2077028 CGGAGTGCCTGCAGGGAGAGGGG + Exonic
1161139669 19:2639916-2639938 AGGAGGGAGTGAAGGAAGAAAGG + Intronic
1161142248 19:2654629-2654651 CTGAGTGGGGGGAGGGAGAGAGG + Intronic
1161257301 19:3316494-3316516 CAGAGTGAGGAGGGGGAGAAAGG + Intergenic
1161262334 19:3344956-3344978 CGGAGGGAGGAGAGGGAGAGAGG + Intergenic
1161551725 19:4916706-4916728 CGGAGGGAGAGAAGGGAGGAAGG - Intronic
1161803497 19:6429341-6429363 AAGAGGGAGAGGAGGGAGAAAGG + Intronic
1161860146 19:6791923-6791945 GGGAGTGAGTGGAGGGAGAGTGG + Intronic
1161913892 19:7214798-7214820 GGGAGGGAGGGGAGGGAGGAGGG - Intronic
1161919783 19:7257446-7257468 CGGGGTGGGAGGAGGGAGGAGGG + Intronic
1162431387 19:10631033-10631055 TGGAGTTAGAGAAGGGAGAATGG - Intronic
1162943503 19:14028404-14028426 GGGAGAGAGTGGATGTAGAAGGG + Intronic
1163509894 19:17728088-17728110 CGGAGTGAGCCCAGTGAGAAGGG + Exonic
1163611561 19:18304473-18304495 GGGAGTGAGAGGAGGGGGATGGG + Intergenic
1163763703 19:19150788-19150810 CAGAGTGAGTGGGTGGAGAGTGG + Intronic
1163827840 19:19533531-19533553 AGGAGGGAGAGGAAGGAGAAAGG - Intronic
1164292717 19:23881935-23881957 CGGAGGAAGAGGAGGAAGAAAGG + Intergenic
1164534790 19:29077007-29077029 CTGAGTGTGTGGTGGGGGAAAGG - Intergenic
1164581816 19:29439357-29439379 GGGGGTGATGGGAGGGAGAAAGG + Intergenic
1164866849 19:31611517-31611539 AGGAGAGAGAGGAGGGGGAAAGG + Intergenic
1164866855 19:31611537-31611559 AGGAGAGAGAGGAGGGGGAAAGG + Intergenic
1165768995 19:38367606-38367628 TGGAGGGAGTGGAAGGAGATGGG + Intronic
1165847416 19:38827114-38827136 GGGAGGGAGGGGAGGGAGAAAGG + Intronic
1165868292 19:38952521-38952543 TGGGGAGGGTGGAGGGAGAATGG - Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166500979 19:43341068-43341090 GAGAGTGAGGGGAGAGAGAAAGG - Intergenic
1166509116 19:43392380-43392402 GAGAGTGAGGGGAGAGAGAAAGG + Intergenic
1166533659 19:43557831-43557853 GGGAAGGAGGGGAGGGAGAATGG + Intronic
1166571376 19:43799028-43799050 CGCTGAGACTGGAGGGAGAAGGG - Intronic
1166690345 19:44818677-44818699 AGGAGTGAGGGGAGAGAGGAGGG - Intronic
1166878070 19:45910111-45910133 AGGAATGTGGGGAGGGAGAAAGG + Intergenic
1166890552 19:45989689-45989711 AAGAGTGAGTGAAGAGAGAAAGG - Intergenic
1166980614 19:46630042-46630064 GGCAGTGAGTGGATAGAGAAAGG - Intergenic
1167296179 19:48651405-48651427 TGGAGTCTGTGGAGGGAGTATGG + Intergenic
1167486511 19:49766348-49766370 GGGTGACAGTGGAGGGAGAAAGG + Intergenic
1167621765 19:50564703-50564725 CAGAGAGAGTGGGGTGAGAAGGG + Intronic
1168251592 19:55145369-55145391 AGGAGGGAGAGGAGGGAGGAGGG + Intronic
925363382 2:3295050-3295072 AGGTGTGTGTGGAGAGAGAATGG - Intronic
925477903 2:4239101-4239123 TGGAGTGGGGGGAGGGGGAAGGG + Intergenic
926104558 2:10142159-10142181 CAGAGTGAGGGGTGGGAGATGGG + Intronic
926361982 2:12097721-12097743 GAGAGTGAGAGGAGGGAGAGTGG + Intergenic
926777357 2:16435704-16435726 CAGAGTTAGGGGAGGGAGAATGG - Intergenic
926786045 2:16519376-16519398 GGGTGTGAGTGAGGGGAGAAAGG + Intergenic
926871167 2:17419212-17419234 AGGAGTGGGTTGGGGGAGAAGGG + Intergenic
927238758 2:20901734-20901756 TTGGCTGAGTGGAGGGAGAAGGG - Intergenic
928083931 2:28334006-28334028 CGGAGTGGGAGGAGGGGGAAAGG - Intronic
928384213 2:30850851-30850873 TGGGGTGAGGGGAGGGAGGAGGG + Intergenic
928424876 2:31169536-31169558 CAGAGTGAGTGGTGGGAGGTGGG - Intergenic
928512447 2:32014040-32014062 GGGAGGGAGGGGAGGGAGGAAGG + Intronic
928538034 2:32258779-32258801 CAGAGTGTGTGGAGGAGGAAGGG - Intronic
928577393 2:32668972-32668994 CGGAGTCTGTGGCAGGAGAATGG + Intronic
928931880 2:36633315-36633337 GGGAGGGAGGGGAGGGAGAAAGG - Intronic
928958664 2:36898878-36898900 AGGAGAGAGAGAAGGGAGAAGGG + Intronic
929385356 2:41400212-41400234 CTGAGTGAGAGGTGGGACAAAGG + Intergenic
929666541 2:43838386-43838408 TGGAGAGAGGAGAGGGAGAAGGG - Intronic
930096283 2:47569538-47569560 CGCCGAGGGTGGAGGGAGAAGGG + Intronic
930639534 2:53840615-53840637 GGGAGGGAGTGGAGGGGGGAGGG + Intergenic
930793270 2:55357377-55357399 AGGAGAGAGAGGAGGGAGAGAGG - Intronic
931223141 2:60306306-60306328 GGGTGGGAGTGGAGGGAGGAAGG - Intergenic
931267545 2:60673870-60673892 AAGAGTTAGTGGAGGGAAAATGG + Intergenic
931685041 2:64785411-64785433 CGGAGTGAGGGCAGGCAGAAAGG + Intergenic
931860256 2:66347025-66347047 TGGGGTGAGGGGAGGGGGAAGGG - Intergenic
932322183 2:70830403-70830425 CTAAGGGAGTGGAAGGAGAAGGG + Exonic
