ID: 1114544400

View in Genome Browser
Species Human (GRCh38)
Location 14:23487752-23487774
Sequence AGGTATAAAGAGATGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 827
Summary {0: 1, 1: 0, 2: 5, 3: 77, 4: 744}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114544400 Original CRISPR AGGTATAAAGAGATGGAGAA GGG Intronic
900149722 1:1173042-1173064 AGACACACAGAGATGGAGAAAGG + Intergenic
900678863 1:3905062-3905084 AGGTAGAAAGAGAGAGAGAGAGG + Intergenic
900932855 1:5747714-5747736 AGGAAGAAGGAGATGGAGGAGGG + Intergenic
902677740 1:18020630-18020652 AGGGATAAAAAGAGGGAGAGGGG - Intergenic
902686369 1:18080229-18080251 AGGAATAAAGAGGAGGATAAGGG + Intergenic
903321188 1:22544101-22544123 AGGTATTAGGAGGTGGAGCAGGG + Intergenic
903860077 1:26359916-26359938 AGGTGAGGAGAGATGGAGAAAGG - Intergenic
904011894 1:27394614-27394636 AGGTGTAGAGAGGTGGAGAGTGG - Exonic
904286782 1:29458040-29458062 GGGTAGCAAGAGAGGGAGAATGG - Intergenic
905715185 1:40143282-40143304 AGGTAGAAATTGATGGATAAGGG - Intergenic
906015581 1:42576018-42576040 AGTTTTAAAGAGATAGACAAGGG + Intronic
906172382 1:43738102-43738124 TGGTAAAAAGAGAGAGAGAAAGG + Intronic
906294961 1:44644069-44644091 AGTTATAAAGGGATTAAGAAGGG - Intronic
906658021 1:47562787-47562809 AGGCATAAAGAGATGGATGGTGG - Intergenic
907573765 1:55507397-55507419 AGGAATGAAGAGCAGGAGAAGGG - Intergenic
907745894 1:57213175-57213197 AGGTACAAAGAAATGGGGGATGG + Intronic
908136342 1:61137326-61137348 AGGAAAAAAGAGATTCAGAAAGG + Intronic
908410907 1:63864189-63864211 AGCTATTAAGAGATGGAGGCAGG + Intronic
908470269 1:64437315-64437337 AGGTATAAAAAGAAGGTCAATGG + Intergenic
908480127 1:64531363-64531385 AGGCTTGAAGAGATTGAGAAGGG + Intronic
908503632 1:64772567-64772589 AGGTATAAAAAAATAAAGAATGG + Intronic
908528265 1:65008670-65008692 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
908697775 1:66864462-66864484 AGGTGTCAACAGATGGAGACTGG + Intronic
908819730 1:68072850-68072872 AGGAAAAAAGAAATGAAGAAAGG - Intergenic
909395532 1:75167469-75167491 AGGAAAAGAGAAATGGAGAAAGG - Intergenic
909726275 1:78839674-78839696 AGGAATAAAGAGAAAAAGAATGG - Intergenic
909891067 1:81007464-81007486 AGTTACACAGTGATGGAGAAGGG - Intergenic
910416752 1:87009234-87009256 CAGTTTAAAGGGATGGAGAAAGG - Intronic
910578518 1:88794861-88794883 AGGTATAAAGATAAGGTCAAAGG - Intronic
911151818 1:94603676-94603698 AAGGCTAAAGGGATGGAGAATGG + Intergenic
912096657 1:106152872-106152894 AGGGACAAAAAGATGGAAAATGG + Intergenic
912153409 1:106885696-106885718 AGAAAAAAAAAGATGGAGAAGGG + Intergenic
912635105 1:111284669-111284691 AGGTAAAAGGACATGGGGAAGGG - Intergenic
912730780 1:112101210-112101232 AGGAACCAAGAGATGGAAAAAGG + Intergenic
913070095 1:115290691-115290713 AGGCTTTAAGAGATAGAGAAGGG - Intronic
913092368 1:115486122-115486144 AAAAATAAAGGGATGGAGAATGG + Intergenic
913540906 1:119819996-119820018 AGGGAGAAAGAGAAGAAGAAGGG - Intergenic
913973196 1:143432365-143432387 AGGTATAAAAAGAAGTAGAGAGG - Intergenic
914067580 1:144257972-144257994 AGGTATAAAAAGAAGTAGAGAGG - Intergenic
914111573 1:144708382-144708404 AGGTATAAAAAGAAGTAGAGAGG + Intergenic
914737813 1:150435222-150435244 AGATAGAAAGAGATGGGGAATGG - Intronic
914767724 1:150654140-150654162 ATCAATAAAGAGATAGAGAAAGG + Intronic
915032764 1:152897733-152897755 CGCTATAATGAGATGAAGAAGGG + Intergenic
915732883 1:158066716-158066738 AGGCTGCAAGAGATGGAGAAAGG - Intronic
915735206 1:158080286-158080308 AGATAGAGAGAGATGAAGAAAGG + Intronic
916008429 1:160682484-160682506 AGGAAGAAAGAGAGAGAGAAGGG + Intronic
916149342 1:161771233-161771255 AAGAATAAAGAGAAGGAAAAAGG - Intronic
916297000 1:163230025-163230047 AAGTAAAAAGAGATGAAGAGAGG - Intronic
916336181 1:163673409-163673431 AGGTACAGGCAGATGGAGAAAGG - Intergenic
916721868 1:167490303-167490325 AGGAAGAAAGAGATAGAGAGGGG - Intronic
916873434 1:168941973-168941995 AGATGTAAAGAGATGGAAATAGG - Intergenic
917191110 1:172420182-172420204 AGGTAAGAAGAGTTGGGGAAAGG - Intronic
917520941 1:175748059-175748081 TGGAAAAAAGAGATGGAGAGAGG + Intergenic
917640978 1:176982915-176982937 AGGAATAGAGGGATGGAAAAGGG + Intronic
917709385 1:177669210-177669232 AGGCATGAAGAGCTGGAGAGGGG + Intergenic
918609208 1:186467132-186467154 AGAAATAAAGAGATAGAGATAGG + Intergenic
918892927 1:190299358-190299380 AGGAAAAAAGAGAAAGAGAATGG - Intronic
919006052 1:191900818-191900840 AGGGAAAGAGAGATGAAGAATGG - Intergenic
919263260 1:195226373-195226395 AGGAAGAAAGAGAGGGAGGAAGG + Intergenic
919328193 1:196135922-196135944 AGATATAAAGAGGTAAAGAATGG + Intergenic
919946397 1:202322201-202322223 AGGTCTAAAGAGTAGGGGAAAGG + Intergenic
919973061 1:202593146-202593168 AGGTAGAAAGAGATTGAGCCAGG - Exonic
920063264 1:203244057-203244079 AGGTAGAAGGAGAAGAAGAAGGG + Intronic
920274156 1:204791628-204791650 AGGTGGAAAGAGGTGGAGAGAGG + Intergenic
921219230 1:212961468-212961490 AGGGAGAAAGAGAAGCAGAAGGG - Intronic
921317307 1:213904960-213904982 AGGTAGGAAGAGAGGGAAAAAGG + Intergenic
921805407 1:219448568-219448590 AGGTGTAGACAGATGGACAATGG - Intergenic
921940135 1:220830567-220830589 AGAAATAAAGAAATAGAGAATGG - Intergenic
922302092 1:224310677-224310699 AGGGCTAAAGGGAGGGAGAAAGG - Intronic
922434290 1:225588178-225588200 AGGAAGAAAGAGAGGGAGGAGGG + Intronic
922478121 1:225920910-225920932 AGTTAAAAAGTGATGGAGACAGG - Intronic
922816656 1:228453930-228453952 AGGTATAAAGAGGGGGAGCAGGG - Intergenic
923818457 1:237406228-237406250 ACGTATAAAGAGATGGGAGAGGG - Intronic
924062068 1:240185172-240185194 AGGGAGAAAGAGAAGGGGAAAGG - Intronic
924135012 1:240956744-240956766 AGGTAAAAAGAGATGGTAAAAGG + Intronic
1063157921 10:3397123-3397145 AGGGAGAAAGAGAGGGAGAGAGG - Intergenic
1063220930 10:3967118-3967140 AGATGTAATGACATGGAGAATGG - Intergenic
1063806483 10:9649264-9649286 GGGTAGAAAGTCATGGAGAAAGG - Intergenic
1063870473 10:10411427-10411449 AGGTAAAAAGAGATGGCAACTGG - Intergenic
1064274968 10:13897449-13897471 AGGTAGGAAGGGATGGAGAAGGG + Intronic
1065147687 10:22787754-22787776 ATATAAAAAGAGATTGAGAATGG - Intergenic
1065765624 10:29026893-29026915 AGGTAGAAAGGGAGGGAGGAAGG + Intergenic
1065804228 10:29380241-29380263 AGGTAGAGAGAGATTGAGAGAGG - Intergenic
1065944956 10:30597779-30597801 AGGTAGACAGAGATTGAGAGAGG + Intergenic
1066022175 10:31314764-31314786 AGGTCTGAAGAGAATGAGAAGGG + Intergenic
1066984542 10:42453754-42453776 AGGTATAAAGAGAATGAGATGGG + Intergenic
1067245066 10:44533901-44533923 AGATAAAAAGAGATAAAGAAGGG - Intergenic
1067853466 10:49769838-49769860 AGGGAGAAAGAAAGGGAGAAGGG + Intergenic
1067899381 10:50222791-50222813 ATTTATAAAGATATGCAGAAAGG + Intronic
1068033578 10:51732502-51732524 AGGTATACAGAGAGCAAGAACGG + Intronic
1068104999 10:52603700-52603722 ATGTGTAAATAGATGGGGAATGG + Intergenic
1069014647 10:63415308-63415330 AGGTTTTATTAGATGGAGAAGGG - Intronic
1069047738 10:63761065-63761087 AGCTAGAAGGTGATGGAGAAAGG + Intergenic
1070575031 10:77671159-77671181 AGGTAGAGAGAGATGGACAGAGG + Intergenic
1070703861 10:78623013-78623035 AGGAAGGAAGGGATGGAGAAAGG + Intergenic
