ID: 1114535491

View in Genome Browser
Species Human (GRCh38)
Location 14:23419652-23419674
Sequence GGGGAATGAAGGGGTGTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 542
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 510}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114535477_1114535491 20 Left 1114535477 14:23419609-23419631 CCTGAGAAGGGAAGGAGAGTTAT 0: 1
1: 1
2: 3
3: 20
4: 278
Right 1114535491 14:23419652-23419674 GGGGAATGAAGGGGTGTAAGAGG 0: 1
1: 0
2: 2
3: 29
4: 510
1114535475_1114535491 29 Left 1114535475 14:23419600-23419622 CCAGGTTAGCCTGAGAAGGGAAG 0: 1
1: 0
2: 0
3: 17
4: 170
Right 1114535491 14:23419652-23419674 GGGGAATGAAGGGGTGTAAGAGG 0: 1
1: 0
2: 2
3: 29
4: 510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114535491 Original CRISPR GGGGAATGAAGGGGTGTAAG AGG Intronic
900124159 1:1062165-1062187 AGGGAGGGAAGGGGTGTGAGAGG - Intergenic
900701235 1:4049773-4049795 GGGGAAGGAGGGGGAGAAAGAGG + Intergenic
903534871 1:24060274-24060296 GGGCAATTGAGGGGTATAAGTGG - Intronic
903778681 1:25808654-25808676 GGGGAAGGAAGGGCTGGAAGTGG - Exonic
903974250 1:27138764-27138786 GGGGCATGAAGTGGAGAAAGGGG + Intronic
904044809 1:27602968-27602990 GGGGAATGAAGGGGGGACCGTGG - Intronic
904348810 1:29891693-29891715 GGGAAATGAAATGGGGTAAGAGG - Intergenic
904955537 1:34280429-34280451 TGGGAATTGAGGGGTGTAGGGGG + Intergenic
905190174 1:36227598-36227620 GAGGAAGGAAGGGGTTTCAGGGG + Intronic
906050691 1:42868889-42868911 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
906268487 1:44454798-44454820 GGGGAATGAAGGGATTTTTGAGG - Intronic
906930712 1:50167044-50167066 CAGGAATCAAGGGGTGGAAGTGG - Intronic
907509316 1:54946534-54946556 GAAGAATGAAGGGGCGGAAGGGG - Intergenic
908023727 1:59926429-59926451 GGGGGATGAAGGGCAGGAAGAGG - Intronic
908487449 1:64609019-64609041 CGGGATTCACGGGGTGTAAGGGG + Intronic
908737603 1:67292290-67292312 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
909858720 1:80575567-80575589 CAGGAATCAAGGGGTGAAAGTGG - Intergenic
909973406 1:82018213-82018235 GCGGAATGAAGGGGAGGAAGGGG - Intergenic
910328960 1:86046831-86046853 GTGGAAAGAAGGGTTTTAAGGGG - Exonic
910562105 1:88601444-88601466 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
910830887 1:91461944-91461966 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
911792511 1:102035553-102035575 GAGGAATGGAGGGGTGTGAAGGG - Intergenic
912067213 1:105758432-105758454 CAGGAATGAAGGAGTGGAAGTGG + Intergenic
912070033 1:105797676-105797698 TGGAAAAGAAAGGGTGTAAGTGG - Intergenic
912143580 1:106762525-106762547 GGTGGATGAAGGGGGGTACGAGG + Intergenic
912251828 1:108019999-108020021 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
912432332 1:109635222-109635244 GGGGAGTGGAGGGGAGCAAGTGG + Intergenic
912733116 1:112127350-112127372 CAGGAATAAAGGGGTGGAAGTGG - Intergenic
912794859 1:112686782-112686804 GGGGAATGAAGGCTGGGAAGAGG - Intronic
913261057 1:116998512-116998534 GGGGATAAAAGAGGTGTAAGAGG - Intergenic
913491304 1:119382701-119382723 GGGGAATGAGGTGTTGGAAGCGG + Intronic
913571357 1:120123412-120123434 GGGAAATGAAGGGGTGGAGTGGG - Intergenic
914234558 1:145796809-145796831 AGGGAATGAAGGGGAGAAATGGG - Intronic
914292169 1:146284389-146284411 GGGAAATGAAGGGGTGGAGTAGG - Intergenic
914553213 1:148735172-148735194 GGGAAATGAAGGGGTGGAGTAGG - Intergenic
915543837 1:156584853-156584875 TGGGAATGAAGTGGAGTAAAGGG - Intronic
915667469 1:157458196-157458218 CAGGAATGAAGGGGTGGAAGTGG - Intergenic
917462908 1:175247640-175247662 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
918116826 1:181504926-181504948 GAGGAGTGAAGGGGTGTTTGAGG + Intronic
918768662 1:188523332-188523354 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
918774702 1:188612220-188612242 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
918958440 1:191239414-191239436 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
919000535 1:191826395-191826417 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
920118479 1:203637997-203638019 GGGGGCTGAAGGGGTCTTAGTGG + Intronic
920197642 1:204239838-204239860 CAGGAATCAAGGGGTGGAAGTGG + Intronic
920772602 1:208903539-208903561 GGCACATGAAGGGTTGTAAGAGG + Intergenic
921235634 1:213124887-213124909 GGGCAAGGAAGAGGTGTCAGGGG + Intronic
921517027 1:216106581-216106603 GGGGAATGGAGAGTGGTAAGGGG - Intronic
922550898 1:226493691-226493713 TGGAAAGGAAGGGGAGTAAGAGG - Intergenic
923744943 1:236691705-236691727 GGTGAGTGAAGGGATGTAAAAGG - Intronic
923957447 1:239039135-239039157 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
924252260 1:242144461-242144483 GGGGAATGAATGGGTATGTGGGG + Intronic
924632900 1:245759294-245759316 AGGGAAAGAGGGGGAGTAAGAGG - Intronic
1063327221 10:5116440-5116462 CAGGAATCAAGGGGTGGAAGTGG - Intronic
1063486914 10:6428748-6428770 AGGGAGTGAGGGGGTGTGAGCGG + Intronic
1064872308 10:19952002-19952024 GGGGAAGGAAGGGGAGCCAGAGG + Intronic
1065826973 10:29581284-29581306 GGGAAATGAAAGGGCCTAAGTGG - Intronic
1068007453 10:51408103-51408125 CAGGAATCAAGGGGTGGAAGTGG - Intronic