932336663 2:70935684-70935706 TGGAGGATGTGGAGGGAGAAGGG - Intergenic
932480068 2:72033726-72033748 CGGCTGGAGAGGAGGGAGAAGGG - Intergenic
932913540 2:75830573-75830595 GGGAGAGAGTGCAGGGAGAAAGG + Intergenic
933716162 2:85362394-85362416 GGGAGTGAGGGGAGGGTGTATGG + Intronic
933764706 2:85698682-85698704 GGGAGTCAGGGGAGGGAGACTGG - Exonic
933991843 2:87639589-87639611 AGGAGTAAGTGGGGAGAGAAAGG - Intergenic
934502798 2:94872818-94872840 CTGAGAGAGTGCAGGGGGAAGGG - Intronic
934888405 2:98045124-98045146 CAGAGTGAGTGCAAGGACAAGGG + Intergenic
935685871 2:105682050-105682072 CGGAGAGAGTGGAGGGAAACAGG + Intergenic
936751195 2:115644303-115644325 CGGAGTGGGCGGAGGGGGGAGGG - Intronic
937019070 2:118633804-118633826 GGGAGGGACTGGAGGGAGATTGG - Intergenic
937239888 2:120453218-120453240 GGGTGGGAGTGGAGGGCGAAGGG - Intergenic
937787637 2:125921047-125921069 CGGAGTAAGTGTAGGGAAAAAGG - Intergenic
937903169 2:127038138-127038160 AGGAGAGTGTGGAGGGAGAGAGG - Intergenic
937911452 2:127077607-127077629 CGGAGAGAGAGGTGGGAGCAGGG + Intronic
937913466 2:127087530-127087552 CAGCGTGAGTGGAGGCAGCAGGG + Intronic
938391427 2:130909512-130909534 AGGAGTGAGGAGAGGCAGAAGGG + Intronic
941263272 2:163323992-163324014 AGGAGTGAGGGCTGGGAGAAAGG + Intergenic
941777386 2:169407709-169407731 GAGATTGAGTGGAGAGAGAAAGG - Intergenic
942785234 2:179693328-179693350 CTGAATGACTGAAGGGAGAAGGG + Intronic
943952324 2:194146805-194146827 GGGTGTCAGTGGAGGCAGAAGGG + Intergenic
944091126 2:195912901-195912923 AGGCTTGAGTTGAGGGAGAAGGG + Intronic
944797241 2:203199812-203199834 GGGAGGGAATGGAGGGAGGAAGG - Intronic
945027909 2:205637047-205637069 AGGAGGGAGGGGAGGGAGAGGGG - Intergenic
945872483 2:215243040-215243062 AAGAGTGAGTGCAGGGAGATAGG - Intergenic
945929762 2:215843037-215843059 CAGAGTGAGAGGAGGGAGAGTGG - Intergenic
946174429 2:217913743-217913765 TGGAGTGGCTGGAGGGAGAAGGG - Intronic
946603386 2:221375168-221375190 CTGAGTGTGAGGAGGAAGAAAGG + Intergenic
946625149 2:221603706-221603728 AAGAGTGAGTGGTGGGAAAATGG + Intergenic
946884780 2:224211988-224212010 GGGTGGGAGTGGAGGGAGGAGGG - Intergenic
947258982 2:228199277-228199299 TGGAGTGGGGGGAGGGAGGAGGG - Intergenic
947647402 2:231753444-231753466 CGGAGGGTGAGGCGGGAGAATGG + Intronic
947751499 2:232535094-232535116 CAGAGAGAGTGGGGTGAGAAGGG - Intronic
947926512 2:233926435-233926457 GGGAGAGGGTGGAGGGAAAACGG + Intronic
948282738 2:236760350-236760372 GGGAGGGAGAGGAGGGAGGAAGG + Intergenic
1168852592 20:986807-986829 CCAAGTGTGTGGAGGGAGAATGG + Intronic
1168856492 20:1012860-1012882 GGGAGGGAGTGGAGGGAGCAAGG + Intergenic
1168955980 20:1834691-1834713 AAGGGTGAGAGGAGGGAGAAGGG + Intergenic
1169165759 20:3422165-3422187 CTGAGGGAGTGGAGGGACAATGG + Intergenic
1169287085 20:4318447-4318469 TGGACTGAGTGGAGGAGGAAGGG - Intergenic
1169387676 20:5165005-5165027 GGGAGAGAGTGTTGGGAGAAAGG + Intronic
1170466667 20:16628387-16628409 TGAATTGAGTGGTGGGAGAAAGG + Intergenic
1170598576 20:17823605-17823627 AGGAGGGGGAGGAGGGAGAAGGG - Intergenic
1170745752 20:19097583-19097605 CAGAGTGAGAAGAGGGAGAGGGG + Intergenic
1170759813 20:19239578-19239600 TGAAGTGAATGGAGGAAGAAAGG - Intronic
1170825672 20:19792772-19792794 CGGGGTGATTTGAGGGAGGAGGG + Intergenic
1170963818 20:21049045-21049067 CTGGGAGGGTGGAGGGAGAATGG + Intergenic
1171019459 20:21572084-21572106 TTGAGGGAGTGGAGAGAGAAGGG + Intergenic
1171545590 20:25998115-25998137 AGGAGTGGGTGGAGGGAACATGG + Intergenic
1171763184 20:29231275-29231297 TGGGGTGAGGGGAGGGGGAAGGG + Intergenic
1172572147 20:35979114-35979136 TGCAGTGAGTGAAGGGAAAATGG + Intronic
1173149957 20:40558574-40558596 GGGAGGGAGGGGAAGGAGAAAGG + Intergenic
1173508976 20:43611214-43611236 CAGAGTGAGAGAAGGGAGAAGGG - Intronic
1173821985 20:46025553-46025575 GGGGGTGAGTGCAGTGAGAAAGG + Intronic
1173912570 20:46681190-46681212 AGGAGTGAGTGAAGAGAGAATGG + Intronic
1174156932 20:48521697-48521719 AGGAGTGAGTGGTGGGAGGTGGG - Intergenic
1174200292 20:48802346-48802368 TAGAGTGAGTGAGGGGAGAATGG - Intronic
1174302103 20:49589863-49589885 CTGAGTGAGTTGGGGGAGAGTGG - Intergenic
1174318061 20:49718184-49718206 CAGAGTGAGGGCAGGGAGGAAGG - Intergenic
1174781975 20:53397980-53398002 TGGAGTGGGGGGAGGGGGAAGGG + Intronic
1175120140 20:56710771-56710793 AGGAGGGAGAGGAGGGAGAGGGG - Intergenic
