ID: 1114535748

View in Genome Browser
Species Human (GRCh38)
Location 14:23421187-23421209
Sequence ACCGCAGGTGTTACACTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 43}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114535748_1114535755 26 Left 1114535748 14:23421187-23421209 CCTGGAAGTGTAACACCTGCGGT 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1114535755 14:23421236-23421258 TGGGAGGAGTGCTGTAGACAGGG 0: 1
1: 1
2: 3
3: 71
4: 1783
1114535748_1114535752 10 Left 1114535748 14:23421187-23421209 CCTGGAAGTGTAACACCTGCGGT 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1114535752 14:23421220-23421242 TCCAACAAGAATGTAATGGGAGG 0: 1
1: 0
2: 1
3: 13
4: 120
1114535748_1114535751 7 Left 1114535748 14:23421187-23421209 CCTGGAAGTGTAACACCTGCGGT 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1114535751 14:23421217-23421239 AAATCCAACAAGAATGTAATGGG 0: 1
1: 0
2: 2
3: 23
4: 350
1114535748_1114535750 6 Left 1114535748 14:23421187-23421209 CCTGGAAGTGTAACACCTGCGGT 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1114535750 14:23421216-23421238 GAAATCCAACAAGAATGTAATGG 0: 1
1: 0
2: 2
3: 17
4: 270
1114535748_1114535754 25 Left 1114535748 14:23421187-23421209 CCTGGAAGTGTAACACCTGCGGT 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1114535754 14:23421235-23421257 ATGGGAGGAGTGCTGTAGACAGG 0: 1
1: 0
2: 3
3: 37
4: 811

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114535748 Original CRISPR ACCGCAGGTGTTACACTTCC AGG (reversed) Intronic
902834082 1:19035599-19035621 ACTGCAGGTGTCACACATCCAGG - Intergenic
902894859 1:19472428-19472450 GCCGCAGGTGTAACACAGCCAGG + Intronic
906797717 1:48711097-48711119 ACCGCAGGTGATCCACCTCCAGG + Intronic
912659409 1:111515023-111515045 GCCGCCTGTGTTACACTGCCTGG + Intronic
917420096 1:174854304-174854326 AAAGCAGGTAATACACTTCCAGG + Intronic
922823921 1:228503877-228503899 AGAGCAGGTTTTACACTTTCAGG + Intergenic
1075219778 10:120575095-120575117 ACAGCAGGTGTTACTCTAGCAGG - Intronic
1078396113 11:10983659-10983681 ACAGCAGATGTTTGACTTCCTGG - Intergenic
1086937422 11:92760024-92760046 AACGCAAATGTTACACTCCCAGG - Intronic
1088647071 11:111926094-111926116 AATGCACGTGTTTCACTTCCCGG - Exonic
1096277715 12:50224804-50224826 ACTGCAGCTGTTTGACTTCCTGG + Intronic
1098137081 12:67414153-67414175 TCAGCAGGTGTTACAGATCCGGG + Intergenic
1107315402 13:39126220-39126242 ATCTCAGGTGGTAGACTTCCAGG - Intergenic
1108438755 13:50427423-50427445 ACCACAGGTGTTAGTTTTCCTGG - Intronic
1113542636 13:111121130-111121152 ACTGCAGGTGTCTCACTTCTCGG + Intronic
1114535748 14:23421187-23421209 ACCGCAGGTGTTACACTTCCAGG - Intronic
1119238803 14:73041853-73041875 ACCTCAAGTGTTCCACTGCCTGG - Intergenic
1120899805 14:89565955-89565977 ACAGCAGGTTTTATATTTCCGGG - Intronic
1121734081 14:96205874-96205896 ACAGCAGGTGTTGCTGTTCCAGG + Intronic
1145813946 17:27782074-27782096 CCCGCAGCTGTTCCACTGCCCGG - Exonic
1146985132 17:37208893-37208915 ACCGCAGGTGGTGTACTTCAAGG - Intronic
1155313360 18:24546344-24546366 GCCACAGGTGTCACATTTCCAGG + Intergenic
1160958489 19:1706321-1706343 CTCACAGGTGTTGCACTTCCAGG + Intergenic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
1166248784 19:41551388-41551410 ACCTCAGGTGATCCACCTCCTGG + Intronic
927996547 2:27491086-27491108 AGAGCATATGTTACACTTCCTGG - Intergenic
929995471 2:46823530-46823552 ACTGCAGTTGTTATAATTCCAGG - Intronic
932305325 2:70697893-70697915 ACCAGAGGTGATACACCTCCAGG + Intronic
937875749 2:126824074-126824096 CCTGCATGTGTTTCACTTCCTGG + Intergenic
948729654 2:239954855-239954877 AACGCAGGACTCACACTTCCGGG - Intronic
1176064755 20:63188675-63188697 TCCACAGGTGCTACTCTTCCAGG + Intergenic
1178846976 21:36182169-36182191 ACCCCAGGTGCTCCAATTCCGGG - Intronic
965191745 3:165539166-165539188 ACCTCAGGTTTTACCCTTCCTGG - Intergenic
971050893 4:22861400-22861422 ACCCAAGGTGATACACTTCCTGG + Intergenic
971368725 4:25998065-25998087 ACCTCAGGTGATCCACTCCCTGG - Intergenic
979306748 4:119154554-119154576 ACAGAAGGTATTACAATTCCTGG + Intronic
982898563 4:160967086-160967108 ACTGGAGGTATCACACTTCCTGG - Intergenic
988254941 5:28809275-28809297 TGCGCAGGTGCCACACTTCCTGG - Intergenic
994183596 5:96794904-96794926 ACCGCAGGTTTGTCACTTGCTGG + Intronic
1007166336 6:39831565-39831587 AACTCAGGAGTTAGACTTCCTGG - Intronic
1015918475 6:138242661-138242683 ACCACAGGGTTTAAACTTCCAGG + Intronic
1027256587 7:76434651-76434673 AAGGCAGGTGTTAGCCTTCCTGG + Intronic
1027282309 7:76617667-76617689 AAGGCAGGTGTTAGCCTTCCTGG - Intronic
1036430535 8:8685700-8685722 CCCTCAGGAGTTACTCTTCCAGG + Intergenic
1043797459 8:84562294-84562316 ACTGCAGGTTTTAAACTTGCTGG - Intronic
1049035563 8:140073072-140073094 ACCGGAGCTCTTACACTGCCGGG + Intronic
1186693205 X:12001984-12002006 ATTGCAGCTGTTACTCTTCCTGG + Intergenic
1196097398 X:111814863-111814885 AACTCAGGTGCTACACTTCAGGG + Intronic