ID: 1114539928

View in Genome Browser
Species Human (GRCh38)
Location 14:23447511-23447533
Sequence CAGTAGGCCTGGAAGGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114539928_1114539935 19 Left 1114539928 14:23447511-23447533 CCCAGGTCCTTCCAGGCCTACTG No data
Right 1114539935 14:23447553-23447575 AACACAGCTTACCACACCCCAGG No data
1114539928_1114539933 -4 Left 1114539928 14:23447511-23447533 CCCAGGTCCTTCCAGGCCTACTG No data
Right 1114539933 14:23447530-23447552 ACTGTTCTGCTCCAGTTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114539928 Original CRISPR CAGTAGGCCTGGAAGGACCT GGG (reversed) Intergenic
No off target data available for this crispr