ID: 1114532879

View in Genome Browser
Species Human (GRCh38)
Location 14:23406361-23406383
Sequence TTTGCCTGCACAGTGACTAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114532878_1114532879 1 Left 1114532878 14:23406337-23406359 CCGTGGCTCTAAATGACTAAATG 0: 1
1: 0
2: 3
3: 52
4: 785
Right 1114532879 14:23406361-23406383 TTTGCCTGCACAGTGACTAGCGG 0: 1
1: 0
2: 0
3: 14
4: 110
1114532876_1114532879 26 Left 1114532876 14:23406312-23406334 CCAGTGTTTTTTATAGTGGAGAA 0: 1
1: 1
2: 1
3: 20
4: 279
Right 1114532879 14:23406361-23406383 TTTGCCTGCACAGTGACTAGCGG 0: 1
1: 0
2: 0
3: 14
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114532879 Original CRISPR TTTGCCTGCACAGTGACTAG CGG Intronic
902491243 1:16782353-16782375 TTTGCCAGCACAGGGACTCTGGG - Intronic
907020332 1:51060502-51060524 ATTGCCTGCAGTGTGACGAGTGG - Intergenic
910064149 1:83132811-83132833 TTTGTCTTCACAGAGACTATGGG - Intergenic
910377369 1:86587213-86587235 TTCGGCTGCAAAGTGAATAGTGG - Intergenic
910796486 1:91102655-91102677 TTGGCCTGCAGAGTGAATAGTGG - Intergenic
911774557 1:101791766-101791788 TTTGCCTGCATAGGGACAGGAGG + Intergenic
915977055 1:160398388-160398410 TTTGCTTACTCAGTGACTTGGGG + Intergenic
917877516 1:179299361-179299383 TTTAGCAGCACAGTGCCTAGAGG + Intronic
923201412 1:231716067-231716089 GATGCCTGCACAGTGCCTGGAGG + Intronic
923671445 1:236044803-236044825 TTTTCCTTCACATTGACTAGGGG - Intronic
924141243 1:241026175-241026197 TTTGCCTTCCCAGTGTCTAGTGG + Intronic
1063720648 10:8577682-8577704 TTAGCCTGAACAGTGACAAGAGG + Intergenic
1063987440 10:11520399-11520421 TATGCCGGCACAGAGACTTGAGG - Intronic
1064507769 10:16051714-16051736 TTTGCCTGCTCAGGCAGTAGTGG - Intergenic
1065239070 10:23687062-23687084 TTTGTTTGCTTAGTGACTAGGGG + Intergenic
1067052493 10:43030051-43030073 TTTGCCTGCACTGTAACTTATGG - Intergenic
1073465926 10:103694444-103694466 TTTGCCTGCACAGCCAGGAGTGG + Intronic
1074018624 10:109561568-109561590 TTTGCTTACACAATGACAAGAGG + Intergenic
1074082897 10:110181803-110181825 AGTCCCTGCTCAGTGACTAGTGG + Intergenic
1074144506 10:110704727-110704749 TTTGCCTGCACACAGTCTAATGG - Intronic
1079802404 11:24887003-24887025 TTTGCCTGATCTGTGACCAGGGG + Intronic
1083624337 11:64064424-64064446 ATTGCCTGCCCAGTGCCCAGAGG - Intronic
1090339256 11:126001714-126001736 TTTACCTCCACTGTGCCTAGAGG + Exonic
1091071356 11:132566982-132567004 TTTTCCTGCAGAATGACTACTGG + Intronic
1092918801 12:13212352-13212374 TTTGCCTGCCTAGTGATTGGTGG - Intronic
1095331057 12:40964947-40964969 TTTGTCTGGACAGTGAAGAGTGG - Intronic
1096741905 12:53699658-53699680 ATAGCCTGCACAGTGCCCAGAGG + Intergenic
1106981406 13:35286853-35286875 TTTGGGTTCACACTGACTAGGGG - Intronic
1109259629 13:60128685-60128707 TTGGCCTGCACAGAAACTAGAGG - Intronic
1110369970 13:74728923-74728945 TTTGCCCTCAGAGTGACTTGTGG + Intergenic
1111897147 13:94155859-94155881 GTTGCCTGCACAGGAACAAGAGG + Intronic
1111972110 13:94927263-94927285 TTTGTATTCCCAGTGACTAGTGG + Intergenic
1114532879 14:23406361-23406383 TTTGCCTGCACAGTGACTAGCGG + Intronic
1115787395 14:36841813-36841835 CTTGCCTGCACAGGGAGTATGGG - Intronic
1122298216 14:100717360-100717382 GTTCCCTGCACAGAGACTGGGGG + Intergenic