1070738191 10:78879683-78879705 AAGTAAAAAGATATGGAGACTGG + Intergenic
1071192660 10:83120435-83120457 AGGAAGAAAGAGAAGGGGAAAGG - Intergenic
1071707177 10:88011846-88011868 AGCTATTAAGAGAAGGGGAAAGG + Intergenic
1071751538 10:88482969-88482991 AGGAAGAAAGGGATGGAGGAAGG - Intronic
1071803649 10:89092893-89092915 AGGGATAGAGACAGGGAGAAAGG - Intergenic
1072123588 10:92425961-92425983 ATATATAAATAAATGGAGAATGG - Intergenic
1073686037 10:105754896-105754918 AGGAAGAAAGAGATAGAAAAAGG - Intergenic
1073778880 10:106815297-106815319 AGGAATAAAGGGAGGGAGAGAGG + Intronic
1073917389 10:108421656-108421678 AGGTAACAAGAAATGTAGAAAGG - Intergenic
1074607287 10:114985844-114985866 AGGTCTGAAGAGAGGGAGAGAGG + Intergenic
1074704308 10:116117708-116117730 AGGTATGAATAGATGGATGATGG + Intronic
1074917868 10:117975023-117975045 AAGTAAAAATAGAAGGAGAAGGG + Intergenic
1075392250 10:122100756-122100778 TGGTATAAAAATGTGGAGAAAGG + Intronic
1075509562 10:123060086-123060108 TGAAATAAAGAGATGGAAAAAGG + Intergenic
1077345038 11:2043651-2043673 AGAGAGAAAGAAATGGAGAAAGG - Intergenic
1077346903 11:2064164-2064186 TGGAGTATAGAGATGGAGAATGG - Intergenic
1077373988 11:2196986-2197008 AGAGACAGAGAGATGGAGAAGGG - Intergenic
1077388517 11:2287629-2287651 AGGGAGGAAGAGATGAAGAAAGG + Intergenic
1077490627 11:2859340-2859362 AGGTGTAAAGAGAGGGACAGAGG + Intergenic
1077768390 11:5187403-5187425 ATAGAAAAAGAGATGGAGAAAGG + Intergenic
1077820629 11:5736401-5736423 ATTTCTAAAGAGATGAAGAAAGG + Intronic
1077880873 11:6348924-6348946 AGGGATTAAGAGTTGGAGATGGG - Intergenic
1077931849 11:6741056-6741078 AAGGATAAAGAAATGGAAAAAGG + Intergenic
1078038027 11:7828319-7828341 AGTTAAAAAGAGATGGATATGGG + Intergenic
1078670494 11:13360601-13360623 AGGTTAAAAGAGGAGGAGAATGG - Intronic
1078886632 11:15506873-15506895 AGGAATGAAGATATGGAGGAGGG + Intergenic
1079128766 11:17735692-17735714 AGGGAGAAAGGGAGGGAGAAAGG - Exonic
1079307032 11:19332463-19332485 GGGTATGAAGACATGGAGAATGG + Intergenic
1079957196 11:26880187-26880209 AGGGAGTAAGAGAGGGAGAAGGG + Intergenic
1080514229 11:33005222-33005244 AGGAATAATGAGAGGCAGAAAGG + Intergenic
1080914921 11:36647629-36647651 AGGGATAAAGAGAAAGAAAATGG - Intronic
1081272932 11:41109125-41109147 AGGGATAAAGGGATGAAGATAGG - Intronic
1081546357 11:44074723-44074745 AGAAAGAAAGAGATGGAGAGGGG - Intronic
1081557199 11:44175786-44175808 AGGGATGGAGAGAGGGAGAAAGG + Intronic
1081722877 11:45302958-45302980 AGGAAGAAACAGATGGAGAAAGG + Intergenic
1081924784 11:46816291-46816313 ATGTACATAGAGATTGAGAAAGG - Exonic
1082890078 11:58129774-58129796 TGTTATAAAGAAATAGAGAAGGG - Intronic
1083091799 11:60207565-60207587 AGGCACAAAATGATGGAGAAGGG + Intronic
1083101131 11:60307209-60307231 AGGTGCAAAATGATGGAGAAGGG - Intronic
1083418869 11:62542542-62542564 GGGTAGAGAGAGATGGAGAAAGG - Intronic
1083819590 11:65160660-65160682 AGGTATGAAGAGAGAGAGGAAGG + Intergenic
1084608519 11:70186393-70186415 AGGAAGAAAGACATGGAGAAAGG + Intronic
1084615516 11:70233188-70233210 AGGAATAAAGGGATGCTGAAGGG - Intergenic
1084869315 11:72086073-72086095 AGGCAAAAAGAGATGGATACAGG + Intronic
1084993456 11:72951785-72951807 ATTTATAAAGAGATTGTGAAAGG - Intronic
1085606888 11:77908890-77908912 AGTAATAAAGAAGTGGAGAATGG - Intronic
1085856765 11:80183972-80183994 TGGCATAGAGAGAGGGAGAAAGG - Intergenic
1086351543 11:85946892-85946914 AGGTGTAAAGAGACAGAGTATGG + Intergenic
1086478707 11:87209335-87209357 CAAAATAAAGAGATGGAGAAAGG + Intronic
1086658923 11:89390998-89391020 TGCTATAAAGAGATGGGGGAAGG + Intronic
1086831033 11:91563783-91563805 AGCTATAAATAGAAGTAGAAAGG - Intergenic
1087450258 11:98311745-98311767 AGATTTAAAGAGATTGAGAAGGG - Intergenic
1087659219 11:100966344-100966366 ATATATAAAGAGATAGAGATTGG + Intronic
1088164104 11:106911058-106911080 AGGAAGAAAGAGAGGGAGGAAGG + Intronic
1088709536 11:112495548-112495570 TGGTATAAATAAATGAAGAAGGG + Intergenic
1089001584 11:115056365-115056387 AAGTATAAAGAGGTGGAGTTTGG + Intergenic
1089182108 11:116590276-116590298 AGGCAGAAAGAGGTGGTGAAAGG - Intergenic
1090259601 11:125309209-125309231 AGGAAGAAAGAGAGAGAGAAAGG - Intronic
1091180195 11:133597174-133597196 AGGAATACAGATTTGGAGAAAGG + Intergenic
1091190674 11:133693132-133693154 AGGAATAAACAGCTGGAAAATGG - Intergenic
1202827955 11_KI270721v1_random:98402-98424 AGAGATAAAAACATGGAGAATGG - Intergenic
1202827967 11_KI270721v1_random:98523-98545 AGAGAGAAAGATATGGAGAAAGG - Intergenic
1091427095 12:400578-400600 AGGCAAGAAGAGAGGGAGAAAGG + Intronic
1091894939 12:4094312-4094334 AGGGAGAAAGGGAGGGAGAAAGG + Intergenic
1092011429 12:5116085-5116107 AGGTAGTATGAGATGTAGAAAGG - Intergenic
1092514197 12:9191318-9191340 AGGTAGTTAGATATGGAGAATGG - Intronic
1092515625 12:9208642-9208664 ATTTTGAAAGAGATGGAGAAAGG - Intergenic
1092663155 12:10761920-10761942 AGACATCAAGAGATGAAGAATGG - Intergenic
1092710487 12:11331651-11331673 AGGGATAAAGAGGTAGAGCAAGG - Intergenic
1092937865 12:13380515-13380537 AAGTAAGAAGAAATGGAGAAAGG - Intronic
1093055863 12:14555047-14555069 AGGGATAAAGAGGTAGAGATTGG - Intronic
1093055978 12:14556028-14556050 AGGAAATAAGACATGGAGAAAGG + Intronic
1093201860 12:16197416-16197438 GGGTATAAAAAGATATAGAAAGG + Intronic
1093795072 12:23301495-23301517 AGGTATCAAGAGAAAGAGTAAGG + Intergenic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094316588 12:29142730-29142752 AGGTTTAAACAAGTGGAGAAAGG - Intergenic
1094635548 12:32223865-32223887 AAGGAGAAAGAGATGGGGAATGG + Intronic
1095442822 12:42254979-42255001 AGGAATCAAGAGATGGAAATGGG - Intronic
1096842834 12:54389969-54389991 AGAGAAAAAGAGATGGAGGAAGG + Intronic
1096933234 12:55239357-55239379 AGGGGAAAAGAGATGGAGAATGG + Intergenic
1096964104 12:55611373-55611395 AGGAATAAAGGGAGGGAGACAGG + Intergenic
1097448251 12:59703077-59703099 AGGTATACAAAAATGGATAAGGG - Intronic
1097521833 12:60679923-60679945 AGCTATAAAGACATTGAGACTGG + Intergenic
1098010074 12:66041429-66041451 CCCTATAAAGAGCTGGAGAATGG + Intergenic
1098779852 12:74672953-74672975 AGATAGACAGAGATAGAGAAGGG - Intergenic
1098983916 12:76989451-76989473 AGGAATAAAGTGATTTAGAATGG - Intergenic
1099840947 12:87966365-87966387 AGGTAAAGAGAGATGGAGAATGG - Intergenic
1100036976 12:90263723-90263745 AGATATGAAAAGATGTAGAAGGG + Intergenic
1100274046 12:93055223-93055245 AGGGAGAAAGAGATAGAGAGAGG + Intergenic
1100643717 12:96507364-96507386 AAGTAAATATAGATGGAGAAGGG + Intronic
1100875227 12:98954935-98954957 AGGAATAAAGAAATGGAGGGTGG - Intronic
1101456250 12:104834431-104834453 AAGTATAAAGAGAATGATAAAGG - Intronic
1101483166 12:105122853-105122875 AGGCTTGAAGAGAGGGAGAAAGG - Intronic
1101527783 12:105547498-105547520 AGGGATAAAGTGATGGACCATGG + Intergenic
1102490449 12:113287121-113287143 AGGGAGAAAGAGAGGGAGGACGG + Intronic
1102682241 12:114698670-114698692 AGATAGAAAGGGAGGGAGAAGGG - Intergenic
1102717409 12:114986294-114986316 AGGGAGAGAGAGAGGGAGAAAGG - Intergenic
1102982191 12:117250703-117250725 AGGTAGACAGAGATGGTGACTGG + Intronic
1103111594 12:118284630-118284652 AAATAGAAAGAGATGGAGATTGG + Intronic
1104255813 12:127137019-127137041 AAAAGTAAAGAGATGGAGAAAGG - Intergenic