1068709510 10:60118137-60118159 GGGGACTGAAGGTGTATATGGGG + Intronic
1070191520 10:74115917-74115939 GGGGAAATAAGGAGAGTAAGGGG - Intronic
1071308714 10:84323542-84323564 CAGGAATTAAGGGGTGGAAGTGG + Intergenic
1071378587 10:85034838-85034860 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1071942580 10:90606299-90606321 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1072209056 10:93230232-93230254 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1072282642 10:93881948-93881970 GAGGAGTGAAGGGGTGGGAGCGG + Intergenic
1073140757 10:101245944-101245966 AGGAAATGAAGGGGAGTGAGTGG + Intergenic
1074030144 10:109678960-109678982 GGGTAATGAAGTGGGGTAATGGG + Intergenic
1074272714 10:111971010-111971032 GGGGAGTTAAGGGGTTTGAGGGG - Intergenic
1074280422 10:112046266-112046288 AGTAAATGAAGGGGTGTGAGAGG - Intergenic
1074520804 10:114221554-114221576 TGGGAATGAAGGGGAGAAAGAGG + Intronic
1075429442 10:122368349-122368371 GGGGAAAGAAGGTCTTTAAGAGG - Intergenic
1075607001 10:123818886-123818908 CAGGAATCAAGGGGTGGAAGTGG + Intronic
1076927055 10:133496732-133496754 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1078368835 11:10728567-10728589 GGGGACAGAAGGGATGTGAGAGG - Intergenic
1080076806 11:28158972-28158994 CAGGAATCAAGGGGTGGAAGTGG + Intronic
1080446754 11:32344794-32344816 GGGGGATGAAGGGGTGAAGTGGG - Intergenic
1080552270 11:33382854-33382876 GGGGACTGAAGGGCTCTGAGGGG + Intergenic
1080650621 11:34220062-34220084 AGGGACTGAAGGGGTGGAGGAGG + Intronic
1081110734 11:39130195-39130217 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1081609274 11:44549340-44549362 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1082715421 11:56606287-56606309 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1082999854 11:59281318-59281340 CAGGAATCAAGGGGTGAAAGTGG + Intergenic
1083400678 11:62421323-62421345 AGGGAATGAAGTGGTACAAGTGG + Intronic
1083402456 11:62433324-62433346 GGGGGAGCAAGGGGTGTAAGAGG + Intergenic
1083413107 11:62507037-62507059 GGGGAATAAAAGTGTGGAAGTGG - Intronic
1083729113 11:64643407-64643429 GGGGAATGAAGGGATAGGAGAGG + Intronic
1083912343 11:65717539-65717561 GGGGGGTGATGGGGAGTAAGAGG - Intronic
1083924688 11:65798732-65798754 GGGCAGTGTAGGGGTGGAAGAGG + Intergenic
1084271692 11:68032640-68032662 GAGGAATCAAGGGGGGTAGGTGG - Intronic
1085207902 11:74748080-74748102 GAGGAATGTAGGGATCTAAGAGG + Intergenic
1085686168 11:78623642-78623664 CAGGAATGAAGGGGTGGAAGTGG + Intergenic
1086278808 11:85161904-85161926 CAGGAATCAAGGGGTGGAAGTGG + Intronic
1086416674 11:86595848-86595870 GGGGAAAGAAGTTGTGTTAGAGG + Intronic
1087374217 11:97322000-97322022 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1088265631 11:107985057-107985079 CAGGAATCAAGGGGTGAAAGTGG + Intergenic
1088407413 11:109497217-109497239 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1088527469 11:110772527-110772549 TGGGAAGGAAGAGGTTTAAGGGG - Intergenic
1088848173 11:113684739-113684761 CTGGAATGAAGGGGTGGAGGTGG - Intergenic
1088849472 11:113693274-113693296 GGGGAAGGAAGGGGCAGAAGAGG + Intronic
1089326949 11:117663850-117663872 GGGGAAAGATGTTGTGTAAGTGG - Intronic
1090079693 11:123603652-123603674 GTGGAATGAAGGAGGGAAAGTGG + Intronic
1090227855 11:125082350-125082372 GGGGAATGAAGGGGTCTCTGAGG + Intronic
1090245659 11:125214346-125214368 GGGGACAGAAAGGGAGTAAGAGG - Intronic
1090472676 11:126994346-126994368 GGGGCATGAAGGGTGGAAAGAGG - Intronic
1090529388 11:127574896-127574918 GGGGAAAGAAGGAGAGTAAAGGG + Intergenic
1090880823 11:130830334-130830356 GGGAAAGGAAGGGGTGAGAGAGG - Intergenic
1090914233 11:131148919-131148941 AGGGAACGAAGGGGAGCAAGGGG - Intergenic
1091832302 12:3558237-3558259 GGAGAAGGAAGGGGAGGAAGGGG - Intronic
1094395008 12:29996140-29996162 TAGGAATGAATGGGTGTAGGAGG + Intergenic
1094627144 12:32135040-32135062 GGGGAATGGAGGGGAGGAGGGGG - Intronic
1095604100 12:44046101-44046123 CAGGAATCAAGGGGTGGAAGTGG + Intronic
1095844184 12:46728519-46728541 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1096240272 12:49956131-49956153 TGGGGAGGAAGGGGTGCAAGGGG - Exonic
1096649612 12:53055541-53055563 GGAGAATGCAGGGGTGCAACTGG - Intronic
1096744114 12:53714409-53714431 GGAGAAGGGAGGGATGTAAGTGG - Intronic
1097013891 12:55971769-55971791 TGGGAATACAGGGGTGAAAGGGG + Exonic
1097437622 12:59570807-59570829 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1097843135 12:64341298-64341320 CAGGAATCAAGGGGTGGAAGCGG - Intronic
1097905750 12:64918045-64918067 GGGGGATGAAGAGGAGAAAGAGG + Intergenic
1098898805 12:76091731-76091753 GGGGAGTGGAGGGGTGTATGTGG + Intergenic
1099183189 12:79491146-79491168 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1099366126 12:81766837-81766859 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1099401052 12:82204307-82204329 AAGGAATCAAGGGGTGGAAGTGG - Intergenic
1099508768 12:83508640-83508662 CAGGAATCAAGGGGTGAAAGTGG + Intergenic
1101264343 12:103067570-103067592 CAGGAATGAAGGGGTAGAAGTGG + Intergenic
1103004388 12:117409490-117409512 GAGGAATGAATGAGTGGAAGGGG + Intronic