1175691897 20:61071521-61071543 CTGAGTAAGTGGAGGGTGAGAGG + Intergenic
1175921385 20:62451979-62452001 AAGAGGGAGAGGAGGGAGAAGGG + Intergenic
1175958463 20:62623191-62623213 CGGAGGCTGTGGAGGGAGGACGG - Intergenic
1176384004 21:6127956-6127978 AGGAGAGAGAGGAGGGAGAGAGG + Intergenic
1176652652 21:9564564-9564586 GGGTGTGAGTGGAGCCAGAAGGG + Intergenic
1177164670 21:17586879-17586901 TGGGGTGAGGGGAGGGAGGAGGG - Intronic
1177833566 21:26167248-26167270 GGGAGTAAGGGGAGGGAGGAGGG + Intronic
1178441250 21:32600392-32600414 GGGAGTGAGTGGAGGTGGCAGGG - Intronic
1178767529 21:35468387-35468409 GGGAGAGAGTGTAGAGAGAATGG + Intronic
1178902080 21:36606114-36606136 GGGAGTGAGAGGAGGGTGAAGGG - Intergenic
1179739470 21:43410282-43410304 AGGAGAGAGAGGAGGGAGAGAGG - Intergenic
1179958018 21:44751875-44751897 TGGAGGGGGCGGAGGGAGAAAGG - Intergenic
1181167903 22:20993129-20993151 CAGAGTCAGTGGAGGGAGCCGGG + Intronic
1181274838 22:21681806-21681828 GGGAGTGGGTGTAGGGAGAGGGG + Intronic
1181600901 22:23951414-23951436 AGCAGTCTGTGGAGGGAGAATGG + Intergenic
1181607612 22:23989912-23989934 AGCAGTCTGTGGAGGGAGAATGG - Intergenic
1181631118 22:24151892-24151914 AGGACTGAGTGGAGGAAGGATGG - Intronic
1181963483 22:26640040-26640062 AGGAGGGGGTGGAGGGGGAAAGG - Intergenic
1181975564 22:26726903-26726925 CTGAGGGAGTAGAGGGACAAAGG + Intergenic
1182090895 22:27594137-27594159 GGGAGGGACTGGAGGGAGGAAGG + Intergenic
1182196781 22:28527257-28527279 GGGAGTGAGTAGAGGGAGTTGGG - Intronic
1182288330 22:29260688-29260710 CGGAGTGAGGTGAGGGTGATGGG - Exonic
1182409347 22:30169757-30169779 GGGAGTGAGAGGTGGGAAAATGG - Intronic
1182905282 22:33930779-33930801 CGGAGTGGGGGGTGGGAGGAAGG - Intergenic
1183301069 22:37059477-37059499 CGGGGAGGGTGGAGGGAGACAGG - Intronic
1183490836 22:38114859-38114881 TGCAGTGAGTGCAGGCAGAACGG + Intronic
1183545156 22:38451526-38451548 TGGAGAGAAGGGAGGGAGAAAGG + Intronic
1183777272 22:39974773-39974795 GGGAGAGAATGCAGGGAGAAAGG - Intergenic
1184317813 22:43710847-43710869 GGGAGTCAGGGGAGGGAGATAGG + Intronic
1184384739 22:44167603-44167625 TGGAGGCAGGGGAGGGAGAATGG - Intronic
1185051199 22:48555177-48555199 CCGAGTGAAGGGAGGGAGGATGG + Intronic
1185056358 22:48580657-48580679 CGGTGTGTGTGGAAGGAGGAGGG + Intronic
949729488 3:7092111-7092133 CGGAGGTTGAGGAGGGAGAATGG - Intronic
949826876 3:8174873-8174895 TGGGGTGAGAGGAGGAAGAAGGG - Intergenic
949917746 3:8977605-8977627 TGGGGTGGGTGGAGGGAGAGTGG + Intergenic
950039285 3:9909432-9909454 TGGAGTCAGTGGGGGGAAAAGGG + Intronic
950465552 3:13151279-13151301 GGGAGTGACTGGGGGCAGAAGGG - Intergenic
950955008 3:17043320-17043342 AGGCTTGAGTAGAGGGAGAATGG + Intronic
951206849 3:19934396-19934418 GGGAGAGAGAGGAGAGAGAAGGG - Intronic
951508655 3:23477927-23477949 CAGAGTGACAGGAGAGAGAAGGG - Intronic
951534104 3:23726010-23726032 GGGAGGGAGGGGAGGGAGAGAGG + Intergenic
952186326 3:30973542-30973564 CTGAGTGAGTGGGGGGATAGTGG - Intergenic
952470919 3:33650743-33650765 GGGAGAGACTGGAGGAAGAAAGG + Intronic
952502114 3:33973139-33973161 GGGAGTGGGTGGAGAGAGAGAGG + Intergenic
952810246 3:37396240-37396262 AGGAGTGAGTGGAGGTTGGATGG - Intronic
953539016 3:43798055-43798077 TGGAGTGAGTGGTGGGAGATAGG + Intergenic
954196898 3:49002340-49002362 CAAAGTGAGTGCAGGTAGAAAGG - Intronic
954225827 3:49180448-49180470 CTGAGTGACTGGAGAGGGAATGG - Intronic
954414641 3:50387256-50387278 TGCAGTGAGAGGAGGGAGACAGG - Intronic
954953183 3:54492885-54492907 CGGAGTGAGCCCAGAGAGAATGG + Intronic
954991376 3:54843503-54843525 GGCAGTGAGTGGAGGGAGGCAGG + Intronic
955224544 3:57050130-57050152 AGAAGGGAGTGGAAGGAGAAGGG - Intronic
955365587 3:58307151-58307173 GGGATTGAGCGGAGGGAGAATGG + Intronic
956395030 3:68816165-68816187 TGGAGTGGGGGGAGGGAGGAGGG + Intronic
956796358 3:72722186-72722208 AGGAGAGAGAGAAGGGAGAAAGG + Intergenic
956850998 3:73228106-73228128 GGGAGAGAGAGGAGGGAGAGAGG - Intergenic
957059413 3:75470001-75470023 CAGAGTCAGTGAAGGGAGATAGG + Intergenic
958165896 3:89877418-89877440 AGGGGTGAGTGGAGGGAAAGAGG + Intergenic
959469640 3:106734423-106734445 AGTAGTGAGAGGAGGAAGAAAGG - Intergenic
959611653 3:108301723-108301745 CTGCTTGAGTTGAGGGAGAAAGG - Intronic
960943696 3:122952016-122952038 GGGAGGGAGTGGGGGGAGAAGGG - Intronic
961640309 3:128360728-128360750 GGGTGGGAGTGGAGGGAGGAGGG + Intronic