1105715661 13:23061427-23061449 AGGAAGAAAGAGATGGAGGGGGG + Intergenic
1105841454 13:24257175-24257197 ACGTAGAAAGAGAAGGGGAATGG - Intronic
1106588786 13:31080269-31080291 AGGTGTAAAGAGAGGTGGAAAGG - Intergenic
1107146673 13:37067783-37067805 AGGTTTTAAGAGCTGGAGTAGGG - Intergenic
1107749409 13:43548441-43548463 CAGAATTAAGAGATGGAGAAAGG - Intronic
1108106238 13:47013771-47013793 AAGAAGGAAGAGATGGAGAAAGG + Intergenic
1108183593 13:47866331-47866353 AGGTAAATAAAGAGGGAGAAAGG - Intergenic
1108588313 13:51890400-51890422 AGGAAGCAAGAGAGGGAGAAAGG - Intergenic
1108978852 13:56484070-56484092 ATGTATAAAGAATTGGAGAGAGG - Intergenic
1109642856 13:65213074-65213096 AGATAAAAAGAGAAGGAGAAAGG + Intergenic
1109866951 13:68276967-68276989 AGAAATAAAGACAGGGAGAAAGG - Intergenic
1109971418 13:69775238-69775260 ACATCTAAAGAGATGGAGCAAGG + Intronic
1109971432 13:69775563-69775585 TGGAGTAAAGATATGGAGAAGGG + Intronic
1110046287 13:70836260-70836282 AAGAAAAAAGAGATGGAGAGAGG - Intergenic
1110398877 13:75066285-75066307 AGGCATAAAGAGATGGAGGATGG + Intergenic
1110506960 13:76298227-76298249 AGGGAGAAAGAAATGCAGAAAGG + Intergenic
1110531158 13:76600598-76600620 AGCTATGAAGAGGTGGAGAGAGG - Intergenic
1110540384 13:76700898-76700920 AGATATAAAGAGAGAGGGAAGGG + Intergenic
1110935372 13:81281063-81281085 AGGGATAAAAAGTTGGAGTAAGG + Intergenic
1111453977 13:88455167-88455189 AGGTAGAAAGTGATTGAAAAAGG + Intergenic
1111515669 13:89327667-89327689 GGGTATAAAGAGATAGATATAGG - Intergenic
1111613870 13:90640072-90640094 AAGGAGAAAGAGATGAAGAAAGG - Intergenic
1111759485 13:92443640-92443662 AGGTATAATGAGAGTGACAAAGG + Intronic
1111832438 13:93346168-93346190 AGTTTTAAAGAGAAGGTGAAGGG + Intronic
1113053851 13:106245763-106245785 AGATATATAGATATGGAGACAGG + Intergenic
1113254338 13:108490755-108490777 CGCTACAAGGAGATGGAGAAAGG + Intergenic
1113315063 13:109170553-109170575 AGGAAGAAAGAGATGGAGAAAGG + Intronic
1113584303 13:111452943-111452965 AGGTTTAAAAGGATGGAGAATGG - Intergenic
1113585121 13:111459637-111459659 AGGGAGAAAGAGAAAGAGAAGGG + Intergenic
1114040780 14:18676620-18676642 AGCTAGAGAGAGATGGAGATTGG + Intergenic
1114045818 14:18875124-18875146 AGCTAGAGAGAGATGGAGATTGG + Intergenic
1114118396 14:19644346-19644368 AGCTAGAGAGAGATGGAGACTGG - Intergenic
1114242889 14:20885241-20885263 AGATTCAAAGAGATGGAGTAAGG + Intergenic
1114249819 14:20949179-20949201 AGATTCAAAGAGATGGAGTAAGG + Intergenic
1114500095 14:23162154-23162176 AGGTATAAGGAAAGGGAGAGAGG + Intronic
1114544400 14:23487752-23487774 AGGTATAAAGAGATGGAGAAGGG + Intronic
1115331477 14:32202706-32202728 AGGTCTAAGATGATGGAGAATGG + Intergenic
1115396309 14:32912553-32912575 GTGAATAAAGAGAAGGAGAAGGG + Intergenic
1115438497 14:33404486-33404508 AGATCTAAAGAGAAGGAAAAAGG - Intronic
1115752669 14:36506989-36507011 TGGAATAAAGAAATGGAAAATGG + Intronic
1116083052 14:40200847-40200869 ATGTATAAAGAGGGAGAGAAAGG + Intergenic
1116171576 14:41408928-41408950 AAATATATAGAGATGTAGAAAGG + Intergenic
1116442755 14:44972720-44972742 AAAAGTAAAGAGATGGAGAAAGG - Intronic
1116686909 14:48051579-48051601 AGGGATAAAGAGGTGGAACATGG + Intergenic
1117251137 14:53939852-53939874 AGATTTTAAGAGATAGAGAAAGG - Intergenic
1117751999 14:58933886-58933908 AGTTAAAAAGAGAGGAAGAAAGG - Intergenic
1117841595 14:59866397-59866419 AGTAAAAAAGAGATGGAGAGAGG + Intronic
1118336946 14:64861562-64861584 AGGTAGCTAGGGATGGAGAAAGG - Intronic
1118737976 14:68716009-68716031 AGGCATAAAGGAAGGGAGAAGGG - Intronic
1118983099 14:70731886-70731908 AGGGAGAAAGAGATGGTGACAGG + Intronic
1118998778 14:70862077-70862099 AGAGAGAAAGAGAGGGAGAAAGG + Intergenic
1119074459 14:71621806-71621828 AGGAGGAAAGACATGGAGAAAGG - Intronic
1119343061 14:73897222-73897244 AGGGTTAAAGAGATGGGGAGTGG + Intronic
1120021766 14:79539030-79539052 AGCTATAAAGTGATCGAGACAGG + Intronic
1120814604 14:88842050-88842072 AGGCAGAAGGAGAGGGAGAAAGG + Intronic
1120873756 14:89360413-89360435 AGGTAAAAAGAGAGGGAGGAAGG + Intronic
1121556659 14:94843183-94843205 AGGAATAAAGAGATGGCATAGGG + Intergenic
1122131351 14:99605783-99605805 AGGTACAAAGATAAGGGGAAGGG + Intergenic
1124160324 15:27262415-27262437 AGGGAAGTAGAGATGGAGAAAGG - Intronic
1124661305 15:31553000-31553022 AGCTATAAGGAGAAGGGGAATGG + Intronic
1125056747 15:35368219-35368241 AGTTAAAAAGAGAAGAAGAAAGG + Intronic
1125087872 15:35752330-35752352 AGGGAGAAGGAGAGGGAGAAAGG - Intergenic
1125271233 15:37940773-37940795 AGGCATACAGGGAGGGAGAAAGG + Intronic
1125820131 15:42622704-42622726 AGGTATTAAGAGATGACAAATGG + Intronic
1125890078 15:43259073-43259095 AGGTAGAAAGAGAGGGAAGATGG + Intronic
1126118637 15:45231519-45231541 AAGTAGAAAGAGATGAAGGAAGG + Intergenic
1126453898 15:48840642-48840664 AGTAATAAAGAGATGGAGTGGGG - Intronic
1126508631 15:49439297-49439319 AGGGAGAAAGAGAGAGAGAAAGG + Intronic
1126860428 15:52877579-52877601 AGAAATAGAGAGATGGAGGAAGG - Intergenic
1127477901 15:59351944-59351966 AGGAAGAAAGAGATCCAGAATGG - Intronic
1127688697 15:61373553-61373575 AGGTTTAAAGATATGCAGAAAGG + Intergenic
1127966258 15:63924923-63924945 AGGTCTAAAAAGAGTGAGAACGG - Intronic
1128793465 15:70449347-70449369 ATGTATAGAGGGATGGAGAGAGG + Intergenic
1128793472 15:70449375-70449397 ATGTATAGAGGGATGGAGAGAGG + Intergenic
1129127703 15:73458700-73458722 GGGGATAAAGAAATGGACAAAGG + Intronic
1129952639 15:79605653-79605675 AGATACAAAGAGACTGAGAATGG + Intergenic
1130082824 15:80749457-80749479 AGGTATGAAGAAAGAGAGAAAGG - Intronic
1130640573 15:85670227-85670249 AGTGATAAAGAGAGGGAGAGAGG - Intronic
1130840034 15:87689959-87689981 ATGAATATAGAGCTGGAGAATGG - Intergenic
1130866264 15:87935692-87935714 TGATTTAAAGAGATGGAGAGAGG - Intronic
1130888162 15:88111020-88111042 AGGGGTAAAGAGATGGGGACTGG + Intronic
1131666971 15:94581084-94581106 AGGGAAAAAGAGATGGAGACAGG + Intergenic
1131793352 15:95988445-95988467 AGGAAGGAAGAGAGGGAGAAAGG + Intergenic
1132320604 15:100922059-100922081 AGGTATAAATAGTTGGCAAAAGG + Intronic
1133088805 16:3387357-3387379 AGATATAAACAGATAGAGATGGG - Intronic
1133368325 16:5228622-5228644 AGGGAAAAAGGGATGGAGAAAGG + Intergenic
1133698284 16:8285873-8285895 AGGTAAAAAGAGAGGGAGGATGG - Intergenic
1134691795 16:16195682-16195704 AGGAAGAAAGAGAGGGAGAGAGG - Intronic
1134809584 16:17155924-17155946 AGAAAGAAATAGATGGAGAATGG - Intronic
1135160883 16:20095196-20095218 AGGTAGTAAGAGATGGAGCCAGG - Intergenic
1135206295 16:20487145-20487167 AGGGAGAAAGAGAGGGAGAAAGG + Exonic
1135212624 16:20536768-20536790 AGGGAGAAAGAGAGGGAGAAAGG - Exonic
1135392167 16:22103003-22103025 AGGTATAAGGAGATTGTGAAAGG - Intronic
1135482817 16:22836521-22836543 AGGTATAAATTAATGGAGACAGG - Intronic
1135510349 16:23077575-23077597 AGGTAGGGAGAGATGGAGGAGGG - Intronic
1135654943 16:24239844-24239866 AGTTAGTAAGACATGGAGAATGG - Intergenic
1135786158 16:25351098-25351120 AGGTAATAGGATATGGAGAAAGG - Intergenic
1135795975 16:25442876-25442898 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1135842379 16:25888353-25888375 AGAGATAAAGAGAGGGAGAAAGG - Intronic