1103239064 12:119398107-119398129 GGGGGAGGAAGGGGTGGCAGAGG + Intronic
1104281283 12:127380269-127380291 GGGGAAAAAAGGGGAGTTAGTGG - Intergenic
1104402773 12:128490416-128490438 GGGCAATGAGGGTGTGGAAGGGG - Intronic
1105723707 13:23140966-23140988 GGGAAATGAAGGGGAAAAAGGGG - Intergenic
1105740324 13:23316633-23316655 CAGGAATCAAGGGGTGGAAGTGG + Intronic
1106338398 13:28805639-28805661 AGAGAACGAGGGGGTGTAAGAGG - Intergenic
1106529307 13:30574037-30574059 TGGGGATGAATGGGTGGAAGGGG + Intronic
1108146236 13:47480264-47480286 GGAGAAAGAAGGGCTCTAAGAGG - Intergenic
1109893666 13:68653849-68653871 GGGGAGTGTAGGGGTGTTGGGGG + Intergenic
1111198734 13:84906341-84906363 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1111441077 13:88283212-88283234 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1113263473 13:108592161-108592183 GGGGTATGGAGGGGTGTGTGGGG + Intergenic
1113263482 13:108592180-108592202 GGGGTATGGAGGGGTGTGGGGGG + Intergenic
1113486425 13:110655912-110655934 GGGGAAGGAATGGGTGCAGGCGG + Intronic
1113728324 13:112622388-112622410 GGGGAATAAAGGCGTGTGATGGG - Intergenic
1113909946 13:113836905-113836927 GGGGAATGGTGGGGAGGAAGAGG + Intronic
1114231343 14:20785708-20785730 GGGGAAGGAAGGGGAAGAAGAGG + Intergenic
1114535491 14:23419652-23419674 GGGGAATGAAGGGGTGTAAGAGG + Intronic
1114549098 14:23523053-23523075 GGGGAAAGAAGGGAGGGAAGGGG - Intronic
1115444802 14:33477703-33477725 GAGGCTTGAAGGGCTGTAAGGGG - Intronic
1115489888 14:33949203-33949225 TGGGAGTGAAGGGGTGGAGGTGG - Intronic
1116628438 14:47297477-47297499 GGGGAGTGGAGGGGTGTGAAGGG + Intronic
1117094330 14:52282243-52282265 GGGTAAAGTGGGGGTGTAAGTGG - Intergenic
1118474301 14:66102403-66102425 GGTGAATGCAGGGGTTTGAGTGG - Intergenic
1118592285 14:67410724-67410746 GGGGAATGAAGAGGGATGAGGGG - Intronic
1118950554 14:70433122-70433144 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1119059501 14:71460739-71460761 CAGGAATCAAGGGGTGGAAGTGG - Intronic
1119513080 14:75226994-75227016 GGTGCATGCAGGGGTGTAGGGGG + Intergenic
1120498207 14:85262141-85262163 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1120973904 14:90232263-90232285 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1122249003 14:100425080-100425102 GGGGCATGAAGGGGAGGCAGGGG - Intronic
1122634433 14:103123495-103123517 GGGGAATGGACGTGTGGAAGCGG - Exonic
1122890162 14:104728536-104728558 AGGGAGTGAAGCAGTGTAAGTGG + Intronic
1122915092 14:104854920-104854942 GGGGAGTGGAGGGGTGAATGGGG + Intergenic
1123128316 14:105965659-105965681 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1124548150 15:30651927-30651949 GGGGAAGGAAGGGGAAGAAGGGG - Intronic
1125646807 15:41279460-41279482 GGGGAATGAGGGGGTGGAGGTGG - Exonic
1125824702 15:42666465-42666487 GGAGAAGGAAGGGGTGTGAGAGG + Intronic
1126283802 15:46987710-46987732 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1127356983 15:58209687-58209709 CAGGAATTAAGGGGTGGAAGTGG + Intronic
1127420226 15:58798043-58798065 TGGGATTGTAGAGGTGTAAGAGG - Intronic
1129034437 15:72640951-72640973 GGGGAAATCAGGGGTGTAAAGGG + Intergenic
1129215445 15:74096265-74096287 GGGGAAATCAGGGGTGTAAAGGG - Intergenic
1129454026 15:75667013-75667035 GGGGTGTGAAGGGGTGGAAGAGG + Intergenic
1129831832 15:78675790-78675812 TGGGAATGAAGAGGTGTGGGTGG - Intronic
1130708289 15:86253961-86253983 GGGGAAGGAAGGAGAGTAAGGGG + Intronic
1131452226 15:92552214-92552236 CAGGAATCAAGGGGTGGAAGCGG + Intergenic
1131665022 15:94561085-94561107 GAAGAATGAAGGAGAGTAAGAGG - Intergenic
1131946057 15:97623242-97623264 TGGGAAGGAAGGGATGGAAGTGG + Intergenic
1133678591 16:8099068-8099090 GAGGTATTAAGGGGTGAAAGAGG + Intergenic
1134174293 16:11993347-11993369 GGGAGATGAAAGGGTGAAAGAGG - Intronic
1135265819 16:21024568-21024590 GGGGAAGGAAAGGGTCTGAGGGG + Intronic
1135604534 16:23811963-23811985 TGGGAATGAAGGTGTAGAAGAGG - Intergenic
1136106754 16:28035730-28035752 GGGCAATGAGGGGTTGTATGAGG - Intronic
1136534661 16:30892785-30892807 GGGGACTGAAGGAGTGTACTAGG - Intronic
1137870704 16:51947576-51947598 GGGGAGTGTGGGGGTGTAATGGG - Intergenic
1138119882 16:54391495-54391517 GGGAAAAGAAGGGGTTTTAGTGG + Intergenic
1138197237 16:55060664-55060686 AGGGCAGGAAGGGGTTTAAGTGG - Intergenic
1139741947 16:69042843-69042865 GGGGAATGGAGGGGTATACAGGG + Intronic
1140113278 16:72021357-72021379 GGAGAATGAAGGGGAGCAGGTGG - Intronic
1140169854 16:72593316-72593338 GGGGAATGAAATGGGGTAAGGGG + Intergenic
1140393216 16:74606465-74606487 GGGGAAAGAAGGAGTGGGAGTGG + Intronic
1141035762 16:80624052-80624074 GGAGTATGCAGGGGTGTGAGGGG - Intronic
1141514547 16:84535053-84535075 GGAGAAGGAAGAGGAGTAAGGGG - Intronic
1141559337 16:84856582-84856604 CAGGAATTAAGGGGTGGAAGTGG - Intronic
1142349216 16:89572043-89572065 GGGGAAGGAAGTGGAGGAAGGGG + Intergenic
1142653663 17:1374820-1374842 GGGGAATTAAGAGGAGTCAGTGG - Intronic
1144165202 17:12604046-12604068 GGAGAATGAAGTGCTGTAATTGG + Intergenic
1144265380 17:13563290-13563312 AGGGAATGAAGGGATTTAGGAGG + Intronic
1145952222 17:28827800-28827822 GGGTAATGAAGGGCTTTAAAGGG + Intronic
