ID: 1114537900

View in Genome Browser
Species Human (GRCh38)
Location 14:23434418-23434440
Sequence AACTAGTTCTTGAGGAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 290}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114537900_1114537903 -8 Left 1114537900 14:23434418-23434440 CCCTTTTTCCTCAAGAACTAGTT 0: 1
1: 0
2: 2
3: 23
4: 290
Right 1114537903 14:23434433-23434455 AACTAGTTCTAACAGCTTCCTGG 0: 1
1: 0
2: 0
3: 14
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114537900 Original CRISPR AACTAGTTCTTGAGGAAAAA GGG (reversed) Intronic
900076168 1:819582-819604 AACTAGTTTTTAAGGAAATATGG + Intergenic
901557193 1:10040979-10041001 AACTATCTTCTGAGGAAAAAAGG - Intronic
901950062 1:12737516-12737538 AAAGGGTTCTTCAGGAAAAAGGG + Intergenic
902613715 1:17612257-17612279 AACCAGTTCTGCAGGAAAAAGGG - Intronic
906631742 1:47375586-47375608 AACTTGTTCTTCATGAGAAATGG + Intronic
906820041 1:48919775-48919797 AAATGTTTCTTGAGGAAAAAGGG + Intronic
907940869 1:59085708-59085730 AACAAGTTCTTGATTGAAAAGGG + Intergenic
908190150 1:61694560-61694582 ATCTAGTACATGAAGAAAAATGG + Intronic
909602561 1:77476038-77476060 ACCTAGTTCTCTAGGAGAAATGG - Intronic
911255868 1:95632796-95632818 TACTAGTTCCTGAGAAAAACTGG + Intergenic
912889624 1:113515136-113515158 AACCATTTCTTGAGTAAAAATGG + Intronic
914214179 1:145609299-145609321 AACAAGTTTTTGAAGAGAAAAGG - Intronic
914466120 1:147929702-147929724 AACAAGTTTTTGAAGAGAAAAGG - Intronic
915451500 1:156008567-156008589 AGCTAGTTCTTAACGAGAAAGGG + Intergenic
916914176 1:169388317-169388339 CACTAATTCTGGGGGAAAAAAGG - Intronic
919656120 1:200198837-200198859 TACTAGTGCTTGAGGAAAAAAGG + Intergenic
919958654 1:202443469-202443491 AACTAGTTATTGTTGAAACATGG + Intronic
920394579 1:205634873-205634895 AAACACTTCTTTAGGAAAAAGGG - Intergenic
921300088 1:213743848-213743870 AAAGAGTGCTTGAGGAAAGAGGG + Intergenic
921535748 1:216346698-216346720 AACTAGATCTTCAGGAATTAAGG - Intronic
924504464 1:244668531-244668553 TTCTAGTTTTTGAGGAGAAATGG + Intronic
1063895965 10:10682350-10682372 AAATTGTTCTTTAAGAAAAACGG - Intergenic
1064888422 10:20139238-20139260 TACTAGTTGTTAAGGCAAAATGG + Intronic
1064964504 10:21001257-21001279 ACCTAGTGCTAGAGGAAAATCGG + Intronic
1066163684 10:32762119-32762141 AACTTCTTCCTGAGGAATAAAGG + Intronic
1067817629 10:49494526-49494548 ATCTGATTCTTCAGGAAAAAGGG - Intronic
1068613771 10:59089235-59089257 AACTAGTTGTTTAGGGGAAAGGG + Intergenic
1068817931 10:61338673-61338695 AACAGATTCTTGAGGAAATAAGG - Intergenic
1070337587 10:75468929-75468951 AACTAGGACGAGAGGAAAAAAGG + Intronic
1073407735 10:103312562-103312584 ATATAATTCTTGGGGAAAAAAGG - Intronic
1074391753 10:113063770-113063792 AAAGAGTTCTTTAGGAAAAGGGG + Intronic
1075285300 10:121179938-121179960 AAGTTATTTTTGAGGAAAAAAGG - Intergenic
1076579981 10:131500914-131500936 AAGTAGCTCTTGAGAAAAAAAGG + Intergenic