962203439 3:133417327-133417349 CGGGGTGAGTGGAGGGGAGATGG - Intronic
962464894 3:135649036-135649058 AGTAGTGAGGGGAGGGAGATGGG + Intergenic
962676941 3:137764559-137764581 GGGAGCGAGTGGGGGCAGAAAGG - Exonic
962865697 3:139446646-139446668 CGGAGTGGGTGGGGAGAGATAGG - Intergenic
962952213 3:140229636-140229658 CTGAGTGAGTGAAGGAGGAAGGG + Intronic
963542991 3:146618032-146618054 TGGAGTGGGTTGAGGGAGTATGG - Intergenic
964282383 3:155080231-155080253 AAGAGTGAGGGGAGGGAGAGGGG + Intronic
964468565 3:157026237-157026259 CAGAGTGAGAGGAAGAAGAAAGG - Intronic
964936761 3:162098624-162098646 CCGAGTCTGAGGAGGGAGAAAGG + Intergenic
964963441 3:162457641-162457663 TGGGGTGAGGGGAGGGGGAAAGG + Intergenic
965117939 3:164515436-164515458 CAGAGTGAGTGCTGGGAGCAGGG + Intergenic
965739746 3:171861594-171861616 GGGACGGAGGGGAGGGAGAAAGG + Intronic
965749904 3:171965210-171965232 GGGGCTGAGTGGAGGGGGAAGGG + Intergenic
965822382 3:172697664-172697686 TGGAGGGAGAGGAGGGAGAAGGG + Intronic
966085124 3:176061648-176061670 CTGAGTCAGTGAAGGGAGATAGG - Intergenic
966371441 3:179254222-179254244 CGGTGTGGGTGAAGGGAGAGGGG - Intronic
966444398 3:179985794-179985816 GGGACTGAGGGGAGGCAGAAAGG - Intronic
966937098 3:184717782-184717804 CCGGGTGGATGGAGGGAGAAGGG + Intergenic
967070769 3:185960742-185960764 CGGAGTGAGAGGAGGGTGGCAGG - Intergenic
967350764 3:188511304-188511326 GGGAGAGAGGGGAGGGAGGAAGG - Intronic
967417023 3:189230480-189230502 CAAAGAGAGTGGAGGGAGATTGG - Intronic
968436515 4:593255-593277 GGGAGTGAGTGTAGACAGAAGGG - Intergenic
968546229 4:1200392-1200414 GGGAGCAAGTGGAGGGAGGAAGG + Intronic
968820697 4:2848571-2848593 CAGAGTCAGAGGTGGGAGAATGG - Intronic
969004101 4:4005508-4005530 AAGAGTGAGTGAAGGGAGATGGG + Intergenic
969173759 4:5384126-5384148 CGAAGTGAGTGGAAGGAGGATGG + Intronic
969432335 4:7162709-7162731 CTTAGGGAGTGGAGGAAGAAGGG + Intergenic
969526974 4:7708813-7708835 CTGAGGGAGTGGTGGGAGGATGG + Intronic
970486724 4:16532111-16532133 GGGAGTAAGTGGAAAGAGAAGGG - Intronic
970520857 4:16882469-16882491 GGGAGAGAATGGAGGGGGAATGG - Intronic
970546429 4:17134746-17134768 AGGATAGACTGGAGGGAGAATGG - Intergenic
970554876 4:17220978-17221000 CAGGGCAAGTGGAGGGAGAAAGG - Intergenic
971162188 4:24144688-24144710 AGGGGAAAGTGGAGGGAGAAGGG - Intergenic
971525568 4:27613646-27613668 AGGAGAGAGTAGAGGGTGAATGG - Intergenic
971552500 4:27975184-27975206 AGGAGTCAGTGAAGGGAGATAGG - Intergenic
972715872 4:41645220-41645242 CGGGGAGAGAGGAGGGAGAGTGG + Intronic
972782729 4:42300123-42300145 AGGAGGGAGGGGAGGAAGAAAGG - Intergenic
973121491 4:46524957-46524979 TTGAGTCAGTGGAGTGAGAAAGG - Intergenic
973178723 4:47242027-47242049 TGGGGTGGGTGGAGGGGGAAGGG - Intronic
974102773 4:57436128-57436150 GGGGGTGCGTGGAGGGGGAAGGG - Intergenic
974703087 4:65476585-65476607 CGGAGTGAGAGGAGGGATAAAGG + Intronic
974923879 4:68274555-68274577 AGGAGTCAGTGAAGGGAGATAGG + Intergenic
975570127 4:75808058-75808080 CTGAGTAAGTGGTGGGACAATGG - Intronic
976317974 4:83679952-83679974 GGGACTGAGGGGAGGGAAAATGG - Intergenic
977237765 4:94528990-94529012 CAGAGTGAGTGAAGGCAGACTGG + Intronic
978303483 4:107295569-107295591 AGGAGTCAGTGAAGGGAGATAGG + Intergenic
978624857 4:110673698-110673720 GTGAGTGAGTGGTGGGGGAATGG - Intergenic
978959050 4:114653121-114653143 GGGAGTGAGATGAAGGAGAAAGG + Intronic
979273567 4:118791528-118791550 GGGAGAGAGAGGAGGGAGGAGGG - Intronic
979390684 4:120123805-120123827 AGGAGGGAGAGAAGGGAGAAAGG - Intergenic
979485290 4:121263507-121263529 GCTAGTGAGTGGAGTGAGAAGGG - Intergenic
980728163 4:136791872-136791894 CGTAGTGAAAGAAGGGAGAAGGG - Intergenic
981043286 4:140242893-140242915 AGGAAGGAGTGGAGGGAGGAAGG + Intergenic
981191956 4:141874104-141874126 GGGAGTGGGTGGAGGGGGATAGG + Intergenic
981502258 4:145464351-145464373 ATGAGTGAGTGGTGGGTGAATGG + Intergenic
981616122 4:146646804-146646826 TGGTGGGAGTGGAGGGAGAGAGG - Intergenic
981991230 4:150923298-150923320 AGGATGGAGTGCAGGGAGAAGGG - Intronic
982690174 4:158539331-158539353 TGGAGTGGGGGGAGGGGGAAGGG + Intronic
982900752 4:161000023-161000045 TGGGGTGGGGGGAGGGAGAAGGG - Intergenic
983918244 4:173315313-173315335 GGGAGTGAATGGAGGGGGCAAGG + Intronic
984180823 4:176480441-176480463 GTTAGTGAGTGCAGGGAGAAAGG - Intergenic