1148218772 17:45848387-45848409 GGGGTTTGGAGGGGTGGAAGAGG - Intergenic
1148335118 17:46835805-46835827 GGGGAGTGAAGGGGGCTGAGGGG - Intronic
1148343192 17:46885845-46885867 GGGGAATGAAGGGAAGGAAAGGG - Intronic
1148391439 17:47275838-47275860 GGCTAGGGAAGGGGTGTAAGGGG + Intronic
1148555656 17:48577327-48577349 GGAGAATGAGGGGGTGGAAGAGG + Intronic
1149135777 17:53361790-53361812 GGAGAAGGAAGAGGTGTAGGAGG - Intergenic
1149255084 17:54816891-54816913 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1151099500 17:71540453-71540475 GCTGAATGAAGGGGTTTTAGAGG + Intergenic
1151453622 17:74213808-74213830 GGGGAGAGAAGGGGTCTGAGAGG - Intronic
1151765314 17:76130730-76130752 GCGGAACTATGGGGTGTAAGGGG - Intergenic
1152571658 17:81123743-81123765 GGGGAAGGAAGGGGAGAGAGGGG + Intronic
1153089925 18:1331616-1331638 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1153685030 18:7537107-7537129 CGGGAATCAAGGGGTGGAAGTGG - Intergenic
1154252357 18:12755306-12755328 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1156990109 18:43399330-43399352 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1157235692 18:45963306-45963328 GGGATAGGAAGGGGTGTCAGAGG + Intronic
1157298589 18:46463314-46463336 GGGGAAGAAAAGGGTGAAAGAGG - Intergenic
1157341409 18:46781465-46781487 CAGGAATCAAGGGGTGAAAGCGG + Intergenic
1158875307 18:61728555-61728577 GGAGAATGGAGGGATGGAAGGGG + Intergenic
1159287978 18:66376927-66376949 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1159509769 18:69380946-69380968 GGGGGATGAAGGGGATGAAGAGG + Intergenic
1159558900 18:69973910-69973932 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1159711535 18:71765887-71765909 CAGGAATCAAGGGGTGGAAGTGG + Intronic
1160092640 18:75841453-75841475 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1160583641 18:79901193-79901215 GGGGAATGACGGGGGATAGGAGG + Intergenic
1160881367 19:1322224-1322246 GGGGAAAGGAGGGGTGAAGGGGG + Intergenic
1160960262 19:1717815-1717837 GGAGAATGAATGGGTGTGAGAGG + Intergenic
1161643087 19:5436389-5436411 GGGGAGGGAAGGGGGGGAAGGGG + Intergenic
1162533045 19:11246878-11246900 GAGGATGGAAGGGGTGTAACGGG - Intronic
1163730462 19:18946442-18946464 GGGGAATGAAGAGAAGGAAGAGG - Intergenic
1164611964 19:29638459-29638481 AGGGAATGCAGGAGGGTAAGGGG + Intergenic
1164897594 19:31890813-31890835 TGGGCAAGAAGGGGTGTGAGGGG + Intergenic
1165712785 19:38024040-38024062 GGGGAGTGAAGAGGTATGAGCGG + Intronic
1165859220 19:38898473-38898495 GGGGAATAAAGGGGTTCAAATGG + Intronic
1167541330 19:50089639-50089661 GGGCAATGAAGGGATGAAAGGGG + Intergenic
1167628762 19:50609870-50609892 GGGCAATGAAGGGATGAAGGGGG - Intergenic
1167633512 19:50639902-50639924 GGGGAAGGAGGGGGTGCAGGGGG - Intronic
1168046531 19:53798211-53798233 GGGGAGTGACGGGGTGGCAGTGG - Intronic
1168160017 19:54503891-54503913 GGAGAATGAAGGAGAGAAAGGGG - Intronic
1168187523 19:54709494-54709516 GGAGAAGGAAGGGGTGTGGGAGG + Intergenic
925772546 2:7297562-7297584 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
926137434 2:10346776-10346798 GGAGAAGGAAGGGGAGGAAGGGG - Intronic
926146298 2:10398908-10398930 GGAGAATGAAGGAGTGGAAGTGG - Intronic
926380246 2:12279709-12279731 GGGGAATGAAGGGGATGAAAAGG + Intergenic
927284729 2:21345016-21345038 TGGGAATGAGGGGGTGAAGGGGG - Intergenic
927660624 2:24990113-24990135 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
928093366 2:28390175-28390197 GGGGACTGAAAGGGGGTGAGCGG + Intergenic
928555201 2:32416779-32416801 GGGGAAAGAAAGGGGGAAAGGGG - Intronic
928584937 2:32750030-32750052 GGGAAATGAAGGTATGGAAGAGG + Intronic
928861934 2:35868890-35868912 TGGGAAAGAAGGGGAGTGAGGGG + Intergenic
929353225 2:40986620-40986642 GGTCAGTGAAGGGGAGTAAGTGG - Intergenic
930100641 2:47600494-47600516 GGGTAATGAAGGGCAGTGAGGGG + Intergenic
930395214 2:50814373-50814395 GGGGAATGAGAAGGGGTAAGGGG - Intronic
935534048 2:104272375-104272397 GGGGTAAGAAGGTGTGCAAGAGG - Intergenic
935887341 2:107636531-107636553 GGAGGGTGAAGGGGTGTAAGTGG - Intergenic
936687542 2:114845871-114845893 GGGAAATAAAGAGGTTTAAGTGG - Intronic
937127864 2:119485627-119485649 GGGACATGGAGGGGTGTGAGTGG - Intronic
938302042 2:130222764-130222786 GGGAAATGAAATGGTGTATGTGG + Intergenic
938454658 2:131451688-131451710 GGGAAATGAAATGGTGTATGTGG - Intergenic
938901923 2:135805651-135805673 GGGGAATAAAGGGGTCCAACAGG + Intronic
939916173 2:148046569-148046591 AGGTAAAGAAGGGGTGGAAGAGG - Intronic
940171106 2:150831252-150831274 CCGGAATCAAGGGGTGGAAGTGG - Intergenic
940471888 2:154111666-154111688 CAGGAATCAAGGGGTGGAAGTGG - Intronic
940546789 2:155099675-155099697 GGACAATGAAGGGGTGGAATTGG - Intergenic
940548680 2:155123558-155123580 TGGAAATGCAGGGGTGTAAAAGG - Intergenic
940962667 2:159802320-159802342 GGGGAAAGAAGGGTTGAAAAAGG - Intronic
941161492 2:162040553-162040575 GGGGAAGGAAGGGATGAATGGGG + Intronic
941668224 2:168262551-168262573 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
943182477 2:184561096-184561118 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
944142108 2:196467984-196468006 GGAGAATGAAGGGTTGTTACCGG - Intronic