1136694674 16:32066939-32066961 AAGTCTACAGAGATGGAAAATGG - Intergenic
1136795176 16:33010201-33010223 AAGTCTACAGAGATGGAAAATGG - Intergenic
1136874740 16:33844181-33844203 AAGTCTACAGAGATGGAAAATGG + Intergenic
1137661925 16:50214754-50214776 TGGTACAGAGAGATGGAAAAGGG + Intronic
1137682535 16:50362773-50362795 AGGTCTGAGGAGAGGGAGAAAGG + Intronic
1137744652 16:50811959-50811981 AGAGAGAAAGAGAGGGAGAAGGG - Intergenic
1138182661 16:54952756-54952778 AAGAAGATAGAGATGGAGAAAGG - Intergenic
1138691561 16:58773566-58773588 AAATATAAAGAGATAGATAATGG - Intergenic
1138705691 16:58912808-58912830 AGGCATAAAGAGATAGCTAAAGG + Intergenic
1138913905 16:61439401-61439423 ATGTAAAAAGAGATGGAGGATGG + Intergenic
1138984696 16:62314260-62314282 AGGTTTACAGAGATGGAGCCAGG + Intergenic
1139273290 16:65703596-65703618 AGGTATGAAGAGAGAGAAAAAGG + Intergenic
1140028162 16:71311009-71311031 AGGTTTAAAGAGATGGAGGAAGG + Intergenic
1140117384 16:72054550-72054572 AGGAATTACGAAATGGAGAAGGG + Intronic
1140118467 16:72063153-72063175 AGGAATTACGAAATGGAGAAGGG + Intronic
1140140033 16:72246842-72246864 AGGAAGAAAGAGAGGGAGAGAGG + Intergenic
1140145172 16:72300067-72300089 AGGTAGAAAGAGAAGGGGGATGG - Intergenic
1140335853 16:74104438-74104460 AGGTAAAATGGTATGGAGAAAGG + Intergenic
1140490742 16:75333796-75333818 AAGTAAAAAAAGATGAAGAAAGG + Intronic
1140713223 16:77697321-77697343 AGGCACAGAGAGATGGAGAAAGG + Intergenic
1141092827 16:81141842-81141864 AGGTTCAAAGAGACGGAGTAAGG + Intergenic
1141406642 16:83800186-83800208 AGCTATGAAGATTTGGAGAAAGG + Intronic
1141856413 16:86684232-86684254 AGACAAAAAGAGATAGAGAAAGG - Intergenic
1203097431 16_KI270728v1_random:1271861-1271883 AAGTCTACAGAGATGGAAAATGG - Intergenic
1142578408 17:924900-924922 AGGTACACAGAGCTGGAGACAGG + Intronic
1142832879 17:2562352-2562374 AGGAAGAAAGAGAAAGAGAAAGG + Intergenic
1143121938 17:4613567-4613589 AGGTAAAAAGAAAAGGAGGAAGG - Intergenic
1143584802 17:7845725-7845747 AGGGATACAGAGATGGAAAGAGG - Intronic
1143965805 17:10755864-10755886 AGGGAGAAAGAGAGGGAGAAAGG - Intergenic
1144450252 17:15371194-15371216 AGGTGAAAAGAGATGGGTAAAGG - Intergenic
1145279795 17:21458635-21458657 AGGTACAAAGAACTGGGGAAAGG + Intergenic
1145398088 17:22511844-22511866 AGGTACAAAGAACTGGAGAGAGG - Intergenic
1145931423 17:28688572-28688594 GGGTATAAAGAGATAAGGAAGGG + Intronic
1146831930 17:36076882-36076904 AGTTAAAAAGAGAAGGAGAGAGG + Intergenic
1147045904 17:37751933-37751955 AGGGAGAGAGAGAGGGAGAAAGG + Intergenic
1148022956 17:44565756-44565778 AGGAAGAAAGGGAGGGAGAAAGG - Intergenic
1148160418 17:45446825-45446847 AGGTATAAAGTGGTGGAGGCAGG - Intronic
1148808551 17:50276520-50276542 AGGTATAAAGATAAAGATAACGG + Intronic
1148822090 17:50365672-50365694 AGGATTAAAGGGATGGAGAAAGG + Intergenic
1150208034 17:63423902-63423924 AGGGGTATAGAGATGGAGAGAGG - Exonic
1150391706 17:64793704-64793726 AGGTATAAAGTGGTGGAGGCAGG - Intergenic
1150464380 17:65379611-65379633 AGGGACAAAGAAATGGAGGAAGG + Intergenic
1152006590 17:77686008-77686030 AGGAATAGAGAGATGGAGAGTGG - Intergenic
1153112641 18:1610531-1610553 AGGTATAGAGAGAGCGAGATTGG + Intergenic
1153113365 18:1621579-1621601 AGGTCTACAGGGAGGGAGAAGGG + Intergenic
1153448706 18:5201610-5201632 AGGTAAAAATAGATAGAGAGAGG + Intergenic
1154121879 18:11658752-11658774 AGGGAAGGAGAGATGGAGAAGGG - Intergenic
1155813770 18:30276298-30276320 AGGGAGAAAGAGAGGGAGGAAGG + Intergenic
1156202904 18:34854670-34854692 AGGGACTAAGGGATGGAGAAGGG - Intronic
1156373221 18:36489849-36489871 AGAAAGAAAGAGAGGGAGAAGGG + Intronic
1156381660 18:36567288-36567310 AGGGAGGAAGAGATGGAGGAAGG + Intronic
1156597638 18:38565843-38565865 AGGGAGAAAGAGAGGGAGAGAGG - Intergenic
1156711430 18:39951203-39951225 AGATATAAAAAGCTGTAGAAAGG + Intergenic
1156837075 18:41567264-41567286 AGGCCTGAAGAGATGGAGGAAGG + Intergenic
1156914018 18:42444212-42444234 TGGTACATAGATATGGAGAAAGG + Intergenic
1157024603 18:43828146-43828168 AGGGATGAAGAGATGGAGCACGG - Intergenic
1157048346 18:44130282-44130304 AGGTTTAATGAGAGGGAGAATGG - Intergenic
1157051875 18:44175709-44175731 AGGTAGAAAATGATGGAGAGTGG + Intergenic
1157277869 18:46324707-46324729 AATGATAAAGAGGTGGAGAAAGG + Intergenic
1157475262 18:48019996-48020018 AAGTGTAGAGAGTTGGAGAAGGG + Intergenic
1158269235 18:55695030-55695052 AGAGAGAAAGAGAGGGAGAAAGG + Intergenic
1158332328 18:56376258-56376280 AGGAAAAAGGAGAGGGAGAAAGG + Intergenic
1158461096 18:57646273-57646295 AGGGAAGAAGTGATGGAGAAAGG - Intergenic
1158468721 18:57714556-57714578 AGGGAGAGAGAGAAGGAGAAAGG + Intronic
1158796106 18:60848445-60848467 TGGTAAAAAGTGATGTAGAATGG + Intergenic
1159010536 18:63055255-63055277 AGGGAGAAAGAGAGAGAGAAGGG - Intergenic
1159424891 18:68272364-68272386 AGGTATAAATTGATAGAGAATGG - Intergenic
1159528543 18:69626400-69626422 ATGAATAAAGAAATGAAGAAAGG - Intronic
1159732884 18:72053895-72053917 AGTAAAAAAGAGATGGGGAATGG - Intergenic
1160502568 18:79409552-79409574 AGGGATAAAGAGATGGATTATGG - Intronic
1160758990 19:773103-773125 CGGGATAGAGGGATGGAGAAGGG + Intergenic
1161204083 19:3031476-3031498 AAACATAAAGAGATGGTGAAGGG - Intronic
1161256140 19:3310827-3310849 AGGGAGAGAGAGATGGAGAGAGG - Intergenic
1161816537 19:6502702-6502724 AGGTCTAAATAGAATGAGAAGGG - Intronic
1163161800 19:15469363-15469385 AGGTATTAGGAGCTGGGGAAAGG + Intronic
1163484991 19:17580265-17580287 GGGAAAAAAGAGATGGAGGAAGG - Intronic
1164566879 19:29332162-29332184 AGGTATAAAGCAATAGGGAAGGG + Intergenic
1164677408 19:30110953-30110975 AGATATAAAAAGCTGGAGAAAGG + Intergenic
1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG + Intergenic
1164802688 19:31090733-31090755 AGGAAGAAAGGGAGGGAGAAAGG + Intergenic
1165362811 19:35347069-35347091 AGGGCCAGAGAGATGGAGAAGGG - Exonic
1165680782 19:37773030-37773052 AAGTATTAAGTGATGGAAAATGG - Intronic
1165821697 19:38680768-38680790 AGGAATAAAGAGAAGGAGGAAGG - Intronic
1165917423 19:39269293-39269315 AGGGAGAAAGAGACGGTGAAGGG - Intronic
1166146309 19:40838741-40838763 AAGGAGGAAGAGATGGAGAAAGG - Intronic
1166546750 19:43638884-43638906 AGGGATAGAGAGAGGGAGGAAGG + Intronic
1166579633 19:43883295-43883317 ATCTATAAAGAGTTGTAGAAAGG - Intronic
1167633052 19:50637757-50637779 AAGGAGGAAGAGATGGAGAAGGG + Exonic
1167960620 19:53102205-53102227 AGGCAGAAATAGATGGAGATTGG - Intronic
1167971729 19:53192179-53192201 AGGCAGAAATAGATGGAGATTGG - Intronic
1202682387 1_KI270712v1_random:18893-18915 AGGAAGAAAGTGAGGGAGAAAGG + Intergenic
925719494 2:6813574-6813596 AGGAAAAGAGAGAAGGAGAAAGG + Intergenic
925792197 2:7501839-7501861 AGGAAGGAAGAGATGGAGACAGG + Intergenic
926266499 2:11327207-11327229 AAGTTTAAAGTGATGGAAAATGG + Intronic
926269446 2:11354281-11354303 AGGCAGAAAGGGATGGAGGAAGG + Intergenic
926394842 2:12430376-12430398 AGGAAGAAAGAGAAGAAGAAAGG + Intergenic
927784200 2:25961237-25961259 GGGAGTGAAGAGATGGAGAAAGG + Intronic
927866180 2:26589159-26589181 AGGAAGAAGGAGAAGGAGAAGGG - Intronic
927996783 2:27492564-27492586 GGGCAGAAAAAGATGGAGAATGG - Intronic
928077236 2:28276181-28276203 AAGAATAAAGAGATGGTAAAAGG + Intronic