1078196615 11:9142047-9142069 AAGTAGTCCCTGAGGAAAACTGG - Exonic
1078644320 11:13125809-13125831 AACTATTAACTGAGGAAAAATGG - Intergenic
1078958177 11:16227687-16227709 AACTTGTTCTTAATAAAAAATGG - Intronic
1079566874 11:21893187-21893209 AACTAGTGCTGCAGGAAAAGTGG + Intergenic
1079574054 11:21981016-21981038 AACTATTTAGTGAGGAAAGAAGG - Intergenic
1080096510 11:28414676-28414698 AACTATTTGGTGAGGAAAATAGG + Intergenic
1080354055 11:31420766-31420788 AAATAGTGATTGAGAAAAAATGG - Intronic
1082266820 11:50128363-50128385 AACTAGTACATGAGGAATATGGG + Intergenic
1082289269 11:50350205-50350227 AACTAGTACATGAGGAATATGGG - Intergenic
1082652897 11:55816420-55816442 AACTAGTTCTTTGGTTAAAAAGG - Intergenic
1083904723 11:65662377-65662399 ACCTGCTTCTTGAGGGAAAACGG + Intronic
1086592089 11:88526758-88526780 ATCTAGTATTTGAAGAAAAATGG + Intronic
1087270006 11:96101390-96101412 AAATAGTCATTGAGGAGAAAGGG + Intronic
1087364768 11:97204125-97204147 AGCTATTTGTTGAGGAAATAAGG - Intergenic
1087483441 11:98731567-98731589 TACTTGCTCTTGAAGAAAAAGGG - Intergenic
1087970594 11:104476950-104476972 AAATTGTCCTTGAAGAAAAATGG + Intergenic
1091526918 12:1312000-1312022 ATCATGTTCTTGAGGAAAAATGG - Intronic
1091875608 12:3930778-3930800 AGCTTCTTCTTCAGGAAAAAGGG + Intergenic
1093260168 12:16926226-16926248 AAATGAATCTTGAGGAAAAAAGG + Intergenic
1094413977 12:30198720-30198742 TACTAGTTCTTGAAGAAATTCGG - Intergenic
1096721836 12:53528803-53528825 AATTAGTTCTTTAGGAGAATAGG + Intronic
1096896424 12:54825002-54825024 AAACAGTTCTTCAGGAATAAAGG - Intergenic
1097396763 12:59084695-59084717 AAATTGTTCTTCAGGAAAGATGG - Intergenic
1098135619 12:67398667-67398689 ATTTAGTTCCTGAGGATAAAAGG - Intergenic
1098309373 12:69133052-69133074 ACCAAGCTATTGAGGAAAAAAGG - Intergenic
1099684565 12:85868172-85868194 AAGTTGTCCTTGAGGAAAACTGG - Intergenic
1101885582 12:108658495-108658517 AACTATTTCTTTGTGAAAAAAGG + Intronic
1102245064 12:111350650-111350672 AACTAGTTTTTAAGGCACAATGG + Intergenic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1104140467 12:125982805-125982827 AACAAGTTCTTCAAGGAAAATGG + Intergenic
1106057005 13:26247393-26247415 AAATAGTGCTTGAGCAAAATGGG - Intergenic
1106268950 13:28135931-28135953 AACTTTTTCTTGAGGACAATTGG - Intergenic
1106854325 13:33831983-33832005 AAATACTTCCTGAGTAAAAATGG - Intronic
1107257881 13:38452197-38452219 AACTATTTTTTGAGGAACTAAGG + Intergenic
1107270851 13:38614347-38614369 AGCTAATTCTTCAGGAAATATGG + Intergenic
1107347739 13:39480656-39480678 AAGTTTTTCTTGAGTAAAAAAGG - Intronic
1108789652 13:53952256-53952278 ATGTATTTCTAGAGGAAAAATGG - Intergenic
1109159582 13:58955925-58955947 AATTATTTCTGGAGGGAAAAAGG + Intergenic
1111152562 13:84275416-84275438 AAATATTTCTTGAGGGAGAAGGG - Intergenic
1111894864 13:94128884-94128906 AAGTAGTTATGGAGGAAGAATGG - Intronic