984251993 4:177346601-177346623 CGGAGGGAGGAGAGGCAGAAAGG - Intronic
984961657 4:185103281-185103303 AAGTGTGAGTTGAGGGAGAATGG + Intergenic
985511852 5:317947-317969 GGGAGTAGGTGGAGGGTGAAGGG - Intronic
985701954 5:1378911-1378933 GGGAGTTAGTGGAGGGAACAGGG - Intergenic
985887863 5:2694157-2694179 AGGGATGGGTGGAGGGAGAAAGG + Intergenic
985905939 5:2836693-2836715 GGGAGGCAGAGGAGGGAGAATGG - Intergenic
986738337 5:10683663-10683685 TGGAGGGCGTGGAGGCAGAATGG + Intronic
986822495 5:11482861-11482883 GGGAGTGAGGGGAGAGAGCAGGG + Intronic
988718488 5:33852468-33852490 GAGGGTGAGTGGATGGAGAATGG + Intronic
988986227 5:36621455-36621477 AGGAGTCAGTGGAGGGAGTAGGG + Intronic
989209968 5:38848551-38848573 CTGAGTGGGAGGAGGGAGGATGG - Intronic
989284392 5:39682656-39682678 TGGGGTGAGGGGAGGGAGGAGGG - Intergenic
990058654 5:51618853-51618875 CGGAGTGAAGGGAAAGAGAATGG + Intergenic
990222797 5:53612428-53612450 GGGAGTGTGTGGAGTGAGGAAGG + Intronic
990511668 5:56494584-56494606 CGGAGGGAGTGGGGGAAAAAAGG + Intergenic
990558478 5:56960635-56960657 CGGAGATGGAGGAGGGAGAAGGG - Intronic
992013338 5:72552503-72552525 AAGAGGGAGTGTAGGGAGAAAGG + Intergenic
992648402 5:78833549-78833571 GGGAGGCAGTGGAGGGAGGAAGG + Intronic
992650963 5:78859766-78859788 CGGGGTGAGAGGAGGCACAATGG - Intronic
993156379 5:84229921-84229943 AGAAGTGAAGGGAGGGAGAAGGG + Intronic
993899309 5:93573431-93573453 GGGAGTGACTGGAGTGAGAAAGG - Intergenic
995260076 5:110093479-110093501 GGGAGTTACTAGAGGGAGAAGGG + Intergenic
995815002 5:116158153-116158175 CGGAGGGAGAGGAGGGAGGGAGG - Intronic
995879012 5:116822544-116822566 GGGAGTCAGTGAAGGGAGATAGG - Intergenic
996595081 5:125191455-125191477 CGGATTGAGAGGAGGGAGGGAGG - Intergenic
996882585 5:128316999-128317021 AGGAGTGAGTGGAGGGGACAGGG - Intronic
996924803 5:128811883-128811905 GGGAGGGAGGGGAGGGAGGAAGG - Intronic
997138246 5:131349340-131349362 TGGGGTGGGGGGAGGGAGAAGGG + Intronic
997383037 5:133450957-133450979 TGGGGTGAGTGGAGGGAGACAGG + Intronic
997896689 5:137725044-137725066 TGGAATGAATGGAGGGAAAAAGG - Intronic
998153058 5:139768206-139768228 GGGAGGAAGAGGAGGGAGAAAGG + Intergenic
998516306 5:142757677-142757699 CAGAGTGGGCAGAGGGAGAAGGG + Intergenic
998687005 5:144539371-144539393 GGTAGTGAGGGGAGGGAGAGAGG + Intergenic
998994069 5:147851569-147851591 AGGATTGAGTGGTGGGAAAATGG + Intergenic
999137615 5:149332910-149332932 TGTAGTGAGTGGAGGGACATAGG - Intronic
999261752 5:150242777-150242799 CGGAAGGAGTGTGGGGAGAATGG - Intronic
999558879 5:152776833-152776855 TGGAGTGAGGGGATGGAGGAGGG + Intergenic
999743970 5:154577628-154577650 AGGAGTGAGTGGTGGAAGGAAGG - Intergenic
1000095679 5:157969000-157969022 CAGAGTCAGTGAAGGGAGATGGG - Intergenic
1000185132 5:158851549-158851571 AGGAGAGAGGGGAGGGAAAAAGG + Intronic
1000864907 5:166501487-166501509 GGGACTGAGTGGAATGAGAACGG + Intergenic
1001003777 5:168031698-168031720 GGGAGGGAGGGGAGGGAGGAAGG + Intronic
1001234213 5:170015796-170015818 GGGAGGGAGGGAAGGGAGAAAGG - Intronic
1001553119 5:172618626-172618648 GGGAGTGATTGGAGGCAGAGTGG - Intergenic
1001969163 5:175939725-175939747 GGAGGTGAGGGGAGGGAGAAGGG - Intronic
1002133577 5:177095507-177095529 CAGAGGGAGTGGAGGGAGCGTGG - Intronic
1002248277 5:177904018-177904040 GGAGGTGAGGGGAGGGAGAAGGG + Intergenic
1002453232 5:179331396-179331418 TGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453241 5:179331416-179331438 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453250 5:179331436-179331458 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453259 5:179331456-179331478 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453268 5:179331476-179331498 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453277 5:179331496-179331518 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453286 5:179331516-179331538 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453295 5:179331536-179331558 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453304 5:179331556-179331578 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453313 5:179331576-179331598 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1002453322 5:179331596-179331618 GGGAGGGAGAGGAGGGGGAAGGG + Intronic
1003098873 6:3162497-3162519 GGGAGGGAGTGGGGGGAGGACGG - Intergenic
1003202599 6:3976036-3976058 GGAAATGAGTGGTGGGAGAAGGG - Intergenic