944295846 2:198061479-198061501 GGGGAAGGAAGGGAGGGAAGGGG + Intronic
944775952 2:202964737-202964759 AGGGAATGAGGAAGTGTAAGGGG - Intronic
945725644 2:213470047-213470069 CAGGAATCAAGGGGTGGAAGTGG - Intronic
946791110 2:223301190-223301212 CAGGAATCAAGGGGTGAAAGTGG + Intergenic
947068718 2:226261409-226261431 GGGAAAGGAAGGAGTGTAAAAGG + Intergenic
947441057 2:230121707-230121729 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
947530936 2:230908259-230908281 CGTCAATGAAGGGGTGGAAGTGG - Exonic
947743643 2:232496693-232496715 GGGGACTGCAGAGGTGTCAGTGG + Intergenic
948269525 2:236663608-236663630 GGGGAATGAAGGTGTGTGGATGG + Intergenic
948791192 2:240377785-240377807 GGGGAATGAATGGATGGAAGGGG - Intergenic
1170294900 20:14813353-14813375 GGGGCCTGAAGGGGTGGGAGGGG - Intronic
1170329577 20:15193741-15193763 GGAGAATGAAGGAGTGACAGCGG - Intronic
1175614011 20:60377221-60377243 GGGGAATGAAGGGGAGAAAGAGG + Intergenic
1176998367 21:15581711-15581733 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1177139217 21:17340812-17340834 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1178061892 21:28861814-28861836 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1178385871 21:32149988-32150010 CGGGAATCAAGGGGTGGAAAAGG + Intergenic
1178581562 21:33842890-33842912 GGGGAAAGCAGGGGCGTCAGGGG - Intronic
1178713172 21:34938511-34938533 GGAGAAGGAGGAGGTGTAAGAGG - Intronic
1179314035 21:40225407-40225429 TGGGAATGAATGTGGGTAAGGGG - Intronic
1181256436 22:21565928-21565950 GGGGAATGGAGGTGGGTAAGAGG - Intronic
1181367113 22:22386445-22386467 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1181373517 22:22437729-22437751 TAGGAATCAAGGGGTGGAAGTGG - Intergenic
1181924721 22:26348873-26348895 GGGGAGTGAAGGGGAGGGAGGGG + Intronic
1182270885 22:29152621-29152643 GGAGAGTGGAGGGGTGCAAGGGG - Intronic
1182316296 22:29449527-29449549 ATGGGATGAAGGGGTCTAAGTGG + Intergenic
1182424441 22:30264671-30264693 GGGGAATGAAGAGCTTCAAGAGG + Intronic
1183407413 22:37637174-37637196 GGGGCAGGAATGGGGGTAAGGGG + Intronic
1183676145 22:39299822-39299844 GATGAATGAAGGCGTGTGAGCGG - Intergenic
1184037560 22:41925989-41926011 GGGGAGAGAAGGGCTTTAAGGGG - Intronic
1184272602 22:43393285-43393307 GGGGAATAGAGGGGTGGCAGTGG - Intergenic
1184272859 22:43394741-43394763 GGTGCATGAAGGGGTCTAGGAGG - Intergenic
1184557124 22:45239683-45239705 GGTGAATGAAGGGGTGAATCTGG + Intronic
949169833 3:985161-985183 TTGGAATCAAGGGGTGGAAGTGG - Intergenic
949639106 3:6014967-6014989 CAGGAATCAAGGGGTGAAAGTGG + Intergenic
950614831 3:14150165-14150187 GGGGAGTGAAGTGGTGAGAGGGG + Intronic
951291149 3:20873592-20873614 TGGGAATCAAGGGGTGGAAGTGG - Intergenic
951384725 3:22028972-22028994 CAGGAATCAAGGGGTGGAAGTGG + Intronic
953312170 3:41890802-41890824 GGGGAAGGAAGGGATGGGAGGGG + Intronic
953312179 3:41890823-41890845 GGGGAAGGAAGGGACGGAAGGGG + Intronic
953312322 3:41891186-41891208 GGGGAAAGAAGGGATGGGAGCGG + Intronic
954046525 3:47936088-47936110 GAGGAAAGAAGGGGAGAAAGAGG + Intronic
954439429 3:50513569-50513591 TGGGGATGAAGGGGTTGAAGAGG - Intergenic
954510639 3:51121704-51121726 GGGGAATGAGGGAGAGAAAGGGG + Intronic
955043334 3:55337210-55337232 TGTGAATGAAGGGGAGAAAGAGG + Intergenic
955071106 3:55573076-55573098 GGGGAAGGAGGTGGTATAAGTGG - Intronic
955497080 3:59544903-59544925 GGGGATTGGAGTGGTGAAAGAGG - Intergenic
956509869 3:69981804-69981826 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
956703700 3:71981448-71981470 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
957754786 3:84470881-84470903 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
958258812 3:91355278-91355300 TGGGAATCACGGGGTGAAAGTGG - Intergenic
958460010 3:94383028-94383050 GGGGAAGGAATGAGTGAAAGAGG + Intergenic
958934509 3:100242064-100242086 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
959226583 3:103595827-103595849 CTGGAATCAAGGGGTGGAAGTGG - Intergenic
959377255 3:105602236-105602258 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
959590091 3:108069980-108070002 GGGGAAGAAAGGGGTGGCAGTGG - Intronic
959998076 3:112699756-112699778 CAGGAATGAAGGGGTGGAAGTGG + Intergenic
960349714 3:116577153-116577175 CAGGAATCAAGGGGTGGAAGTGG + Intronic
960584172 3:119305407-119305429 TGGGAAAGAAGTGGTGGAAGGGG - Intronic
961710776 3:128826563-128826585 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
961790765 3:129375191-129375213 AAGGAATGAAGGGGTGAGAGTGG - Intergenic
962072189 3:132044651-132044673 GGGGAAGGAAGGGGAGGGAGGGG + Intronic
962741879 3:138367845-138367867 GGGGAAAGAAAGGGAGCAAGAGG + Intronic
963379042 3:144505830-144505852 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
964527488 3:157630897-157630919 GGGGAAGGAAGAGGTTTTAGGGG - Intronic
964679033 3:159317460-159317482 CGGGAATCAATGGGTGGAAGTGG - Intronic
964787290 3:160411635-160411657 GGGAAATGAGTGTGTGTAAGTGG + Intronic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
965007251 3:163042422-163042444 TGGGAATGATGGGGTGTATAGGG + Intergenic
965226561 3:165999325-165999347 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