1112206216 13:97325807-97325829 AACTAGTAAATGAGGAAGAAAGG - Intronic
1112910919 13:104483256-104483278 AACTAGTTCTGAAAAAAAAATGG + Intergenic
1113125389 13:106972632-106972654 CACTTGTTGTTCAGGAAAAAGGG + Intergenic
1113745846 13:112743894-112743916 AACCAGGTCTGAAGGAAAAAGGG + Intronic
1114537900 14:23434418-23434440 AACTAGTTCTTGAGGAAAAAGGG - Intronic
1115022639 14:28701303-28701325 AACTAGTTCTTCAGAATGAATGG + Intergenic
1116566618 14:46452779-46452801 TATTAGTTCTTGTGGAAATAGGG + Intergenic
1119860480 14:77932416-77932438 AGCTAGTTCCAGAGGAAAGAGGG + Intronic
1120251513 14:82065347-82065369 AAATAGTTCTTGTCGTAAAATGG - Intergenic
1120265922 14:82251196-82251218 AATGACTTCTTAAGGAAAAATGG - Intergenic
1120782636 14:88499368-88499390 AACTAGTTCTCAAGAAGAAATGG + Intronic
1123973333 15:25529076-25529098 AGCTTGATCTTCAGGAAAAATGG + Intergenic
1126201215 15:45988659-45988681 AACTAATATTTGAGAAAAAAAGG - Intergenic
1127467022 15:59254148-59254170 TACTAATTATTGAGGAATAAAGG + Intronic
1127918695 15:63476265-63476287 AAATAGTCATTGAGGAAAAATGG - Intergenic
1128038019 15:64543750-64543772 AACTAGTTTTTGATTTAAAAAGG - Intronic
1128424517 15:67526772-67526794 ACCTAGTTCTAGGGAAAAAATGG - Exonic
1128814159 15:70593783-70593805 AAATAGTATTTAAGGAAAAAAGG - Intergenic
1129303126 15:74638083-74638105 AAATAGTCTTTGAAGAAAAAAGG - Intronic
1129939739 15:79484984-79485006 AAATATTTCTTAATGAAAAAGGG - Intergenic
1131316391 15:91341850-91341872 AAATATTTCTTAATGAAAAATGG + Intergenic
1131847079 15:96499444-96499466 AACAATTTGTTGAGGAAAGAGGG - Intergenic
1133183344 16:4075979-4076001 ATCTAGTTAATGAGGAGAAAAGG + Intronic
1134425441 16:14138965-14138987 AACTAGATCTAGAAGAAAACAGG + Intronic
1135777091 16:25266330-25266352 AAATTTTTCTTTAGGAAAAATGG - Intergenic
1136546452 16:30957708-30957730 GACTAGTCCCTGAGGAAAAGGGG - Exonic
1137264601 16:46858493-46858515 AACTAGTTCCTGGGGAGAATGGG + Intergenic
1138160647 16:54750054-54750076 ATCTAGTTCTGCAAGAAAAATGG + Intergenic
1138218625 16:55228309-55228331 AAGTAGTTATTGAGTCAAAAGGG + Intergenic
1139407696 16:66732121-66732143 AACTTGCTCTCGAGGAAGAAAGG + Intronic
1141243317 16:82283456-82283478 AGCCATTTCTTCAGGAAAAAGGG - Intergenic
1144104555 17:11973391-11973413 AACTAATTCTTGTCGTAAAATGG + Intergenic
1144290649 17:13823028-13823050 AAATATTTGTAGAGGAAAAAGGG + Intergenic
1145394742 17:22486290-22486312 AAATAGTTCTTTGGGTAAAAAGG - Intergenic
1146236355 17:31168141-31168163 AACTATTCATTGTGGAAAAATGG + Intronic
1146956573 17:36939549-36939571 ATCCAGTCCTTGAGGAAAACCGG - Intronic
1149010516 17:51851785-51851807 AAGTAATTCATGAGGAAACATGG - Intronic
1149900108 17:60468314-60468336 AAAAAGTCCTTGAGAAAAAAAGG + Intronic
1151725720 17:75882820-75882842 TAGTAGTGCTTGAGAAAAAAAGG + Intronic
1153127840 18:1817606-1817628 AACAAGTTTTTGGGGAAAAATGG - Intergenic