1003226056 6:4207107-4207129 GGGAGGGAGGGGAGGGGGAAGGG - Intergenic
1003369123 6:5507780-5507802 CGGAGGGAGCAGAGGGACAAGGG + Intronic
1003460384 6:6323046-6323068 GGGAGTCAGTGGAGGGAGACTGG - Intergenic
1003579284 6:7325080-7325102 CTGTGGGAGTGGAGAGAGAAGGG - Intronic
1003681155 6:8258401-8258423 AGGAGGGAGAGGAGGAAGAAGGG + Intergenic
1003682012 6:8265956-8265978 CGGAGAGAGTGGAAGGTCAAGGG + Intergenic
1004869961 6:19894694-19894716 GGGAGTGGGGGGAGGGAGCAGGG + Intergenic
1004899988 6:20184711-20184733 TGTAGGGAGTAGAGGGAGAATGG - Intronic
1004963558 6:20821099-20821121 CAGAGTGTTTGGAGGGAGAGCGG + Intronic
1005001494 6:21246276-21246298 CACAGTGAGTGGGTGGAGAAGGG - Intergenic
1005048976 6:21666375-21666397 GGGAGGGAGGGGAGGGAGAGAGG + Intergenic
1005402652 6:25450763-25450785 GGGAGGGAGGGGAGGGAGGAAGG - Intronic
1005574099 6:27176078-27176100 TGGAGTGCGTGGTGGGAGACAGG - Intergenic
1005821774 6:29604752-29604774 AGGAGTGAGAGGAGGGTGAACGG + Intronic
1006322890 6:33330865-33330887 CTGAGGGAGGGGAGGGGGAACGG + Intergenic
1006407476 6:33853557-33853579 CTGAGTGAGTGGTGGGTGCAGGG + Intergenic
1006592761 6:35170263-35170285 GGGAGTGAGTGGGGGCAGGAAGG + Intergenic
1007084174 6:39131610-39131632 AGGAGTCAGTGAAGGGAGATAGG + Intergenic
1007158342 6:39768148-39768170 TGGGGTGGGGGGAGGGAGAAGGG + Intergenic
1007183918 6:39951189-39951211 TGGCTTGAGGGGAGGGAGAAAGG + Intergenic
1007228909 6:40334542-40334564 AGGAGTGAGAGGAGGGAGAAAGG - Intergenic
1007270753 6:40635217-40635239 AGAAGTGAGTGATGGGAGAAAGG + Intergenic
1007460111 6:42011746-42011768 CTGAGGCAGTGGAGGGAGAGGGG + Intronic
1007722710 6:43894801-43894823 GTGAGTGAGAGGAGGGAGAGGGG + Intergenic
1008160472 6:48069156-48069178 GGGGGGGAGAGGAGGGAGAAGGG + Intergenic
1010059269 6:71603910-71603932 AGGAGGGAGAGGAGGGAGAGAGG - Intergenic
1010607310 6:77907278-77907300 TGGAGTGCGGGGAGGGGGAAGGG - Intronic
1010943965 6:81953178-81953200 TGGAGTGGGGGGAGGGGGAAGGG - Intergenic
1011526859 6:88275352-88275374 CGGAGTGGGTGGAGGCAGCCAGG - Intergenic
1011706006 6:90002291-90002313 GGAAGTGAGTGGAGATAGAAAGG - Intronic
1012565339 6:100642013-100642035 CGGAGTGGGGGGAGGGGGGAGGG + Intronic
1013842080 6:114408373-114408395 TGGAGAGATTGGCGGGAGAAAGG - Intergenic
1014121231 6:117727279-117727301 TGGCGTGGGTGGAGGGGGAAGGG + Intergenic
1015163966 6:130182625-130182647 AGGAGGGAGGGGAGGGAGGAAGG + Intronic
1015428932 6:133107088-133107110 CAGAGCCAGTGGAGGGAGCAGGG - Intergenic
1015890887 6:137968587-137968609 CTGTGTGAGTGTAGGGAGAGGGG + Intergenic
1015966332 6:138698322-138698344 AGGAGAGAGAGAAGGGAGAATGG - Intergenic
1016063646 6:139656098-139656120 AGGAGGGAAGGGAGGGAGAAAGG - Intergenic
1018757012 6:166858696-166858718 CCAAGTGAGTGCTGGGAGAATGG + Intronic
1018866053 6:167747787-167747809 GGGAGGGAGGGAAGGGAGAATGG + Intergenic
1018890132 6:167977067-167977089 CTGAGTGGGGGGAGGGAGGAGGG + Intergenic
1018894726 6:168005822-168005844 TGGAGTCAGTGGGGTGAGAAAGG - Intronic
1019050819 6:169181985-169182007 TGGAGTGGGGGGAGGGAGGAGGG + Intergenic
1019890656 7:3943379-3943401 AGGAGGAAGTGGGGGGAGAAGGG - Intronic
1020100813 7:5393498-5393520 AGGAGGAAGTGGAGGGAGAGTGG + Intronic
1020654992 7:10918319-10918341 CGGAGGGAGTGGAGAGGAAAGGG - Intergenic
1021510349 7:21427422-21427444 CGCGCTGAGTGGTGGGAGAAAGG - Intergenic
1022035654 7:26531698-26531720 TGGAGTGAGATGAGGGAGAATGG + Intergenic
1022092076 7:27114130-27114152 GGGAGGGACCGGAGGGAGAAGGG + Intronic
1022574294 7:31482664-31482686 CGGAGTGGCTGGAGGAAGAAAGG + Intergenic
1022677286 7:32511776-32511798 AGGAGTAAGGGGAGGAAGAAGGG + Intronic
1022694974 7:32696105-32696127 TGGAGTGAGGGGAGGGGGGAGGG - Intergenic
1023137337 7:37065497-37065519 AGGAGTGACTTGAGGGGGAAGGG - Intronic
1023679784 7:42673800-42673822 CGGAGTCAGTGAAGGGAGATAGG + Intergenic
1023857032 7:44190169-44190191 CCCAGTGAGTGGATGGAGCAGGG + Intronic
1023921244 7:44631845-44631867 GGGAGAGAGAGGAGAGAGAAAGG - Intronic
1024119577 7:46223102-46223124 AGCAGTGAGTGCAGTGAGAATGG + Intergenic
1024233949 7:47384083-47384105 TGGAGACAGTGGGGGGAGAATGG - Intronic
1024588433 7:50860627-50860649 GGGAGTCAGTGCAGGGAGATAGG - Intergenic
1025189887 7:56888376-56888398 CTGAGTGAGTGGAGACAGATGGG - Intergenic
1025296995 7:57783174-57783196 AGGAGTGGGTGGAGGGAACATGG + Intergenic