928130462 2:28645344-28645366 AGCTCTGAAAAGATGGAGAATGG + Intergenic
929230885 2:39558667-39558689 AGGAATAAAGGGAGGAAGAATGG + Intergenic
929349961 2:40938675-40938697 AGGAAGAAAGGAATGGAGAAAGG + Intergenic
929484114 2:42339572-42339594 AGGGATAAAGGGAGGGAGGAAGG - Intronic
930423618 2:51184995-51185017 AGAGATGAAGAGAAGGAGAAGGG + Intergenic
930562828 2:52982279-52982301 AGGAAGAAAGAGAGAGAGAAGGG + Intergenic
930571721 2:53094516-53094538 AGGAGAAAAGAGATGGAGAAGGG + Intergenic
931121617 2:59226367-59226389 AGGAAGAAAGAGAGGGAGGAAGG + Intergenic
931942960 2:67273259-67273281 AGGTAGATAGAGGTGGGGAATGG - Intergenic
933053978 2:77638294-77638316 AGGAAGAAAGAGAGGGAGGAGGG - Intergenic
933097151 2:78199843-78199865 AGGCATAAAGAGGCTGAGAAAGG + Intergenic
933392182 2:81685208-81685230 AGGAATAAAGAGATGGAAAGGGG + Intergenic
933929947 2:87139913-87139935 AAAAAAAAAGAGATGGAGAAAGG - Intergenic
933994457 2:87657647-87657669 AGGAATGAAGAGTGGGAGAAAGG + Intergenic
934001280 2:87715698-87715720 AAAAAAAAAGAGATGGAGAAAGG - Intergenic
934053743 2:88233750-88233772 AGCTATATAGAGTAGGAGAAAGG + Intergenic
934177892 2:89593322-89593344 AGGTATAAAAAGAAGTAGAGAGG - Intergenic
934288191 2:91667623-91667645 AGGTATAAAAAGAAGTAGAGAGG - Intergenic
934776287 2:96939678-96939700 AGGTAAAATGAGCTGGACAAGGG + Intronic
934779086 2:96957732-96957754 AAGAAGAAAGAGCTGGAGAAAGG - Intronic
934987928 2:98900700-98900722 TGGTCCCAAGAGATGGAGAAAGG + Intronic
935081764 2:99804891-99804913 AGGTATACAGAGTGGGAAAATGG + Intronic
936144049 2:109967358-109967380 AGATAGGAAGAGATGGAGAAAGG - Intergenic
936158850 2:110069167-110069189 AGGTAAGGAGTGATGGAGAAAGG - Intergenic
936180731 2:110265319-110265341 AGATAGGAAGAGATGGAGAAAGG - Intergenic
936185810 2:110302165-110302187 AGGTAAGGAGTGATGGAGAAAGG + Intergenic
936200638 2:110404111-110404133 AGATAGGAAGAGATGGAGAAAGG + Intronic
936299399 2:111293266-111293288 AGGAATGAAGAGTGGGAGAAAGG - Intergenic
936362992 2:111823502-111823524 AAAAAAAAAGAGATGGAGAAAGG + Intronic
936679770 2:114757053-114757075 AGGGAGAAAGAAATGAAGAAAGG + Intronic
936768091 2:115877985-115878007 AGGGAGAAGGAGAAGGAGAAAGG - Intergenic
936817437 2:116476152-116476174 AGGAAGAAAGAAAGGGAGAAAGG + Intergenic
937837568 2:126487875-126487897 AAAGAGAAAGAGATGGAGAAAGG - Intergenic
938052992 2:128192052-128192074 TGGTAGAAAGACATGGGGAAAGG - Exonic
939242954 2:139585579-139585601 AGGAAGAAAGAGAAAGAGAAAGG - Intergenic
939402265 2:141709723-141709745 AGGGAAAAAGAGATGGCTAAGGG + Intronic
939433040 2:142135229-142135251 AGGTAGAGAGAGAGAGAGAAAGG + Intergenic
940256057 2:151730441-151730463 AGCAATAAATAGATGCAGAAAGG + Intronic
940391658 2:153139576-153139598 AGATATGAACAGATGGAGATGGG + Intergenic
940628441 2:156206968-156206990 ATGATCAAAGAGATGGAGAATGG - Intergenic
940861469 2:158774388-158774410 AGCCATTAGGAGATGGAGAAAGG + Intergenic
941270354 2:163418924-163418946 TCCTAAAAAGAGATGGAGAAAGG + Intergenic
941495254 2:166192511-166192533 AGGTAAAAAGAGAGGGACACTGG - Intergenic
941811700 2:169761943-169761965 AGCTATAAAGGGTTAGAGAAGGG - Intronic
942088732 2:172467210-172467232 AGGTATCAAGAGAGGGCAAAGGG + Intronic
942519615 2:176790053-176790075 AGGAAGATAGAGATGGAAAATGG - Intergenic
942592779 2:177563495-177563517 AGGATAAAAGAGATGGAGGATGG - Intergenic
942800378 2:179868371-179868393 ATGTGTAAAGAAAAGGAGAAGGG + Intergenic
943167159 2:184344419-184344441 AGTTAAAATGTGATGGAGAATGG - Intergenic
943338502 2:186647641-186647663 ATGTAAAAAGAGACTGAGAAAGG + Intronic
943731375 2:191306670-191306692 AGGTGAAGAGAGAGGGAGAAAGG + Intronic
944068602 2:195645580-195645602 GGGTAGAAAGAAATGGGGAATGG - Intronic
944386835 2:199175026-199175048 AGGTATAAAGAGTCTGAAAAAGG + Intergenic
944556910 2:200896367-200896389 AGGTACGATGAGATGGAGAAAGG - Intronic
944640384 2:201718627-201718649 AGTTTTAAAGAGTTGGAGACTGG - Intronic
945180132 2:207083291-207083313 AGGGAGAAAGAGAGGGAGAGAGG - Intronic
945180885 2:207089993-207090015 AGGTTTAAAGGGAAGGGGAAAGG - Intronic
945371863 2:209028667-209028689 AGGGAGAAAGAGAAGGAGAGAGG + Intergenic
945685196 2:212960377-212960399 AGTAAAAAAGAAATGGAGAATGG - Intergenic
946637826 2:221749700-221749722 AGATAAAAAGGGAGGGAGAAAGG + Intergenic
946890141 2:224267046-224267068 GGGGAAAAAGAGATGGAGAAAGG - Intergenic
946942473 2:224784114-224784136 AAGTCTCCAGAGATGGAGAAAGG - Intronic
946980727 2:225212532-225212554 AGGGAGAAAGAGATGGAGGTGGG + Intergenic
947004289 2:225492738-225492760 AGGGAACAAGAGAGGGAGAAGGG + Intronic
947009864 2:225553505-225553527 AGGGAGAAAGAGAGGAAGAAAGG + Intronic
947196023 2:227568440-227568462 AGGGATAAAGAGAAGCATAAAGG + Intergenic
947206783 2:227667998-227668020 CGATCTCAAGAGATGGAGAAAGG - Intergenic
948063838 2:235062020-235062042 AGGCAGACAGAGATGGAGGAGGG + Intergenic
948131127 2:235601299-235601321 AAGGAGAAAGAGATGGAGACAGG + Intronic
948361437 2:237423241-237423263 AGGAAGAAAGAGAGAGAGAAAGG + Intronic
948856561 2:240732925-240732947 AGGGATAAGGGGATGGGGAAGGG + Intronic
1169620277 20:7498901-7498923 AGGTATAAAAATGTGGATAAGGG + Intergenic
1170317830 20:15061704-15061726 GGGTAAAAAGAGAAGGGGAAGGG + Intronic
1170391898 20:15884287-15884309 AGGTGAATAGAGAGGGAGAAGGG + Intronic
1170769303 20:19318232-19318254 AGGAATAGAGAGAGGGGGAAAGG - Intronic
1171121911 20:22575856-22575878 AGGTAAAAGGAGATGGGGGATGG - Intergenic
1172626965 20:36352884-36352906 AGTTATAAAGACATAAAGAACGG + Intronic
1173027065 20:39317864-39317886 ATGTATAAAGAGAGAGAAAATGG - Intergenic
1173070301 20:39758081-39758103 AGAAAGAAAGAGATGGAGAGAGG - Intergenic
1173095553 20:40024732-40024754 AGGTATAAATCGATGTTGAAAGG + Intergenic
1173281912 20:41636083-41636105 AGGGACAGAGAGATGGAGAGAGG + Intergenic
1173902336 20:46600235-46600257 AGGGAGAGAGAGATGGAGGAAGG + Intronic
1174767329 20:53266248-53266270 AGGAGTAAAGAGATGAAGGAGGG + Intronic
1175155101 20:56965774-56965796 GGGGAAAAAGAGGTGGAGAATGG + Intergenic
1175329236 20:58151227-58151249 AGGGAGAAGGAGACGGAGAAAGG - Intronic
1175358186 20:58385662-58385684 AGGTTAATAGACATGGAGAAGGG + Intergenic
1175929274 20:62485978-62486000 AGGTACAAGGCGATGCAGAAAGG + Intergenic
1177343296 21:19834157-19834179 TGGAATATAGAGATAGAGAAGGG + Intergenic
1177583579 21:23060074-23060096 AGATAGAAAGAGACTGAGAAAGG + Intergenic
1178139640 21:29668311-29668333 AGGGATATAGAGAATGAGAAGGG + Intronic
1178468354 21:32869499-32869521 AGGTACAGAGAGGTGGAGATGGG - Intergenic
1179091925 21:38274241-38274263 AGGCAACAAGAGATGAAGAAAGG - Intronic
1179112445 21:38459030-38459052 GGGCATAAAGAGATGGGGGATGG - Intronic
1180464349 22:15597741-15597763 AGCTAGAGAGAGATGGAGATTGG + Intergenic
1181678404 22:24473089-24473111 AGGTATACAGAGAAGTAGGAGGG + Intergenic
1181928740 22:26381707-26381729 AGGTATAAAGAGAAGGTGGAGGG + Intronic
1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG + Intergenic
1182615480 22:31586169-31586191 AGGTACAAAGAGAAGCAGGAGGG - Intronic
1182826176 22:33266788-33266810 AGGTATAAGGACAGGGAGCATGG - Intronic
1183169540 22:36176475-36176497 TGGTATAAAAAGAAGGATAAGGG - Intergenic
