ID: 1114539897

View in Genome Browser
Species Human (GRCh38)
Location 14:23447195-23447217
Sequence TCTTATCTGTAAAATGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114539894_1114539897 -6 Left 1114539894 14:23447178-23447200 CCAGCTCTAAACCTCAGTCTTAT No data
Right 1114539897 14:23447195-23447217 TCTTATCTGTAAAATGTGGATGG No data
1114539893_1114539897 -5 Left 1114539893 14:23447177-23447199 CCCAGCTCTAAACCTCAGTCTTA No data
Right 1114539897 14:23447195-23447217 TCTTATCTGTAAAATGTGGATGG No data
1114539892_1114539897 17 Left 1114539892 14:23447155-23447177 CCAAGAAGATCTTGCTCTGAATC No data
Right 1114539897 14:23447195-23447217 TCTTATCTGTAAAATGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114539897 Original CRISPR TCTTATCTGTAAAATGTGGA TGG Intergenic
No off target data available for this crispr