1025682052 7:63688545-63688567 CTGAGTGAGTGGAGACAGATGGG + Intergenic
1025976141 7:66371552-66371574 GGGAGGGAAAGGAGGGAGAAAGG + Intronic
1027157962 7:75781817-75781839 AGGAGTCAGTGAAGGGAGATAGG - Intronic
1027469448 7:78554904-78554926 CGGTGTGAGGGGTGTGAGAATGG + Intronic
1029251986 7:99243436-99243458 TGGGGTGAGTGGGGGGAGGAAGG + Intergenic
1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG + Intronic
1029526919 7:101100381-101100403 AGCAGTGACTGTAGGGAGAACGG + Intergenic
1029655723 7:101923131-101923153 GGGAGTTAGTGGATGGAGAGTGG + Intronic
1030555679 7:111021250-111021272 AGGAGTGAGAAGAGGGAGAAAGG - Intronic
1030570205 7:111213172-111213194 CGGAGCAAGTGCAGGGAGCAAGG - Intronic
1030614330 7:111722562-111722584 GAGAGTGAGGGGAGGGAGAATGG + Intergenic
1030645099 7:112052451-112052473 CGAAGTGAGGGGGGGAAGAAGGG - Intronic
1031149857 7:118041081-118041103 GGGAGTGGGTGGTGGGAGAGAGG - Intergenic
1031777930 7:125923995-125924017 GAGAGTCAGTGAAGGGAGAAAGG - Intergenic
1032057204 7:128693357-128693379 CGGAGTGAGAGGAGGGATGGAGG - Intergenic
1032158647 7:129492363-129492385 CAGAGGGAGTTGAGGGAGAAGGG - Intergenic
1033310678 7:140259801-140259823 TGGAGTGAGGTCAGGGAGAAGGG + Intergenic
1033354377 7:140587589-140587611 GGGAGAAAGGGGAGGGAGAATGG - Intronic
1033676817 7:143549616-143549638 GAGAGTGGGTGGAGGGAGAAAGG - Intergenic
1033695018 7:143779819-143779841 GAGAGTGGGCGGAGGGAGAAAGG + Intergenic
1033909819 7:146248909-146248931 GAGAGTCAGTGAAGGGAGAAAGG + Intronic
1034442412 7:151092738-151092760 CGCAGTGAGGGGAGGAAGCAGGG + Intronic
1034635609 7:152565108-152565130 GGGAGAAAGTGTAGGGAGAAGGG + Intergenic
1035065851 7:156104807-156104829 TGGATTGAGGGGAGGAAGAAAGG - Intergenic
1035810368 8:2486164-2486186 CGCAGTGGGTGGAGAGAGAGAGG - Intergenic
1036048797 8:5172969-5172991 ATGAGTGTCTGGAGGGAGAAGGG - Intergenic
1036656379 8:10679876-10679898 TGGTCTGAGTGGAGAGAGAAAGG - Intronic
1037248740 8:16867660-16867682 TGGAATGAGTGGAGGGAAAGAGG + Intergenic
1037330906 8:17742597-17742619 AGGCGTGAGTGGAGGAAGAGGGG - Intronic
1037542757 8:19888300-19888322 TGGAGTGAGTGAAGAGGGAAGGG + Intergenic
1037654202 8:20868889-20868911 GGGAGGGAGTGGAGGGAGGTGGG - Intergenic
1037701125 8:21274690-21274712 CACAGGGAGTGGAGGGGGAAGGG - Intergenic
1038007239 8:23442718-23442740 CTGAGTGAATGGAGGGATAAAGG - Intronic
1038179218 8:25210868-25210890 CTGAATGAGGGGAGGGGGAAGGG + Intronic
1038232821 8:25720659-25720681 TGGGGTGAGAGGAGGGGGAAGGG - Intergenic
1038455367 8:27669175-27669197 AGGAGGGAGTGGCAGGAGAAGGG + Intronic
1038721196 8:30037078-30037100 TGGAGTCAGGGGAGGGAGGATGG - Intergenic
1039494249 8:37968899-37968921 TTGAGTGAGGGCAGGGAGAAGGG - Intergenic
1040860080 8:51990105-51990127 GTCAGTGGGTGGAGGGAGAAGGG - Intergenic
1041202737 8:55466485-55466507 TGGAGTGGGGGGAGGGGGAAGGG + Intronic
1041230738 8:55748556-55748578 GGGAGGGAGGGGAGGGAGGAAGG + Intronic
1041309930 8:56506266-56506288 CTGAGCCAGTGGAGGGAAAAGGG - Intergenic
1041576332 8:59399940-59399962 CAGAGAGAGGGGAGAGAGAAAGG + Intergenic
1044145539 8:88709393-88709415 CGGAGACAGTGCAGGAAGAAGGG - Intergenic
1044403564 8:91799410-91799432 TGGGGTGAGGGGAGGGGGAAGGG + Intergenic
1044816137 8:96115314-96115336 CAAAGTGAGTAGAGAGAGAAGGG - Intergenic
1045105236 8:98886047-98886069 GGGAGTGAGAAGAGGGCGAAAGG + Intronic
1047690328 8:127345858-127345880 CCAAGTGGGTGGAGGGAGGAAGG - Intergenic
1048339053 8:133524989-133525011 CGTGGTGAATGGAGGGAGGAGGG + Intronic
1048764564 8:137830262-137830284 CAGAGTCAGTGAAGGGAGATGGG + Intergenic
1048986017 8:139735443-139735465 CAGAGGTAGAGGAGGGAGAAGGG - Intronic
1048994042 8:139778824-139778846 AGAAGAGAGTGGAGGGAGACAGG + Intronic
1049199226 8:141331727-141331749 CGGGGTGTGTGGAGGAAGGAAGG + Intergenic
1049762877 8:144338802-144338824 CGGGGTGAGTGCAGGGCGACAGG - Intergenic
1049939579 9:532528-532550 TGGAGGGAGTGGAGGGAAATGGG - Intronic
1050081872 9:1923969-1923991 AGGAGTGAGTAGAGGTAGAGAGG - Intergenic
1050266135 9:3891970-3891992 AGGAGTGAGTGGCTGCAGAAAGG - Intronic
1050783141 9:9364645-9364667 TGGAGGCAATGGAGGGAGAAAGG + Intronic
1051002957 9:12307401-12307423 CGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1051185842 9:14460368-14460390 CGGGGTGGGGGGAGGGAGAAGGG + Intergenic
1051306982 9:15720830-15720852 TGGGGTGGGTGGAGGGAGGAGGG - Intronic