1183559634 22:38561351-38561373 AGGAAAAAAGAGATGGAGTCAGG - Intronic
949366270 3:3285001-3285023 AGGAAGAAGGAGAAGGAGAAGGG - Intergenic
949827000 3:8176314-8176336 AGTTACAAAGATATGGAGAGTGG - Intergenic
949970671 3:9400423-9400445 ATGATTAAAGAGATGGAGGAAGG - Intronic
950812915 3:15666814-15666836 AGATTTGAACAGATGGAGAAGGG - Intergenic
951222600 3:20084494-20084516 AGGAATAGGGAGATGGAGATGGG - Intronic
951234354 3:20217361-20217383 AGGTAAAAAGAAATGGTGCAGGG + Intergenic
951268666 3:20599839-20599861 CAAAATAAAGAGATGGAGAAAGG - Intergenic
951546328 3:23829674-23829696 AGCTAATAAGAGAAGGAGAAAGG + Intronic
952084288 3:29798419-29798441 AGAAAGAAAGAGAAGGAGAAAGG + Intronic
952129673 3:30346578-30346600 AGGCAAAGAAAGATGGAGAATGG - Intergenic
952327168 3:32331869-32331891 AGGGATAAAGAGAGGGTGCAAGG + Intronic
953039016 3:39238257-39238279 AGGAAGAAGGAGATTGAGAAAGG - Intergenic
953155027 3:40361923-40361945 AAGTATAAAGAGGAGGAGTAAGG - Intergenic
953465459 3:43115572-43115594 AGGTATATGGTGAAGGAGAAGGG + Intergenic
953501166 3:43435950-43435972 AGGTGTAAAGAGAAGCAGAAAGG + Intronic
953903732 3:46857834-46857856 AGGAAAAAAGAGAGGGAGGAAGG + Intergenic
955449092 3:59048720-59048742 AGCAATAAAGAGGTGGAGACGGG + Intronic
955506956 3:59641914-59641936 TGGGATGAAGAGACGGAGAAAGG + Intergenic
956524951 3:70148641-70148663 AGGAATCAAGAGACAGAGAAGGG + Intergenic
956900830 3:73714292-73714314 ATGGATTAAGAGATGGAGAAAGG - Intergenic
956971535 3:74532027-74532049 AGGGATAAAGAGAGGGAGAGAGG + Intergenic
957162642 3:76629966-76629988 ATGTCAAAAGAGATGGAGAAAGG - Intronic
957210528 3:77252219-77252241 AGGAAGAAAGTGTTGGAGAATGG - Intronic
957236330 3:77597092-77597114 ATGTTAAATGAGATGGAGAAGGG - Intronic
957446019 3:80313858-80313880 AGATTAAAAAAGATGGAGAAGGG + Intergenic
957580942 3:82072373-82072395 AGAAATAAGGAGAGGGAGAAAGG + Intergenic
957593784 3:82233937-82233959 AGGGAGAAAGAGAGGGAGGAAGG + Intergenic
958479422 3:94627871-94627893 AGGAAGAAAGAGAAGGAGAGAGG - Intergenic
958903065 3:99910926-99910948 AAGGATGAAGAGATGGAGACTGG + Intronic
959473678 3:106783981-106784003 AGTTAAAGGGAGATGGAGAAAGG - Intergenic
960051841 3:113246803-113246825 AGGTATCCAGAGAGGGAGAAAGG - Intronic
960320374 3:116227605-116227627 AGATAAAAAAAAATGGAGAAGGG - Intronic
960325168 3:116286578-116286600 AGGGATAAAAAGCTGGAGGAGGG - Intronic
960397703 3:117157146-117157168 AGGTGTAAATAGATGGAGAAAGG + Intergenic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
960813337 3:121647380-121647402 AGGAAGAAAGAGATGGAGTCAGG - Exonic
961322380 3:126084443-126084465 AGGTAGAAAGGTACGGAGAACGG + Intronic
961460232 3:127045468-127045490 AGGGAGAAAGGGAAGGAGAAAGG + Intergenic
961802435 3:129462137-129462159 TTGTATAAATACATGGAGAAAGG + Intronic
961905836 3:130262149-130262171 AGGTTTAACCAGATGCAGAAGGG - Intergenic
962338731 3:134562929-134562951 TGGTATTAAGAGCTTGAGAATGG - Exonic
962561310 3:136609454-136609476 AGGTATAAAGAAAAGGGAAAAGG + Intronic
962631348 3:137279285-137279307 AGGTAGAACGGGAAGGAGAAAGG - Intergenic
962775740 3:138657947-138657969 GGCTATAAACAGAGGGAGAAGGG - Intronic
962784009 3:138749687-138749709 AGGTAAAGAGAGGTGGAGAAAGG - Intronic
962870742 3:139490549-139490571 AGGTAGAGAGAGAGGGATAATGG - Intergenic
962878601 3:139554816-139554838 AGGAAGAAAGAGATGGACAGAGG + Intergenic
963006420 3:140730048-140730070 AAGTATAAATATATGGAAAAAGG + Intergenic
963083095 3:141412885-141412907 AGGTACAAAGAGAGGCACAAAGG - Intronic
963093066 3:141504806-141504828 AGATAGTAAGAGATGGAGTAAGG - Intronic
963451325 3:145484786-145484808 AGTTATAAATGGCTGGAGAAAGG + Intergenic
963622678 3:147631960-147631982 AGCTCAAAAGAGGTGGAGAAAGG + Intergenic
964040198 3:152252247-152252269 AGGAATAAAGGGAAGGAGGAAGG - Intronic
964402831 3:156316885-156316907 GGGTAAAGAGAGATGGAGAGTGG + Intronic
964718078 3:159743634-159743656 AGTTGTAAAGAGCTGGAGAACGG + Intronic
966077428 3:175954728-175954750 AGGTGCAAGGAGAAGGAGAAAGG + Intergenic
966339022 3:178904130-178904152 AGAAATAAAGAGGTGAAGAAGGG + Intergenic
967190829 3:186983596-186983618 AGGTAGTAAGAGGTGGAGAGAGG + Intronic
967512959 3:190334389-190334411 TGGAATAAAGAGACTGAGAAGGG + Intronic
967653285 3:192013353-192013375 AGGGAGAAAGAAAGGGAGAAAGG - Intergenic
968865584 4:3209218-3209240 AGGTATGAGGAGATGGAGGGAGG - Intronic
969436063 4:7190253-7190275 AGGAAGAAAGAGAGAGAGAAGGG - Intergenic
969849125 4:9942921-9942943 AGGTACAAGGAGATGGCCAAGGG + Intronic
970181216 4:13397352-13397374 AGGTAGAAGGAGATGGATAAAGG + Intronic
970865786 4:20757159-20757181 TGGCATAAAGAGATGAAGAGAGG - Intronic
970947702 4:21714530-21714552 AGGAAGAAAGAGAGGGAGGAAGG + Intronic
971432045 4:26578468-26578490 AGATAAAAAAAGATGGTGAAAGG + Intronic
974441446 4:61923627-61923649 TGGAATGAAGAGAAGGAGAAAGG - Intronic
975180296 4:71336414-71336436 AGGTATAGGGAAATGGAAAAAGG + Intronic
975396026 4:73874299-73874321 AGGAAAAAAGAGTTGTAGAAAGG - Intergenic
976336322 4:83892161-83892183 AGGAATAAAGAGAGGGAGGAAGG - Intergenic
976382655 4:84417940-84417962 AGGTATTAGGGGATGCAGAAAGG + Intergenic
976407511 4:84676845-84676867 AAGCATAAAAACATGGAGAATGG + Intronic
976785283 4:88812540-88812562 AGGCAGAGAGAGGTGGAGAAAGG - Intronic
977621095 4:99137916-99137938 GGGGAAAAAGAGAGGGAGAAGGG - Intronic
978093797 4:104750374-104750396 AGTTAGGAAGTGATGGAGAAGGG + Intergenic
979857588 4:125652339-125652361 AGGAATAGGGAGATGGAGACAGG - Intergenic
980151415 4:129053486-129053508 AGGTCAAAAGAGATAAAGAAGGG - Intronic
980222761 4:129940929-129940951 CATTATAAAGAGAAGGAGAAGGG - Intergenic
980585331 4:134806176-134806198 AGGTATATAGATATAGATAATGG - Intergenic
981125298 4:141099042-141099064 AGAAATAATGAGATGGAGACAGG - Intronic
981679695 4:147382192-147382214 CCGTCTACAGAGATGGAGAAAGG + Intergenic
982376066 4:154692304-154692326 AGGTGGAAGGAGATGGAGATAGG - Intronic
982573706 4:157081574-157081596 AGGTAGAAAGAGATGGTCTAAGG - Intronic
984418761 4:179492713-179492735 AGGTAGAGAGAGAAAGAGAAAGG - Intergenic
984795206 4:183653935-183653957 AAGTATGAAGAAATGGGGAACGG + Intronic
984962471 4:185111096-185111118 AGGAATAAAAGCATGGAGAAGGG + Intergenic
985385579 4:189444174-189444196 AAGGAGAAAGAGAAGGAGAAAGG - Intergenic
985929291 5:3043707-3043729 ATGGATAAAGAGATGGAGACAGG - Intergenic
986299678 5:6468100-6468122 AGGTTTATAGAGACGGTGAAAGG - Intronic
986322832 5:6647528-6647550 AGGTCAAAAGAGACGAAGAAGGG - Intronic
986536069 5:8788753-8788775 AGGAAGAGAGAGAGGGAGAAAGG - Intergenic
987169205 5:15236188-15236210 AGCTGAAAATAGATGGAGAATGG - Intergenic
987257258 5:16168751-16168773 AGGAAGAAAGAGATGGAAGAAGG + Intronic
987779370 5:22413903-22413925 ATGTATAAAGAGAGAGAGAAAGG - Intronic
987859895 5:23471160-23471182 ACATAGCAAGAGATGGAGAAAGG + Intergenic
988166636 5:27598783-27598805 TGGTACAAATAGAAGGAGAAAGG - Intergenic
988381588 5:30503507-30503529 AGATATTCAGAGATGTAGAAAGG + Intergenic
988792105 5:34618218-34618240 AGGTATAGAGTGATTGAGGAAGG + Intergenic
991254475 5:64599286-64599308 TGGTACATAGAGGTGGAGAAAGG + Intronic
991405419 5:66296462-66296484 AGGAATGAAGAGATGGAGCATGG - Intergenic
