ID: 1114539520

View in Genome Browser
Species Human (GRCh38)
Location 14:23444295-23444317
Sequence TAGGGATACTAGAGGCAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114539520_1114539525 9 Left 1114539520 14:23444295-23444317 CCCTCTTGCCTCTAGTATCCCTA No data
Right 1114539525 14:23444327-23444349 TATCATTTTGATACTTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114539520 Original CRISPR TAGGGATACTAGAGGCAAGA GGG (reversed) Intergenic
No off target data available for this crispr