1051459321 9:17294773-17294795 GGGAGTGAGGGGAGGGAGGGGGG + Intronic
1051459372 9:17294867-17294889 CGGAGGGAGTGGGGGGAGGGGGG + Intronic
1051989276 9:23131431-23131453 CGGGGTGGGGGGAGGGGGAAGGG + Intergenic
1052359572 9:27539659-27539681 TGGCATGAGTGGAGGGAGAAGGG - Intergenic
1053380824 9:37648928-37648950 TGGTGAGAGTGAAGGGAGAAAGG + Intronic
1053546465 9:39028104-39028126 AGAAGTGATTTGAGGGAGAAGGG - Intergenic
1053810782 9:41849771-41849793 AGAAGTGATTTGAGGGAGAAGGG - Intergenic
1054619811 9:67337668-67337690 AGAAGTGATTTGAGGGAGAAGGG + Intergenic
1055398607 9:75899530-75899552 CGGGGTGAGGAGAGGGAGGAGGG - Intronic
1056070613 9:82983156-82983178 AGGAGAGAGTGAGGGGAGAAGGG - Intronic
1056364192 9:85886566-85886588 CATAGTGAGTGGAAGGAAAATGG - Intergenic
1056692905 9:88823439-88823461 AGAAGTGAGAGGAGGTAGAAGGG + Intergenic
1057469181 9:95342620-95342642 CGGAGTGAGTCGACAGAAAATGG + Intergenic
1057510891 9:95678711-95678733 GAGAGTGGGTGCAGGGAGAATGG + Intergenic
1058531142 9:105905589-105905611 AGGAGAGAGCGGAGGGTGAAAGG - Intergenic
1060105524 9:120870424-120870446 CTGGGTGAGTGGAGCGAGCAGGG - Exonic
1060372960 9:123091926-123091948 CCTAGTGAGTGGAGGGAGGCAGG + Intronic
1060449625 9:123724452-123724474 TGGAGTGAGGGGAAGGAGAGGGG + Intronic
1060756740 9:126219390-126219412 GGAGGTGAGTTGAGGGAGAAGGG - Intergenic
1060877860 9:127096141-127096163 CTGAGGGAGTGGTGGGGGAAAGG - Intronic
1060954818 9:127631104-127631126 AAGAGTGTGTGGAGGCAGAAAGG + Intronic
1061359378 9:130131502-130131524 GGGAGTGCGAAGAGGGAGAACGG - Intronic
1061714419 9:132509911-132509933 AGGAGTTTGGGGAGGGAGAAAGG - Intronic
1203358693 Un_KI270442v1:191237-191259 TGGGGTGAGGGGAGGGAGGAGGG + Intergenic
1203630382 Un_KI270750v1:68105-68127 GGGTGTGAGTGGAGCCAGAAGGG + Intergenic
1185565252 X:1090325-1090347 AGGAGGGAGTGGGGGCAGAAGGG + Intergenic
1185708507 X:2282840-2282862 GGGAGAGAGAGAAGGGAGAAGGG + Intronic
1186137016 X:6532760-6532782 AGGTGTGTGGGGAGGGAGAAAGG - Intergenic
1186267270 X:7844538-7844560 TGGTGTGTGGGGAGGGAGAAAGG + Intergenic
1186297720 X:8169113-8169135 TGGTGTGTGGGGAGGGAGAAAGG - Intergenic
1186325139 X:8467358-8467380 TGGTGTGTGGGGAGGGAGAAAGG + Intergenic
1186512557 X:10140940-10140962 CAGAGCTAGGGGAGGGAGAACGG - Intronic
1186730713 X:12406514-12406536 CAGAGTGGTTGGAGGGAGAGAGG - Intronic
1187131255 X:16505326-16505348 AGGAGAGAGAGAAGGGAGAAAGG - Intergenic
1187414246 X:19078873-19078895 CAGAGGGAGGGGAGGGAAAAAGG + Intronic
1187665461 X:21604316-21604338 TGGAGTGGGGGGAGGGGGAAGGG + Intronic
1188553514 X:31386226-31386248 TGGGGTGAGGGGAGGGAGGAGGG + Intronic
1188945019 X:36290019-36290041 GAGAGGGTGTGGAGGGAGAATGG - Intronic
1189020473 X:37332417-37332439 CGTAGTAAGTGGATGGAGAGGGG - Intergenic
1190259868 X:48790995-48791017 TGGAGTGGGAGGAGGGGGAAAGG + Intronic
1190432944 X:50395015-50395037 TGGAGTGAGTGGGGGGGGAGTGG + Intronic
1190914319 X:54799106-54799128 AGACCTGAGTGGAGGGAGAAGGG + Intergenic
1191030147 X:55961154-55961176 AGGACAGAGTGGAGGGAGAGTGG - Intergenic
1192086157 X:68099502-68099524 CTAAGTGAGTGGCGGGAAAATGG - Intronic
1192172386 X:68865138-68865160 GGGGGAGAGGGGAGGGAGAAGGG - Intergenic
1192706712 X:73533830-73533852 GAGAGTCAGTGGAGGGAGATAGG - Intergenic
1193055069 X:77141250-77141272 TGGAGTGGGGGGAGGGGGAAGGG + Intergenic
1193625500 X:83815435-83815457 GAGAGTGAGGGGTGGGAGAAGGG - Intergenic
1193743448 X:85244884-85244906 CCAAGTGAGAGGAGGGAGGAGGG + Intronic
1194806510 X:98335379-98335401 TGAAGTGAATGGAGAGAGAAAGG + Intergenic
1196147369 X:112332681-112332703 TGGGGTGGGGGGAGGGAGAAGGG + Intergenic
1197247708 X:124183191-124183213 CGGGGTGGGGGGAGGGGGAAGGG + Intronic
1197520019 X:127485974-127485996 GTCAGTGGGTGGAGGGAGAAGGG - Intergenic
1197575423 X:128204920-128204942 CGGGGTGGGGGGAGGGGGAAGGG + Intergenic
1197640655 X:128964262-128964284 AGGAGTGAGGGGAGGGAAGAGGG + Intergenic
1197720624 X:129742363-129742385 GGGAGGGAGTGGAGGGGGGAGGG - Intronic
1198245376 X:134826195-134826217 CCAAGTTCGTGGAGGGAGAAAGG - Intronic
1198912582 X:141631090-141631112 TAGAGTGAGAGGAGGAAGAATGG + Intronic
1199518830 X:148711933-148711955 GGGAGTGAGTGAGGGAAGAAAGG - Intronic
1199988572 X:152970374-152970396 AGGAATGAGTGGAGTGGGAAGGG - Intronic
1201625707 Y:16012245-16012267 AGGAGGGAGGGGAGGAAGAACGG + Intergenic