ID: 1114532879

View in Genome Browser
Species Human (GRCh38)
Location 14:23406361-23406383
Sequence TTTGCCTGCACAGTGACTAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114532876_1114532879 26 Left 1114532876 14:23406312-23406334 CCAGTGTTTTTTATAGTGGAGAA 0: 1
1: 1
2: 1
3: 20
4: 279
Right 1114532879 14:23406361-23406383 TTTGCCTGCACAGTGACTAGCGG 0: 1
1: 0
2: 0
3: 14
4: 110
1114532878_1114532879 1 Left 1114532878 14:23406337-23406359 CCGTGGCTCTAAATGACTAAATG 0: 1
1: 0
2: 3
3: 52
4: 785
Right 1114532879 14:23406361-23406383 TTTGCCTGCACAGTGACTAGCGG 0: 1
1: 0
2: 0
3: 14
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114532879 Original CRISPR TTTGCCTGCACAGTGACTAG CGG Intronic