991515801 5:67433830-67433852 AGGTAGAAAGAAAAGGAGAAGGG + Intergenic
991975154 5:72177921-72177943 AGGAAAAAAGAGAGGGAGGAAGG - Intronic
992031080 5:72722107-72722129 AGGAGAGAAGAGATGGAGAAGGG + Intergenic
992389839 5:76320296-76320318 AGGAATGAATAGATGGAGCATGG + Intronic
992458148 5:76935388-76935410 AGGTATTCTGAGATCGAGAAAGG - Intergenic
992462207 5:76971799-76971821 AAGATTACAGAGATGGAGAATGG - Intronic
992678937 5:79134022-79134044 AGGGAAAAAGGGAGGGAGAACGG + Intronic
992874849 5:81043815-81043837 AGGAACAGACAGATGGAGAAGGG - Intronic
993121818 5:83784467-83784489 AGGAACAAAGGGAGGGAGAAAGG - Intergenic
993776398 5:92003531-92003553 AGGTAAATAGAGAGAGAGAAAGG + Intergenic
993810546 5:92470725-92470747 AGGTATGGAGGTATGGAGAAGGG + Intergenic
993812751 5:92503160-92503182 AAGAATAAAGAGAAGGAGCAAGG - Intergenic
993966648 5:94367544-94367566 AGTGATAAAGTGATAGAGAAAGG + Intronic
994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG + Intergenic
994171019 5:96660197-96660219 AGGTGTGAACAGAAGGAGAAGGG - Intronic
994634267 5:102324624-102324646 AGGCATAAAGAAAGGGAGAAAGG - Intergenic
994748228 5:103705878-103705900 ATGATTAAAGAAATGGAGAAAGG + Intergenic
995115958 5:108479325-108479347 AGGCATAAAGAGTGGGATAATGG + Intergenic
995368731 5:111393962-111393984 AGTGAAACAGAGATGGAGAAGGG + Intronic
995420075 5:111954642-111954664 AGAAATAAAGAGATAAAGAAGGG + Intronic
995781725 5:115783820-115783842 AGGAAAAAAGGGAGGGAGAAAGG - Intergenic
995848223 5:116517350-116517372 GGATATAAAGTGATGGAGAAAGG + Intronic
996307702 5:122068816-122068838 ATGAATAAATAAATGGAGAATGG + Intronic
996641904 5:125764931-125764953 AGAGAGAAAGGGATGGAGAAAGG - Intergenic
997020571 5:129995924-129995946 AGGAAGAGAGAGATGGAAAATGG - Intronic
997265680 5:132493937-132493959 AGGGAGAGAGAGATGGAGAGAGG - Intergenic
997552398 5:134764830-134764852 AGGAAGAGAGAGATGGAGGAAGG - Intronic
997700131 5:135891641-135891663 TGGTATAAAGAGAATAAGAAAGG + Intergenic
998084574 5:139308080-139308102 ACAGATTAAGAGATGGAGAAAGG + Exonic
998808773 5:145944518-145944540 ATGAATAAATAGAAGGAGAAAGG - Intronic
998861494 5:146447947-146447969 AGGAATAAAGGGATGAAAAAAGG - Intronic
999381522 5:151124574-151124596 AGATATAGAGAGAGGGAGAGAGG + Intronic
999540296 5:152564121-152564143 AGGTATAAAGGCCTTGAGAAGGG + Intergenic
999903563 5:156114003-156114025 AGGGATAAATAGATGGAGCCAGG + Intronic
1000152169 5:158513964-158513986 AGGGAGAAAGAGAAGGAGAGAGG + Intergenic
1000333387 5:160223745-160223767 AGGGAAAGAGAGATGGGGAATGG - Intronic
1000967920 5:167682037-167682059 AGGAAGAAAGGGAAGGAGAAAGG - Intronic
1001680691 5:173554917-173554939 AGGACTAAAAAGAGGGAGAAGGG + Intergenic
1002415000 5:179115701-179115723 AGGGAGAAAGGGAGGGAGAAAGG + Intronic
1002597389 5:180333191-180333213 AGATATAAAAAAATGGAGAAGGG - Intronic
1002819944 6:715599-715621 ATGCATAAACAGATGGAAAATGG + Intergenic
1003709612 6:8574845-8574867 AGGGAGAAAGAGAAAGAGAAAGG - Intergenic
1004069661 6:12287322-12287344 AGGTGAAAAGAGCTGGACAAAGG - Intergenic
1004202775 6:13564992-13565014 GGGGATGAAGAGATAGAGAATGG - Intergenic
1004558973 6:16728905-16728927 AGGAATAAATAGAAGGAGAATGG - Intronic
1004559972 6:16740002-16740024 AGCTGTAAAGAGATTGAGGAGGG + Intronic
1004730483 6:18353361-18353383 ATGTATAAACTGATGGAGGAGGG + Intergenic
1004887636 6:20067008-20067030 AGGAAGAGAGAGAGGGAGAAGGG + Intergenic
1005149695 6:22734596-22734618 AGTTTTTAAGTGATGGAGAATGG + Intergenic
1005471559 6:26166406-26166428 AGGAATAAAGGGAAGGAGGAGGG - Intronic
1006245221 6:32728033-32728055 AGGGAGAAAGAGAGGGAGGATGG - Intergenic
1006284440 6:33081820-33081842 GGGTGTAAAGGGATGGAGAGAGG + Intronic
1006508849 6:34510616-34510638 AGATCTAAAAAGAGGGAGAAAGG - Intronic
1006599074 6:35213963-35213985 AGGAAGAAAGAGAGGCAGAAAGG + Intergenic
1007275841 6:40673050-40673072 AGGGATGGAGAGAAGGAGAAAGG - Intergenic
1007377429 6:41466478-41466500 AGGAATGGAGAGATGGAGAGAGG + Intergenic
1008823233 6:55659138-55659160 AGGTAACAAGAGAGGGAGAAAGG + Intergenic
1009296821 6:61961445-61961467 AGAAAAAAAGAGATGGAGGAAGG + Intronic
1009342091 6:62568663-62568685 AGGAAGAGAGAGGTGGAGAAGGG - Intergenic
1009815659 6:68730726-68730748 AGTTATAAAGAGATGTAGTCAGG + Intronic
1010143587 6:72639763-72639785 GGGTAAAGAGAGAGGGAGAATGG + Intronic
1010301749 6:74268494-74268516 AAGTATATATAGATGGAGAAAGG + Intergenic
1011183396 6:84647500-84647522 TGGTACAAAGAGATGAAGGATGG - Intergenic
1011531826 6:88331407-88331429 AGGCATTAAGAGATGGATGATGG - Intergenic
1011671670 6:89689307-89689329 AGGTATAAACAAATGGTGTAGGG + Intronic
1012492788 6:99800784-99800806 AAGTTTCAAGAGATGCAGAAAGG - Intergenic
1012931180 6:105318510-105318532 TGGTATCCAGAGAAGGAGAAAGG + Intronic
1014294198 6:119598401-119598423 AGGCACAAGGAGAAGGAGAAGGG + Intergenic
1014737509 6:125111649-125111671 AAGGAAGAAGAGATGGAGAAAGG - Intergenic
1014901686 6:126973315-126973337 AGGTTTTAAGAAATGGAGAATGG + Intergenic
1015388228 6:132650753-132650775 AGGCATAAAGAGATGGGTATGGG - Intergenic
1015412966 6:132915203-132915225 AGGAATACAGAGCAGGAGAAGGG + Intergenic
1016702857 6:147073057-147073079 GGGAAAAAAGAGATGGAGACGGG + Intergenic
1017029699 6:150210369-150210391 AGGAATAAACAGATGGAGTTTGG - Intronic
1017073279 6:150595694-150595716 AGGGACCAAGAGATGGAAAAAGG - Intergenic
1017824877 6:158074113-158074135 AGCTAGAGAGAGATGGAGAAGGG + Intronic
1018649078 6:165976322-165976344 AGGTATACAAAGATGGTGAGAGG - Intronic
1018691982 6:166353760-166353782 AGGCAGAAAGAGAGGAAGAAAGG - Intergenic
1018961675 6:168453867-168453889 AGAGAGACAGAGATGGAGAATGG - Intronic
1020505292 7:8979297-8979319 AGATAGACAAAGATGGAGAATGG + Intergenic
1020533693 7:9366647-9366669 AAGTAAAAAGAGATAAAGAAGGG + Intergenic
1020806730 7:12799237-12799259 AGGTGTATAGAGATAGAGCAGGG - Intergenic
1021734954 7:23634143-23634165 AGGTATAAAAAGATAAAGTACGG + Intronic
1021767831 7:23967275-23967297 AGGTATAGAGAAGTGAAGAAGGG - Intergenic
1021921028 7:25485049-25485071 AGGGAGAAAGAGTGGGAGAAAGG + Intergenic
1022510554 7:30932614-30932636 AGGGAGAAAGAGAAGGAGAGAGG + Intergenic
1022516515 7:30978192-30978214 AGGAATAAAGAGAGGGAGAGTGG - Intronic
1022611942 7:31884672-31884694 ATGGATAAAGAGCTAGAGAAAGG - Intronic
1022988980 7:35688771-35688793 ATGTATAATAAGATGAAGAAAGG - Intronic
1023562648 7:41491833-41491855 AGACAGAAAGAGAGGGAGAAGGG - Intergenic
1023827090 7:44016942-44016964 TGGGATGAAGAGATTGAGAAAGG - Intergenic
1023957406 7:44897896-44897918 AAGTATTAACAGTTGGAGAATGG + Intergenic
1024047530 7:45595371-45595393 AGGCAGAAGGAGAGGGAGAACGG - Intronic
1024104348 7:46067038-46067060 AGGAAAAGAGAGATGAAGAATGG - Intergenic
1024439751 7:49403666-49403688 AGGAAGAGAGAGAAGGAGAAGGG + Intergenic
1024682027 7:51700668-51700690 AAATATAAAGAGAAGGAGAAAGG + Intergenic
1025033292 7:55574168-55574190 AGGCAGAGAGAGATGCAGAAGGG - Intergenic
1025866136 7:65383100-65383122 AGGCAAAAAGAGATAGAGAGTGG - Intronic
1026494114 7:70888023-70888045 AGGGATAGAGAGATGGGGAAAGG + Intergenic
1026905054 7:74058007-74058029 AAGGAGAAAGAGAAGGAGAAGGG - Intronic
1027560728 7:79725909-79725931 AAGGAGAAAGAGATAGAGAAAGG - Intergenic