1153567075 18:6429318-6429340 AGCCAGTTGTTGAGGATAAATGG - Intergenic
1153720690 18:7898885-7898907 AACTACTTCTATAGGAAATATGG + Intronic
1154241190 18:12655859-12655881 AGCTATTTCCAGAGGAAAAATGG - Intronic
1155862661 18:30923112-30923134 AAAAACCTCTTGAGGAAAAAAGG + Intergenic
1156184739 18:34648782-34648804 ATCTATTTCTTGAAGACAAAGGG - Intronic
1158514699 18:58121298-58121320 AGGTAGTTCCTGAGGAAAACCGG - Intronic
1159205023 18:65238309-65238331 AACTATTTTTTAAGGAAGAAAGG + Intergenic
1159550574 18:69891846-69891868 CATTAGTTCTTGAGCAAAGATGG - Intronic
1162659145 19:12156146-12156168 ATTTAGTTTTTCAGGAAAAAAGG + Intronic
1163327089 19:16611618-16611640 AACTAGAACTTGGGGTAAAATGG - Intronic
1164824160 19:31272240-31272262 AAATACTTATAGAGGAAAAAAGG - Intergenic
1168071564 19:53955734-53955756 AACTAACACTTGAGGAAGAAGGG + Intergenic
1168324705 19:55532142-55532164 AACTCGTGTTTGAGGCAAAAAGG + Intronic
925507868 2:4588962-4588984 AACTGGATTTTGAGGAAGAAGGG - Intergenic
925689173 2:6503853-6503875 AACAATTTATTTAGGAAAAAAGG + Intergenic
926515111 2:13833884-13833906 AGCTAGGTCTTGAGGAAAAACGG - Intergenic
926894002 2:17664366-17664388 CTCTAGTTATTGAGGAAAACTGG - Exonic
927452291 2:23219493-23219515 AACCAGTGCTTGAGAAAAATGGG + Intergenic
928793339 2:34985522-34985544 AGCTTGTTTTTAAGGAAAAATGG + Intergenic
929778171 2:44941379-44941401 ATCAACTTCTTTAGGAAAAAGGG + Intergenic
932408557 2:71530590-71530612 ACCTCCTTCTAGAGGAAAAATGG - Intronic
932640950 2:73445959-73445981 AAGGAGTTCATGATGAAAAATGG - Intronic
933496406 2:83055136-83055158 AATTATTTCTGGAGGACAAAGGG - Intergenic
933914610 2:86976590-86976612 TTCTTGTTCTTCAGGAAAAACGG - Exonic
934008383 2:87793309-87793331 TTCTTGTTCTTCAGGAAAAACGG + Exonic
934848277 2:97677713-97677735 AACTTGTTCCTGAGGAAACCTGG + Intergenic
935474591 2:103503048-103503070 AATTAGATATTGAAGAAAAATGG - Intergenic
937595183 2:123663629-123663651 AAATATTTCTTTAGGATAAATGG - Intergenic
938694587 2:133823744-133823766 AACTATTTCTTGAGAAACATTGG - Intergenic
939077205 2:137618046-137618068 AACTATTTGTTGAGGATAACTGG - Intronic
939173668 2:138724568-138724590 AAATAGTTCCAGGGGAAAAATGG - Intronic
940689361 2:156896169-156896191 TACTGGTGCTTGAGGAAAACAGG + Intergenic
941459856 2:165756626-165756648 AACTAGAGCTTGAAAAAAAAAGG + Intronic
941571945 2:167181628-167181650 TATTTGTTCTGGAGGAAAAAAGG - Intronic
941746485 2:169092334-169092356 AGCTGGTGCTTGAGGAAAAGAGG - Intronic
943913251 2:193594447-193594469 AACTAGTTCTGGAGAAATAGAGG + Intergenic
944105845 2:196078492-196078514 GAGTAGTTCTGTAGGAAAAAAGG - Intergenic
947322144 2:228932130-228932152 AACTACTTCTCAAGGAAATATGG - Intronic
948330226 2:237158734-237158756 AACCAGCTCTCCAGGAAAAATGG - Intergenic
1168733711 20:111268-111290 TCCTAGTTGCTGAGGAAAAAGGG - Intergenic
1169826431 20:9773524-9773546 AACTAGTTCATAAGTGAAAAAGG + Intronic