965676363 3:171201021-171201043 GGGGCAGGAAGAGGTGCAAGCGG + Intronic
966113722 3:176434856-176434878 TGGGAATCATGAGGTGTAAGAGG + Intergenic
967070773 3:185960753-185960775 GGGTAATGAAGCGGAGTGAGAGG - Intergenic
968222512 3:196948927-196948949 GGGGAAGGAAGGGAAGTAAAGGG - Intronic
968491811 4:894104-894126 GGGGAATGCAGGGGTGACATCGG + Intronic
968705725 4:2076520-2076542 TGGGAAGGATGGGGTGTCAGGGG + Intronic
969265099 4:6059404-6059426 TGTGAAGCAAGGGGTGTAAGAGG - Intronic
969708688 4:8830486-8830508 GAGGTATGCAGGGGTGTCAGGGG + Intergenic
970644874 4:18108520-18108542 TTGGAATCAAGGGGTGGAAGTGG - Intergenic
971176284 4:24285400-24285422 GAGGAATGAGAGGGTGAAAGGGG + Intergenic
971570932 4:28209981-28210003 GGGGGAGGAAGGGGAGGAAGGGG - Intergenic
971687182 4:29785640-29785662 CAGGAATCAAGGGGTGGAAGAGG - Intergenic
972201097 4:36715733-36715755 CAGGAATAAAGGGGTGGAAGTGG - Intergenic
972806134 4:42530827-42530849 CAGGAATCAAGGGGTGGAAGTGG + Intronic
972859160 4:43145992-43146014 GGGGAATGAAGGGGAGGTAAAGG + Intergenic
973129981 4:46638266-46638288 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
974289756 4:59914192-59914214 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
976034007 4:80794382-80794404 CAGGAATCAAGGGGTGGAAGTGG - Intronic
977205283 4:94158858-94158880 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
977489884 4:97698626-97698648 CAGGAATCAAGGGGTGGAAGTGG - Intronic
978341367 4:107724095-107724117 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
978814829 4:112892184-112892206 GGGGAAGGAAGGGATGGAAATGG + Intronic
978816091 4:112907476-112907498 GGGGAAAGAAGAGGGATAAGTGG - Intronic
980090975 4:128442551-128442573 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
980497434 4:133604624-133604646 CAGGAATTAAGGGGTGGAAGTGG - Intergenic
980602414 4:135041457-135041479 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
980806964 4:137827813-137827835 GGGGAAGGAAGGGAAGAAAGGGG + Intergenic
980806992 4:137827886-137827908 GGGGAAGGAAGGGAAGAAAGGGG + Intergenic
980807004 4:137827915-137827937 GGGGAAGGAAGGGAAGGAAGGGG + Intergenic
980807014 4:137827944-137827966 GGGGAAGGAAGGGAAGAAAGGGG + Intergenic
980807026 4:137827973-137827995 GGGGAAGGAAGGGAAGGAAGGGG + Intergenic
980807036 4:137828002-137828024 GGGGAAGGAAGGGAAGAAAGGGG + Intergenic
980807048 4:137828031-137828053 GGGGAAGGAAGGGAAGGAAGGGG + Intergenic
980807074 4:137828103-137828125 GGGGAAGGAAGGGAAGGAAGGGG + Intergenic
980807091 4:137828151-137828173 GGGGAAGGAAGGGAAGGAAGGGG + Intergenic
980807107 4:137828199-137828221 GGGGAAGGAAGGGAAGGAAGGGG + Intergenic
980909359 4:138979837-138979859 GTTGAATGAATGGGTGCAAGAGG - Intergenic
980957934 4:139447366-139447388 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
981803204 4:148681967-148681989 GGGGAAAGGAAGGGTGTTAGTGG + Intergenic
981835203 4:149045389-149045411 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
982597579 4:157405600-157405622 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
982623133 4:157731436-157731458 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
983517025 4:168668391-168668413 GGGGGATAAAGGGGTGTCAATGG + Intronic
983872899 4:172842715-172842737 GGGGAAGGAGGGAGAGTAAGAGG + Intronic
983913413 4:173265636-173265658 GGGGAATGAGGGGGTCTTGGGGG - Intronic
984858928 4:184219799-184219821 GGGGAAGGAAGGGGAGGAAAGGG + Intronic
985771452 5:1814507-1814529 TGGGAGTGAAGGGGAGTATGAGG - Intronic
986087336 5:4464339-4464361 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
986404972 5:7416452-7416474 GGGGAAGGACAGAGTGTAAGTGG - Intronic
986944032 5:12992685-12992707 GGGGACTGAAAGGGTGGGAGGGG + Intergenic
988188979 5:27902690-27902712 TGGAAATCAAGGGGTGGAAGTGG + Intergenic
989577965 5:43006599-43006621 GAGGAATCAAGGAATGTAAGTGG + Intergenic
990282000 5:54261059-54261081 GAGGAATGAGGGGCTGCAAGTGG + Intronic
991013586 5:61909437-61909459 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
991031574 5:62087324-62087346 GGGGAAGGAAGCGTTGTGAGTGG - Intergenic
991330548 5:65488271-65488293 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
992058749 5:73020600-73020622 GGGGAATGATGGGTTGGAGGTGG + Intronic
992207082 5:74441508-74441530 GGGGAAAGGAGGGATATAAGAGG - Intergenic
993203593 5:84848992-84849014 CGGGAATCAAGGGGTGGAAGTGG + Intergenic
993320028 5:86460025-86460047 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
993780872 5:92063832-92063854 AAGGAATCAAGGGGTGGAAGTGG + Intergenic
993791978 5:92220361-92220383 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
994917149 5:105994923-105994945 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
995483457 5:112615402-112615424 CAGGAATCAAGGGGTGTAAATGG - Intergenic
995776074 5:115726260-115726282 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
996018758 5:118569324-118569346 AAGGAATCAAGGGGTGGAAGTGG + Intergenic
996392015 5:122972338-122972360 TAGGAATCAAGGGGTGGAAGTGG - Intronic
996825767 5:127679274-127679296 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