1123881138 15:24678108-24678130 TTTGCCTGCACAGTCAGTCAGGG + Exonic
1124733392 15:32220183-32220205 TTTGCCTTTAAAGTGACTACTGG + Intergenic
1130434595 15:83885185-83885207 TTTCCCTGCACTGTGACGTGTGG + Exonic
1133435953 16:5779828-5779850 TTTGCCTACACTGTGACTTTGGG + Intergenic
1133497045 16:6328615-6328637 TTTGCATACATAGTGAATAGAGG - Intronic
1136990821 16:35150526-35150548 TTTGCCTGGTCAGTCATTAGGGG + Intergenic
1137538429 16:49345007-49345029 ATTGCCTTCACAGTGAATGGAGG - Intergenic
1141579710 16:84988827-84988849 TCTGCCTGCACAGTGAAAACTGG - Exonic
1142002251 16:87670585-87670607 TTTGCCTGAAGAGTGCCTGGAGG - Intronic
1144075134 17:11711364-11711386 TTTGTTTTCAAAGTGACTAGTGG + Intronic
1148686124 17:49502193-49502215 CCTGCCTGGACAGTGAGTAGAGG + Exonic
1150316561 17:64174266-64174288 TTTGCCTTTGCAGGGACTAGAGG - Intronic
1152383678 17:79956020-79956042 CTTGCCTGCACTGTGCCAAGAGG - Intronic
1155126448 18:22881293-22881315 TTTGCCTGGACAGTTAATAGTGG + Intronic
1155845533 18:30701138-30701160 TTTGCTTGCATCTTGACTAGTGG - Intergenic
1158448742 18:57544168-57544190 GTTACCCCCACAGTGACTAGGGG - Intergenic
1160050271 18:75426930-75426952 GTTGCCTGCACATTGGCTACTGG + Intronic
1160466934 18:79085732-79085754 TTTGCCAGCAGTGTGACTATTGG + Intronic
1163137591 19:15323948-15323970 TGTGCCTGCACAGTGACAAAAGG - Intronic
1164079468 19:21850184-21850206 TTTGCCTGCACTCTGCCTACAGG - Intronic
1164311809 19:24052484-24052506 TTTGCCTGCACCCTGACCACTGG + Intronic
1164325490 19:24187738-24187760 TGTGCCTGCACACTGCCTACAGG - Intergenic
927899666 2:26810330-26810352 TGTGCCTGCCCTCTGACTAGGGG + Intergenic
928217959 2:29378137-29378159 TTTGTCTTCATATTGACTAGTGG + Intronic
932816430 2:74865677-74865699 ATTTCCTGCCCAGTGACTAGAGG - Intronic
935036922 2:99386219-99386241 TTTGTTTCCACAGTGACTAATGG + Intronic
944685719 2:202116094-202116116 ATTGCTGGCACTGTGACTAGGGG - Intronic
945227803 2:207550279-207550301 TTTCCCTGCACACTAACAAGTGG - Intronic
1169526669 20:6435483-6435505 TTTTCCTTCACAGTGACCAATGG + Intergenic
1171360446 20:24583092-24583114 GCTGGCTGCACAGTGATTAGAGG + Intronic
1171398917 20:24859135-24859157 TCTGCCTGCACACTTTCTAGGGG + Intergenic
1172646252 20:36471963-36471985 TTAGCCTGCACAGGTTCTAGAGG - Intronic
1175927672 20:62479048-62479070 GCTGCCTCCACAGTGACTGGTGG + Intergenic
1179300371 21:40102957-40102979 GTTCCCTGCAGAGTGAGTAGAGG - Intronic
1181137347 22:20777720-20777742 TTTGCCAGGACAGTGACCATAGG - Intronic
1181167167 22:20989919-20989941 TGTGGCTGCACAGTGATTCGAGG + Intronic
1183653807 22:39173755-39173777 GATGCCTGCACCGTGACTATGGG - Intergenic
1185258893 22:49850609-49850631 TGTGCCTCCCCAGTGACCAGTGG + Intergenic
949501144 3:4681047-4681069 TTTCCCTGCCCAGGAACTAGTGG + Intronic
950190175 3:10971073-10971095 TCAGCCTGCACAGTGTCAAGAGG - Intergenic
955905060 3:63798354-63798376 TTTGCCTCAACAGTAAGTAGTGG - Intergenic
960892000 3:122458850-122458872 TCTCCCTCCACTGTGACTAGTGG - Intronic
962187404 3:133274414-133274436 TCTGCATGCACAGTGCCTGGAGG + Intronic
964026749 3:152083123-152083145 TTGGCCTGCACAGTAAAAAGGGG + Intergenic
964761211 3:160136577-160136599 TTTGCCTGCTCAGTGAGGTGAGG + Intergenic