1172184416 20:33022398-33022420 GAGTAGTTCTTAAGGAACAAGGG - Intronic
1173156302 20:40613724-40613746 AAATGGTTATTGATGAAAAAGGG - Intergenic
1173781555 20:45760902-45760924 AAATAATTTTTGTGGAAAAATGG + Intronic
1174512881 20:51068273-51068295 AGCTGGTTCTTGACAAAAAAGGG - Intergenic
1174584838 20:51600300-51600322 AACTAATTCTTTAGGCAACATGG - Exonic
1174706971 20:52667132-52667154 AACTCGTTCTTGAGAAATAGTGG + Intergenic
1174779249 20:53373076-53373098 AACTTGTTCTTGTGAGAAAATGG + Intronic
1174907666 20:54569122-54569144 AATTAGTTTTAGAGGTAAAATGG + Intronic
1177186784 21:17806356-17806378 AACTATGGCTTAAGGAAAAAAGG + Intronic
1177392675 21:20496345-20496367 AACTAGTTCTTTAGGCACACAGG + Intergenic
1177400943 21:20605026-20605048 AGCTAGATCTTGTGGAAAACTGG - Intergenic
1178027154 21:28481000-28481022 AACTTGTTTTTAAGGAAAAAAGG - Intergenic
1178136226 21:29630478-29630500 AAATAGTTCTTTAATAAAAAGGG + Intronic
1181504560 22:23343550-23343572 AATTCATTCTTGAGGAACAACGG - Intergenic
1181655676 22:24296162-24296184 AATTCATTCTTGAGGAACAACGG - Intronic
1181709557 22:24673781-24673803 AATTCATTCTTGAGGAACAACGG - Intergenic
1182814782 22:33151855-33151877 ATCTAGTTCATGAGGAATATTGG + Intergenic
951001431 3:17564561-17564583 AACTGATTCTTGAAGAAAGAAGG + Intronic
951026857 3:17839958-17839980 GAATAGTTTTTGAGGAAAAGTGG + Intronic
951307277 3:21080726-21080748 AACATCTTTTTGAGGAAAAAGGG - Intergenic
951731929 3:25819429-25819451 AAGTAGCTATTGAGGAAAACAGG + Intergenic
952258642 3:31717263-31717285 AACTACCTCTTGAAGCAAAATGG - Intronic
956011540 3:64836927-64836949 AGCAAGTTCTTAAGGAAAAGTGG + Intergenic
956908687 3:73794518-73794540 AACTAGTACATGAGGAATATGGG + Intergenic
957178467 3:76844406-76844428 AACTACTTCATCAGGAGAAATGG + Intronic
959190238 3:103102639-103102661 AGATAGGTCTTCAGGAAAAAAGG - Intergenic
960386730 3:117029504-117029526 AACTTGTTTTTCTGGAAAAAAGG + Intronic
961050824 3:123745418-123745440 AACTTGGTATTGAAGAAAAAAGG + Intronic
961164886 3:124756790-124756812 AAATAGTTCTTGTCGTAAAATGG - Intergenic
962881720 3:139584198-139584220 AACAAGTTCTCAAGGAAAGAAGG - Intronic
963073479 3:141324381-141324403 AGCCAGTTCTTGGGGAAAAGAGG + Intronic
963134603 3:141889902-141889924 ATCCAGTGCTTGAGGAGAAAAGG - Intronic
963421573 3:145067120-145067142 AACTAGTTGTTAAGGAATCAAGG + Intergenic
964217641 3:154305007-154305029 TACTAGTTGTTAAAGAAAAATGG - Intronic
964911963 3:161793983-161794005 TATTATTTTTTGAGGAAAAAGGG + Intergenic
964950706 3:162288970-162288992 AAGTAGTTCTAGAGATAAAATGG + Intergenic
965788888 3:172366405-172366427 ATTTAGTTCTTGAGTAAAAAGGG + Intronic
966098435 3:176236004-176236026 AAGTAATTCTTTAGGAGAAAAGG - Intergenic
970427762 4:15961722-15961744 AACTTTTTCTTGTGGAAATAAGG - Intronic
971212617 4:24633826-24633848 CACTAGATTTTGAGGAAAAGTGG - Intergenic