996999609 5:129743975-129743997 GGAAACTGAAGGGCTGTAAGAGG + Intergenic
997528263 5:134567176-134567198 GTGGAAGGAAGAGGTGAAAGGGG + Intronic
998131370 5:139653094-139653116 GGGGAAGGACTGGGTGTGAGAGG - Intronic
998215533 5:140235914-140235936 GGGGACTGAAGGGCAGTAATGGG - Intronic
998265015 5:140661572-140661594 GGGGAAGGAAGAGATGTCAGTGG - Intronic
998290130 5:140907099-140907121 CAGGAATCAAGGGGTGGAAGTGG - Intronic
998998317 5:147891371-147891393 AGGCAATGAAGGGGAGGAAGAGG + Intronic
999311354 5:150554017-150554039 GGGGAAGAAAGGGGTGCAGGTGG - Exonic
1000107282 5:158072102-158072124 GGGGTGTGAAGGGGTTGAAGGGG + Intergenic
1001026456 5:168228277-168228299 AGGGAATAAAGGGGTATTAGAGG - Intronic
1001561621 5:172673444-172673466 GAGGAATGAAGAGGTCTCAGGGG - Intronic
1003098325 6:3158415-3158437 GGCGACCTAAGGGGTGTAAGGGG - Intergenic
1004374086 6:15076639-15076661 GGGGAAGGAAGGGCAGTAAAGGG - Intergenic
1005185378 6:23158521-23158543 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1006407598 6:33854378-33854400 GGGGAAGGAAGGAGGGTAAGAGG - Intergenic
1006621393 6:35367098-35367120 AGGAAATGGAGGAGTGTAAGAGG + Intronic
1008022437 6:46595583-46595605 GGGTAAAGAAGGGGTGGAGGAGG + Intronic
1008646828 6:53522726-53522748 GAGGAAAGAAGGGATGGAAGTGG - Intronic
1008652455 6:53577079-53577101 GGGGAAGGAATGGGTGGATGGGG - Intronic
1008906884 6:56687561-56687583 AGTGAATGGAGGCGTGTAAGAGG + Intronic
1008932982 6:56958910-56958932 GGGGAATGAAGATGAGAAAGAGG + Intronic
1008996444 6:57665295-57665317 CGGGAATCACGGGGTGAAAGTGG + Intergenic
1009184957 6:60564088-60564110 TGGGAATCACGGGGTGAAAGTGG + Intergenic
1009344304 6:62595014-62595036 TTGAAATGAAGGGGTATAAGGGG + Intergenic
1009530186 6:64803360-64803382 GGGGACTGAAGGTGTGTGTGTGG + Intronic
1010066806 6:71691805-71691827 GAGGAATGAAGCAGAGTAAGAGG + Intergenic
1010704421 6:79090223-79090245 GGGGAATGAAGGAGGGAAGGAGG - Intergenic
1011069304 6:83363108-83363130 CAGGAATCAAGGGGTGGAAGTGG + Intronic
1011207090 6:84911498-84911520 AAGGAATGAATGAGTGTAAGAGG - Intergenic
1011329563 6:86188502-86188524 AGGGAATGAAGGGGCTGAAGGGG + Intergenic
1011516974 6:88165997-88166019 GGAGAAGGAAGGGGTGGCAGAGG + Exonic
1012730643 6:102875729-102875751 CAGGAATCAAGGGGTGGAAGGGG + Intergenic
1012884273 6:104826827-104826849 GGGGAGAGAAGGGGTGGAATTGG - Intronic
1013070358 6:106723724-106723746 GGGAAATAAAGCGGAGTAAGGGG + Intergenic
1013613863 6:111822974-111822996 GGGTAAAAACGGGGTGTAAGGGG + Intronic
1016576064 6:145571135-145571157 CAGGAATCAAGGGGTGGAAGTGG - Intronic
1017388385 6:153911701-153911723 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1018600086 6:165528954-165528976 CAGGAATCAAGGGGTGGAAGTGG + Intronic
1018619415 6:165715545-165715567 AGGGAATGAAGGGGAGAAGGAGG + Intronic
1018707166 6:166471321-166471343 GCGGAATGGAGGGGTGGGAGGGG - Intronic
1020365619 7:7377931-7377953 AGGGAAAGAAGGAGTCTAAGAGG + Intronic
1020396858 7:7726575-7726597 CAGGAATCAAGGGGTGGAAGTGG + Intronic
1021552116 7:21882174-21882196 TGGAAATGAAGGGGAGGAAGAGG + Intronic
1021598065 7:22337771-22337793 GGGGAATACAGCAGTGTAAGAGG + Intronic
1021674692 7:23068243-23068265 AGGCAATGAAGGGGTGAAAATGG + Intergenic
1021989020 7:26124375-26124397 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1022079093 7:27001786-27001808 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1022313289 7:29218193-29218215 GGCGAGTGAGGGGGTGGAAGGGG - Intronic
1022624655 7:32022518-32022540 GGGGAATGAAGTGGTTTAAGGGG + Intronic
1022812900 7:33886602-33886624 GGGGAATTAGGGGGTGGAACAGG + Intergenic
1023594029 7:41810092-41810114 GGGGGATGATGGGGTGTCGGGGG + Intergenic
1024268270 7:47622869-47622891 AGGGAAAGAAGGGGTGGTAGAGG - Intergenic
1026046282 7:66907668-66907690 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1027318608 7:76998854-76998876 GGGGTATGTGGGGGTGTAGGTGG + Intergenic
1027738339 7:81964656-81964678 GGGGAATGGAGAGGTATAAGTGG + Intronic
1028141934 7:87283469-87283491 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1028851126 7:95538789-95538811 GGGGAAAGAAAGTGTGTGAGGGG + Exonic
1030368964 7:108675495-108675517 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1032152895 7:129445516-129445538 CAGGAATCAAGGGGTGGAAGTGG - Intronic
1032553929 7:132812105-132812127 TGGGAATGAAAGGGGGAAAGGGG - Intronic
1033076468 7:138254496-138254518 CAGGAATCAAGGGGTGAAAGTGG + Intergenic
1033485651 7:141786618-141786640 CTGCAATGAAGGGGTGTATGTGG - Intronic
1033653697 7:143360220-143360242 GGGTAAGGAAGGGGTGTGAAGGG - Intronic
1036546196 8:9771820-9771842 GGGGAATGAAGCGGGGAGAGAGG + Intronic
1036559742 8:9891317-9891339 GGGCAATGAAGTTGTGAAAGTGG + Intergenic
1037675524 8:21047736-21047758 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1038411988 8:27366263-27366285 GGGGGATGAAGAGATGGAAGGGG - Intronic
1038622296 8:29155556-29155578 GAGGAAGGAATGGGTGTGAGAGG + Intronic
1038694729 8:29796647-29796669 GGGGCATGGAGGTGTGGAAGCGG - Intergenic
1039743289 8:40401554-40401576 GGGGAAGGAAAGGGAGTAGGGGG - Intergenic
1041062150 8:54044577-54044599 GGGGGGTGACGGGGTGGAAGGGG + Intergenic