967195525 3:187022339-187022361 TTTCCCTACACAGGGACTTGGGG + Intronic
968270274 3:197398119-197398141 GTTGCCTGCACAGGAATTAGTGG + Intergenic
971630197 4:28981670-28981692 TATGCCTTAACAGAGACTAGGGG + Intergenic
974875432 4:67698544-67698566 TTTGCCTGCTCTGTGACTTTGGG - Intronic
978875557 4:113636659-113636681 TTTGAGTTCACAGTGACAAGGGG - Intronic
980819304 4:137993148-137993170 TTAGCCTCCACAGTGACCATGGG - Intergenic
984320862 4:178194284-178194306 TATGTCTGAACAGGGACTAGTGG + Intergenic
984524432 4:180841041-180841063 TATGACTTCACAGTGACAAGAGG + Intergenic
987570656 5:19653857-19653879 TTTGCCTGAGAAGGGACTAGAGG + Intronic
987668166 5:20972606-20972628 TTTGTCTGCCCAGTGGCCAGCGG + Intergenic
990566091 5:57030913-57030935 CTTGTCTGCAGAGTGACGAGAGG + Intergenic
991196189 5:63935218-63935240 ATTGCCTTCACAGTTACAAGAGG + Intergenic
992357949 5:76004919-76004941 TTTGCTTTCACAGTGACTTGGGG + Intergenic
994791937 5:104238748-104238770 TTTGCCTGCAGAGTGCATTGAGG + Intergenic
995124416 5:108565895-108565917 TATCCCTGCAGAGTGACTAGTGG + Intergenic
995390293 5:111633232-111633254 TTTGCCTACCAAGTGAATAGCGG + Intergenic
998900176 5:146844868-146844890 TTAGCCTACACAGTGACCTGAGG + Intronic
1002603341 5:180367905-180367927 CCTGCCTGCAAAGTGGCTAGTGG + Intergenic
1004599417 6:17133134-17133156 TTTGCCTGCACATTCCCTAGTGG - Intergenic
1006473035 6:34238580-34238602 TTTGCATGCACAGTGTATGGAGG + Intronic
1006944841 6:37778335-37778357 TTTTCCTGCACAGTAACTCCTGG - Intergenic
1013744661 6:113331488-113331510 TTTGACTTCACAATGTCTAGAGG + Intergenic
1021597065 7:22328523-22328545 TTTACCTGGACAGTGACAAGTGG + Intronic
1028115717 7:86995228-86995250 TTTTCCTTCACAGTGATTAGAGG - Intronic
1028965574 7:96797734-96797756 TTTGCCTACACAGTAACTTCTGG + Intergenic
1029054902 7:97732063-97732085 TTCGCCTGCTCAGTGCCTTGCGG - Exonic
1030042342 7:105463234-105463256 TTTGCTTGCACAGTCATTAATGG + Intronic
1032903143 7:136333948-136333970 TTCGCTTGCACAGTGAGCAGGGG + Intergenic
1032912216 7:136446304-136446326 GGTGACTGCACAGTGACTTGTGG + Intergenic
1036159720 8:6375894-6375916 TTTCCATGGACAGGGACTAGGGG - Intergenic
1036479303 8:9124074-9124096 TGTGCCTGCTCAGTGACTCTTGG + Intergenic
1038069902 8:24002290-24002312 TTTGCCTGCACACTGACAAATGG + Intergenic
1044591317 8:93916853-93916875 ATTGGCTGCGCAGTGACGAGTGG - Intronic
1045795229 8:106035948-106035970 GTTGCTTGCACAGGAACTAGGGG + Intergenic
1046675895 8:117108233-117108255 TTTGCCTGCACAAGGACTGCTGG + Intronic
1052101166 9:24447671-24447693 TGTGCCTTTACACTGACTAGTGG + Intergenic
1055785601 9:79866131-79866153 TTTGCCTGCACAGTCAGTCATGG + Intergenic
1058625240 9:106927493-106927515 TTTGCCAGCACTGTGATTATGGG + Exonic
1060972131 9:127744415-127744437 TTTGCCTGCTCTGTGACTCTGGG - Intronic
1189652737 X:43207985-43208007 TTTGCCTGCACAGAGCAGAGGGG - Intergenic
1191213067 X:57909592-57909614 TTTGCCCGCACAGCGCCTCGGGG + Exonic
1191663486 X:63674158-63674180 TTTGTTTTCACAGTGACTACAGG - Exonic
1199602069 X:149547093-149547115 TTTACATGCACAGTGCTTAGTGG - Exonic
1199648318 X:149932391-149932413 TTTACATGCACAGTGCTTAGTGG + Exonic
1201619171 Y:15936233-15936255 TTTAGCTGCACAGTGAGAAGAGG + Intergenic