976135339 4:81929941-81929963 AACCAGTTCTTGAAGACACAAGG + Intronic
976645870 4:87386871-87386893 AACTAGTATTTTAGGAAAAAGGG + Intronic
978300230 4:107260394-107260416 AAAAATTTCTTGAGGAAGAATGG - Intronic
979833590 4:125332066-125332088 ATCTATATTTTGAGGAAAAAGGG - Intronic
980225044 4:129972053-129972075 AACTACCTGTTGAGGAAAGATGG - Intergenic
980483927 4:133428280-133428302 AATTAGGTTTTGAGGAAAAAAGG + Intergenic
981102391 4:140843847-140843869 AACTAATTTTTTAGGAGAAAAGG - Intergenic
981928297 4:150163459-150163481 TAGTAGTTATTGAAGAAAAAAGG - Intronic
982040610 4:151391869-151391891 AAGTTGTTCCTGAGCAAAAAAGG + Intergenic
982060442 4:151599270-151599292 AACTAGCTCTTGTTGAATAAGGG - Intronic
983276038 4:165618979-165619001 AACCACTTCTTAAGGAAATAAGG + Intergenic
984364145 4:178776463-178776485 AACTAGTTCATGAGGTGAAAAGG - Intergenic
985011390 4:185586058-185586080 GACTAGTTGTTGAGAAAACAGGG - Intronic
986840852 5:11695569-11695591 TTCTATTTCTTGAGAAAAAATGG + Intronic
988617315 5:32787460-32787482 AAGTTGTTCTTGAGGGAAAAGGG - Exonic
989179232 5:38559268-38559290 CACTGTTTCGTGAGGAAAAACGG + Intronic
989709764 5:44383901-44383923 AAATAATTGTTGAGGAAAATAGG - Intronic
990014786 5:51046626-51046648 AACTTGTTTTTGAGGGAAGATGG - Intergenic
990021628 5:51134882-51134904 AAATAGTTGCTGAGGATAAAAGG - Intergenic
990032439 5:51278098-51278120 AACCATTTCTTGAAAAAAAATGG - Intergenic
990265122 5:54067041-54067063 AAGTAGTGATTGAGGAAACACGG - Intronic
991511493 5:67382047-67382069 AACTAGTTCTGTAGCAAAGAAGG + Intergenic
991630742 5:68654282-68654304 AAATAGTTCTTGAAAGAAAATGG - Intergenic
992406250 5:76460421-76460443 AACTTGTTCTGTAGGAAATAGGG + Intronic
992618336 5:78567832-78567854 AACAAATTCCTGAGGAATAAGGG + Intronic
995087147 5:108125017-108125039 AACTAGTTGTTCAAGGAAAAGGG + Intronic
995122482 5:108551093-108551115 AGCTAGGTCTGGAGGAAAATTGG + Intergenic
995827927 5:116322084-116322106 CACTAGTTCCTTAGGAAATACGG + Intronic
996413261 5:123181902-123181924 AACTAATTATTGAGGAGAAGAGG - Intronic
996932724 5:128909373-128909395 AACTAGTGTTTGAGAGAAAAGGG - Intronic
997133818 5:131303411-131303433 TACTGTTTCTTGAGGAAAAGTGG + Intronic
998270171 5:140699463-140699485 AACTACCTCTTGAGGAGACAGGG - Intronic
999178681 5:149652905-149652927 AAGTAGGTCTTGTGGAAAGAGGG - Intergenic
999565360 5:152854182-152854204 ATCTAGTTCTTAGGGAAACATGG + Intergenic
1000204425 5:159045089-159045111 AAGTAGTCCTTTAAGAAAAAAGG + Intronic
1000829794 5:166088533-166088555 AACTATTTCATGAGAAGAAATGG - Intergenic
1001462328 5:171927335-171927357 AACTAGATGTAGAAGAAAAAAGG + Intronic
1002781979 6:373991-374013 AAATAGCTCTTAAGGAAATAAGG - Intergenic
1003367943 6:5494807-5494829 AACTAGCTCTAGGGGAAAAGGGG - Intronic
1004575102 6:16887411-16887433 AAATAATTCTTGACGTAAAATGG + Intergenic
1004938686 6:20533051-20533073 AACTAGATCTTGGGGGAAAAGGG + Intergenic