1041935503 8:63327450-63327472 CAGGAATCAAGGGGTGAAAGTGG + Intergenic
1041986385 8:63925923-63925945 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1042481313 8:69306818-69306840 GGGGAGTGATGGGGTGGGAGAGG + Intergenic
1042843473 8:73147682-73147704 TGGGAACAAAGGGGTGGAAGTGG - Intergenic
1044132071 8:88535948-88535970 GTGGAATGAAAGGTAGTAAGAGG + Intergenic
1044818964 8:96143371-96143393 GGGGAAGGGAGGGATGAAAGGGG - Exonic
1045221978 8:100208015-100208037 CAGGAATCAAGGGGTGGAAGTGG + Intronic
1047701381 8:127452658-127452680 GGGGAAGAAAGGGGAGGAAGAGG + Intergenic
1049337675 8:142095103-142095125 AGGGAATGGAGGAGTGTGAGGGG + Intergenic
1049760334 8:144329280-144329302 GTGGAATAAAGGGCTGGAAGTGG + Intergenic
1050143415 9:2540034-2540056 GGGGAAGTAAGGGGTTGAAGTGG + Intergenic
1050795751 9:9539321-9539343 AGGGAATGAAAGGGGGTAGGTGG + Intronic
1050930980 9:11326296-11326318 AAGGAATGAAGAGGTGAAAGTGG - Intergenic
1051402004 9:16693159-16693181 GGGGGATGAGGGGGTGAGAGTGG + Intronic
1052218254 9:25991956-25991978 GGGTAATGAAGCAGTTTAAGTGG - Intergenic
1052231073 9:26153440-26153462 GGGGAAGGAAGGGAAGGAAGGGG + Intergenic
1052416496 9:28184561-28184583 GGGGGAGGAAGGAGGGTAAGAGG + Intronic
1052737134 9:32354124-32354146 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1053305841 9:36984283-36984305 GGGCAAGGAAGGGGTGTTATGGG + Intronic
1055948827 9:81712081-81712103 GGGGAATGCAGGGTGGTGAGGGG - Intergenic
1056232656 9:84562610-84562632 GAGAAATGCAGGGGTGTGAGAGG + Intergenic
1056314038 9:85371482-85371504 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1056544933 9:87605800-87605822 GGGGACTGGAGGGGTGGGAGAGG - Intronic
1056822742 9:89854906-89854928 GTGGAGGGAAGGGCTGTAAGAGG + Intergenic
1057195835 9:93115379-93115401 GGGGAATGAGGGGGTGTGTGAGG + Intergenic
1058259068 9:102808235-102808257 AAGGAATCAAGGGGTGGAAGTGG - Intergenic
1060607952 9:124934450-124934472 GAGGAATGCAGGAGTGAAAGGGG + Intronic
1061255652 9:129453345-129453367 GAGGGATGGAGGGGTGGAAGAGG + Intergenic
1185466380 X:357191-357213 GGGGAATGATGAGGTGCAAAAGG + Intronic
1185787596 X:2903901-2903923 GGGGGGTGAAGGGGTGGAGGTGG + Intergenic
1186997953 X:15143780-15143802 ATGGAATGAAGGGGTGGAAGGGG - Intergenic
1187843825 X:23515544-23515566 GGGGAAGGGAGGGGAGGAAGGGG - Intergenic
1188518342 X:31011241-31011263 GGGGAAGGAAGGTGCATAAGTGG + Intergenic
1190970403 X:55342603-55342625 GGGGAAGGAAGGGGTGCTGGAGG - Intergenic
1191778353 X:64842976-64842998 GAGGAGTGAGGGGGTGAAAGGGG - Intergenic
1191933111 X:66395597-66395619 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1192448962 X:71230905-71230927 GGGGAAGGAAGAGGGGGAAGGGG + Intergenic
1193573078 X:83168584-83168606 GGGAAATGTAGGGGTGTATGGGG - Intergenic
1193833154 X:86311554-86311576 CAGGAATCAAGGGGTGGAAGTGG + Intronic
1193904667 X:87227270-87227292 CAGGAATTAAGGGGTGGAAGTGG + Intergenic
1193979079 X:88158868-88158890 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1194210481 X:91063801-91063823 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1194233050 X:91347737-91347759 AAGGAATCAAGGGGTGGAAGTGG + Intergenic
1194343510 X:92732533-92732555 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1194513229 X:94820811-94820833 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1194604179 X:95960409-95960431 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1194849051 X:98850720-98850742 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1195666031 X:107432036-107432058 GGGGTGTGAAGGAGTGGAAGTGG + Intergenic
1195782147 X:108478424-108478446 CAGGAATCAAGGGGTGGAAGTGG - Intronic
1195809590 X:108815397-108815419 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1195819776 X:108931332-108931354 GGGGAGTGAGGGGTTGCAAGGGG - Intergenic
1196275825 X:113764146-113764168 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1197062672 X:122199789-122199811 TAGGAATCAAGGGGTGGAAGTGG - Intergenic
1197720640 X:129742403-129742425 GGGGAATGAATGGGAGGGAGGGG - Intronic
1198308408 X:135405205-135405227 CAGGAATTAAGGGGTGGAAGAGG + Intergenic
1198701499 X:139401747-139401769 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1199024575 X:142921176-142921198 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1199116372 X:143997817-143997839 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1199144261 X:144347525-144347547 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1199430887 X:147758529-147758551 AGTGACTGAAAGGGTGTAAGGGG - Intergenic
1200340272 X:155389190-155389212 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1200521467 Y:4213467-4213489 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1200651865 Y:5849198-5849220 CAGGAATCAAGGGGTGGAAGTGG + Intergenic
1200793031 Y:7316222-7316244 TGGGAATGAGGGAGGGTAAGTGG - Intergenic
1201400124 Y:13596022-13596044 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1201529473 Y:14976464-14976486 CAGGAATCAAGGGGTGGAAGTGG - Intergenic
1202606471 Y:26643654-26643676 GTGGAATGAAGTGGAGTGAGTGG + Intergenic