ID: 1114538328

View in Genome Browser
Species Human (GRCh38)
Location 14:23436894-23436916
Sequence ATGCCATGCTCTTCTAGCAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114538324_1114538328 5 Left 1114538324 14:23436866-23436888 CCCAGCCTACGAGCACAGAACAC No data
Right 1114538328 14:23436894-23436916 ATGCCATGCTCTTCTAGCAACGG No data
1114538325_1114538328 4 Left 1114538325 14:23436867-23436889 CCAGCCTACGAGCACAGAACACA No data
Right 1114538328 14:23436894-23436916 ATGCCATGCTCTTCTAGCAACGG No data
1114538326_1114538328 0 Left 1114538326 14:23436871-23436893 CCTACGAGCACAGAACACAACCG No data
Right 1114538328 14:23436894-23436916 ATGCCATGCTCTTCTAGCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114538328 Original CRISPR ATGCCATGCTCTTCTAGCAA CGG Intergenic