1005910992 6:30309390-30309412 AACCAGTTCTAGAGAAATAAAGG - Intergenic
1008279317 6:49577017-49577039 AACTAGATTTTGTGGAGAAAAGG - Intergenic
1008532367 6:52475212-52475234 CAAAAGTTCTTGAGGAAGAAAGG + Intronic
1008994794 6:57646171-57646193 AACAGGCTATTGAGGAAAAAGGG - Exonic
1009183339 6:60544968-60544990 AACAGGCTATTGAGGAAAAAGGG - Intergenic
1009515571 6:64612169-64612191 AACTATTTTCTGAGAAAAAAGGG - Intronic
1011900027 6:92282159-92282181 AATGAGTTCTTGAAGAAAAAAGG - Intergenic
1012659477 6:101869665-101869687 CACTGGCTTTTGAGGAAAAAAGG + Intronic
1012907242 6:105081918-105081940 TACTAGCTATTGAGGGAAAAGGG + Exonic
1014287841 6:119521766-119521788 AACTGTTTCTTAAGGAAAGAAGG - Intergenic
1014989560 6:128056751-128056773 AACTCTTACTTGAGTAAAAAGGG - Intronic
1015618895 6:135108499-135108521 AACAAGTTCTAGAATAAAAAAGG + Intergenic
1016110655 6:140219241-140219263 AACTAGGTATTGAGGGGAAATGG - Intergenic
1016492041 6:144616276-144616298 AAGTAGTTCTTAAGCAATAATGG - Intronic
1018533289 6:164791571-164791593 AACTAATTCATTAGTAAAAATGG + Intergenic
1019882255 7:3872508-3872530 AACTAATTCCTTGGGAAAAAAGG - Intronic
1020700752 7:11479499-11479521 CACTAATTCTTGAAGAATAATGG + Intronic
1021359649 7:19695241-19695263 ATCTACTTTTTGAGAAAAAAAGG + Intergenic
1021526432 7:21593728-21593750 TACTATTTCTTAAGGAAAAAAGG + Intronic
1021675329 7:23074861-23074883 AACTAGCTGGTGAGTAAAAAAGG + Intergenic
1022404916 7:30079867-30079889 ATTTAGTTCTTGAAGAAAACTGG - Exonic
1023003848 7:35840906-35840928 TACTAATTCTTGAGAAAAAATGG + Intronic
1024448203 7:49507311-49507333 TACTAGCTATTGAGGGAAAAGGG - Intergenic
1024846980 7:53657165-53657187 TGCCAGTGCTTGAGGAAAAATGG + Intergenic
1027864969 7:83633772-83633794 AAATAGTCATTGAGGATAAAGGG + Intronic
1028150755 7:87368494-87368516 CCCTAGGTCTTGAGGAAATAAGG + Intronic
1028689723 7:93637977-93637999 AAATAGTCCTTGTGGAAAATGGG + Intronic
1029327904 7:99825351-99825373 GACTATTTCTAGAGGAAAAGGGG + Intergenic
1030577385 7:111305893-111305915 AACTAGCTTCTGAGGAAAAGTGG + Intronic
1035533840 8:376164-376186 AACTAGTTTTTAAGGAAATATGG - Intergenic
1036041652 8:5089576-5089598 AAATAATTCATGAGTAAAAAAGG + Intergenic
1039443537 8:37612308-37612330 AAGGAGTTCTGGAAGAAAAAAGG + Intergenic
1039623709 8:39025757-39025779 AAAATGTTCTTGGGGAAAAAAGG - Intronic
1039712591 8:40071418-40071440 AACAAGTCCTGGAGGAAAACTGG - Intergenic
1041656680 8:60358817-60358839 AAATTGTTCTTCAGGGAAAATGG - Intergenic
1041658696 8:60379585-60379607 AACTAGTTCCAGGGGAAAGAAGG + Intergenic
1042782485 8:72507350-72507372 TACTAGATCTTGGGAAAAAAAGG + Intergenic
1043050121 8:75376184-75376206 GCCTTGTTTTTGAGGAAAAATGG + Intergenic
1043119675 8:76307296-76307318 AACTAGACTTTGAGGAGAAAAGG + Intergenic
1043259283 8:78177214-78177236 AACTAATTATTTAGGAAAGAGGG - Intergenic
1043355580 8:79408350-79408372 AAATAGTCGTTGAGGAAAAGAGG - Intergenic
1043649252 8:82568070-82568092 AACTATTTCTTGAATAGAAAAGG + Intergenic
1043776050 8:84270426-84270448 AAGTAATTATTCAGGAAAAAGGG + Intronic
1046806555 8:118485731-118485753 AAGTAGTGTTTGAGGATAAAAGG + Intronic
1047130214 8:122010909-122010931 AACTATTTCTTGAGGATGAGTGG + Intergenic
1047437149 8:124844162-124844184 AAATACTTGGTGAGGAAAAATGG - Intergenic
1047729885 8:127718662-127718684 TACTAAAGCTTGAGGAAAAAAGG - Intergenic
1049028710 8:140016057-140016079 TACTAATTCTTGAGGAAAGAAGG - Intronic
1050616154 9:7403750-7403772 ATCTAGTCCTTGAGTAAAGATGG - Intergenic
1052142205 9:25001156-25001178 AACCATTTCTTTAGAAAAAAAGG + Intergenic
1056061718 9:82890068-82890090 AAAAAGTTCTTGAGAAAAACAGG - Intergenic
1058583317 9:106481854-106481876 AACCAGTTCTTTGGGAAGAAAGG + Intergenic
1058640726 9:107081694-107081716 AACTAGATGTGGAGGAAAGAAGG - Intergenic
1058666496 9:107322105-107322127 AACAAGTTCTGGAGGTAAAGCGG + Exonic
1059741067 9:117150423-117150445 AAATCCTTTTTGAGGAAAAAAGG + Intronic
1059868185 9:118540734-118540756 AATTAGTTTTTGAGGAAGAAAGG - Intergenic
1186732581 X:12426119-12426141 AACTATCTCTTGAGGAAGACTGG + Intronic
1188195822 X:27231902-27231924 GACTAATGCTTGAGGAATAAAGG - Intergenic
1190634212 X:52418563-52418585 AAGTATTTATTGAGGAAAAGTGG - Intergenic
1190635694 X:52431677-52431699 AAGTATTGCTTGAGGAAAAGTGG + Intergenic
1190640161 X:52476608-52476630 AAGTATGTCTTGAGGAAAACTGG - Intergenic
1190647511 X:52536257-52536279 AAGTATGTCTTGAGGAAAACTGG + Intergenic
1190859835 X:54333875-54333897 AACTTCTTATTAAGGAAAAAGGG - Intronic
1192814243 X:74574544-74574566 AGCTAGATGTTGAGCAAAAAAGG + Intergenic
1193113341 X:77752145-77752167 AACCACTGCTTGAGGAAATAAGG - Intronic
1193536657 X:82725273-82725295 AACAATTTTTTGAGGAAAACAGG + Intergenic
1195290584 X:103429023-103429045 AACTGGTTCTTGAGGGTAGAGGG - Intergenic
1195423501 X:104701490-104701512 AAGTAGTTTATGAGGAGAAAAGG - Intronic
1195721196 X:107870870-107870892 AATTACTTATTAAGGAAAAAGGG - Intronic
1197595286 X:128456713-128456735 GTCTAGTCCTTGAGGATAAAGGG + Intergenic
1198495664 X:137190099-137190121 GTTTAGTTCTTTAGGAAAAAGGG + Intergenic
1199151110 X:144488143-144488165 AACAAGTTTTTCAGGGAAAAAGG - Intergenic
1199162365 X:144628370-144628392 AACTTGTGCTTGAGCAAAGAAGG + Intergenic
1199654864 X:149984229-149984251 AACTAGTTCATGAGGGTACAAGG + Intergenic
1201591679 Y:15622131-15622153 AACCACTGCTTGAGGAAATAAGG + Intergenic
1201793134 Y:17864327-17864349 AAGTAATTCTGGAGGTAAAATGG + Intergenic
1201808420 Y:18041659-18041681 AAGTAATTCTGGAGGTAAAATGG - Intergenic
1202339142 Y:23842296-23842318 AAGTAATTCTTGAGGCAAAATGG + Intergenic
1202354667 Y:24033571-24033593 AAGTAATTCTGGAGGTAAAATGG + Intergenic
1202516111 Y:25636541-25636563 AAGTAATTCTGGAGGTAAAATGG - Intergenic
1202531624 Y:25827776-25827798 AAGTAATTCTTGAGGCAAAATGG - Intergenic