1027950695 7:84811089-84811111 AGGCAGAAAGGGATGGAGAGAGG - Intergenic
1028409968 7:90519822-90519844 AGGAAGAAGGATATGGAGAAAGG - Intronic
1029015855 7:97314910-97314932 AGGCACAATGAGATGGAGCAGGG - Intergenic
1029633828 7:101770520-101770542 AGGAAAAAAGAAATGAAGAAAGG - Intergenic
1029738245 7:102476688-102476710 TGGGATGAAGAGATTGAGAAAGG - Intronic
1029755375 7:102570344-102570366 TGGGATGAAGAGATTGAGAAAGG - Intronic
1029773324 7:102669424-102669446 TGGGATGAAGAGATTGAGAAAGG - Intronic
1030571474 7:111230380-111230402 AGGAATAAAGAGATTCAAAAGGG + Intronic
1031560702 7:123234494-123234516 AGCTATAAAGAGAAGGAAAGAGG + Intergenic
1032433684 7:131883034-131883056 AGGGAGAATGAGATGGGGAAAGG - Intergenic
1032685723 7:134231711-134231733 AGGGAGGAAGAGAGGGAGAACGG - Intronic
1032685732 7:134231743-134231765 AGGGAGGAAGAGAGGGAGAACGG - Intronic
1033615764 7:143012755-143012777 AGGAAGAAGGAGAGGGAGAATGG + Intergenic
1033619979 7:143053182-143053204 AAGGATAAAGGGATTGAGAAAGG - Exonic
1034352152 7:150423675-150423697 AGGGATAAATAGGTGGAGCACGG - Intergenic
1034531059 7:151696801-151696823 AGGGAAAAAGAGCTGGAGAGTGG + Intronic
1034900521 7:154905610-154905632 AGAGAGAAAGAGAGGGAGAAGGG - Intergenic
1035242943 7:157543987-157544009 AGGTGGAGAGAGATGGAGAGCGG + Intronic
1035242960 7:157544107-157544129 AGGTGGAGAGAGATGGAGAGAGG + Intronic
1035380791 7:158439438-158439460 AGGAAAAATGAGATGGAGACAGG + Intronic
1035537784 8:405846-405868 AGGAATAAAGAGAGAGGGAAAGG + Intergenic
1036111413 8:5907147-5907169 AGGAATAGAGAGATGGAGGGAGG - Intergenic
1037216925 8:16465728-16465750 AGAAATAAAGAGATGTAGATGGG + Intronic
1037831186 8:22190575-22190597 AGGTATAGAGAGGTGGAGAGAGG + Intronic
1038160058 8:25027984-25028006 AGGCATTGAGAGATGAAGAAGGG + Intergenic
1038232477 8:25714975-25714997 AGGGAAAAAGGGAGGGAGAAAGG - Intergenic
1038384631 8:27130741-27130763 AGATAGAGAGAGAAGGAGAAAGG + Intergenic
1039770544 8:40682334-40682356 AGGTAAAATGAGTTGGAGGAAGG + Intronic
1039838913 8:41279699-41279721 AGGTATAAAGGGATTTAGAGAGG + Intronic
1040679349 8:49789882-49789904 AGGAATCAAGAGATGGGGATGGG + Intergenic
1042178188 8:66058341-66058363 AGGTAGATAGAGGTGGGGAAAGG + Intronic
1042255018 8:66793920-66793942 AGGTATGTGGAGATGGGGAAGGG - Intronic
1042463312 8:69096547-69096569 AAGCATAAAAAGATAGAGAAAGG + Intergenic
1042966806 8:74362357-74362379 AGGAATCAACAGAAGGAGAAAGG - Intronic
1043007444 8:74837059-74837081 ATCTATAAAGAGATGGTGTAAGG - Intronic
1043206612 8:77451651-77451673 AGATAGAAAGAGATAGAGAACGG + Intergenic
1043708935 8:83389700-83389722 AAGAACAGAGAGATGGAGAATGG + Intergenic
1044579964 8:93814999-93815021 TTGTATAAAGAAATAGAGAAAGG + Intronic
1044758265 8:95489767-95489789 ATTTACAAAGAGATGGAAAATGG + Intergenic
1045359398 8:101418744-101418766 AGGTCTAAAAAGATCAAGAAAGG - Intergenic
1045377597 8:101590674-101590696 AGGTATAAAGAGAAGGAACATGG - Intronic
1045830478 8:106454115-106454137 AGGTAGAAAGAGATTCATAAAGG - Intronic
1045960419 8:107961526-107961548 AGTTATAGAGAGAAAGAGAATGG - Intronic
1046428249 8:114084589-114084611 AGGGAGAAAGAGATGGATACTGG - Intergenic
1046853872 8:119007021-119007043 AGGTATAACTAGAGGAAGAATGG - Intronic
1047023613 8:120804227-120804249 AGGAATAAAGGGAGGGAGAAAGG - Intronic
1047435043 8:124829231-124829253 GGGTATAAAAAGATGGAAAAGGG + Intergenic
1047614948 8:126556376-126556398 AGGGAGGAAGAGAGGGAGAAAGG + Exonic
1047660520 8:127029531-127029553 AGCTATAAAAACCTGGAGAAAGG + Intergenic
1047794618 8:128241921-128241943 GGGGATAAAGAGATGTAGAGTGG + Intergenic
1048084858 8:131166130-131166152 AGGTATTAAGTGGTGGAGACAGG - Intergenic
1048787053 8:138061828-138061850 ATTTATAAAGAGCTGGGGAAAGG - Intergenic
1050013275 9:1207534-1207556 AAGGAGAAAGAGATGGAGAGAGG + Intergenic
1050023207 9:1306523-1306545 AGGTAGAAAGTGATGGAGCTAGG + Intergenic
1050725187 9:8641325-8641347 AGGTATAAAGATGGGGAGAAAGG + Intronic
1050804848 9:9661764-9661786 AGGAAGAAAGAGAAGGAAAAAGG + Intronic
1050839584 9:10131131-10131153 AGGAATAAAGAGAGTGAGGATGG + Intronic
1051994414 9:23197654-23197676 AGAGAAATAGAGATGGAGAAGGG - Intergenic
1052082199 9:24220781-24220803 AGGTAAAATGAGATGAAGAAAGG + Intergenic
1052193080 9:25680062-25680084 AGGGATGAAGAGAGGGAGAAAGG + Intergenic
1052690775 9:31814161-31814183 AGAAAGAAAGAGATGGGGAATGG + Intergenic
1052830930 9:33214812-33214834 AGGGATAAAGGGATAGAGAGAGG + Intergenic
1053149797 9:35736195-35736217 AGGAAAAAGGAGATGAAGAAGGG - Intronic
1053464536 9:38296096-38296118 AAGAAAAAAGACATGGAGAAGGG + Intergenic
1053578971 9:39383267-39383289 AGGAAAAAAGAGATGGGGGATGG + Intergenic
1053843483 9:42211342-42211364 AGGAAAAAAGAGATGGGGGATGG + Intergenic
1054100554 9:60942071-60942093 AGGAAAAAAGAGATGGGGGATGG + Intergenic
1054121950 9:61217696-61217718 AGGAAAAAAGAGATGGGGGATGG + Intergenic
1054585792 9:66964815-66964837 AGGAAAAAAGAGATGGGGGATGG - Intergenic
1054708049 9:68483039-68483061 AGGTAAAAAGAAAGGGAGAAGGG - Intronic
1054966835 9:71038475-71038497 AGGAAAGAAGAGAGGGAGAAAGG - Intronic
1055169674 9:73240591-73240613 AGGCATAGAGAGATGGTGTAAGG + Intergenic
1055189957 9:73506597-73506619 AGTCAGAAAGAGATGGGGAATGG - Intergenic
1055369493 9:75581951-75581973 AGATATAAAAAGATGTTGAATGG - Intergenic
1056108541 9:83371856-83371878 AGGGAGGAAGAGAGGGAGAAAGG + Intronic
1056401504 9:86232084-86232106 ATGTATAGAGAGTTGGAGATTGG - Intronic
1056643793 9:88392635-88392657 AGGTAGAAAAAGAGGGAGGAAGG - Intronic
1058051035 9:100406829-100406851 TAGTATAAAGAGGTGGAGAAAGG + Intergenic
1058403952 9:104650369-104650391 ATATACACAGAGATGGAGAATGG + Intergenic
1058508165 9:105687748-105687770 AGGCAGAAAGACAAGGAGAAGGG + Intergenic
1058599537 9:106654218-106654240 AGGTAGGAAGAGAAAGAGAAGGG - Intergenic
1058713111 9:107698216-107698238 AGGTGGAAAGAAATGGAGCAGGG + Intergenic
1059233922 9:112746291-112746313 AGGTTAAAAGAGAGAGAGAAAGG + Intergenic
1059428047 9:114233368-114233390 AGGTAGAAACAGGTAGAGAAAGG - Intronic
1059824636 9:118015182-118015204 AGGCAGAAAGAGAAGAAGAAAGG - Intergenic
1059876903 9:118645295-118645317 AGGGAGAAAGGGAGGGAGAAAGG - Intergenic
1060105667 9:120871593-120871615 AGAAAAAAAGAGATGGAGAGGGG - Intronic
1060854704 9:126906059-126906081 AGCACTAAATAGATGGAGAAAGG + Intergenic
1061036808 9:128118768-128118790 AGGGATGCAGAGATGGAGGATGG + Intergenic
1061555850 9:131368400-131368422 TGGTATAAAGAGATGGGGCTGGG + Intergenic
1061572889 9:131488561-131488583 AAGAATAAAGAGATGGATGAGGG - Intronic
1062161789 9:135084615-135084637 AGGAAGAAAGGGAGGGAGAAGGG - Intronic
1185559089 X:1044934-1044956 AGGAAAAAAGAGAGGGCGAATGG - Intergenic
1185843659 X:3417033-3417055 AGGAAGAAAGGGAAGGAGAAAGG - Intergenic
1185843687 X:3417169-3417191 AGGAAGAAAGGGAGGGAGAAAGG - Intergenic
1186424839 X:9455700-9455722 AAGTAGAAAGAGAAGGAGAAAGG - Intergenic
1186471166 X:9823100-9823122 AGGGAGAAGGAGAAGGAGAAGGG - Intronic
1186471173 X:9823132-9823154 AGGAAGAAGGAGAAGGAGAAGGG - Intronic
1186578731 X:10793969-10793991 AGGGAGCAAGAGAAGGAGAAAGG - Intronic
1186872268 X:13784627-13784649 CGGTAGAAGGAAATGGAGAAAGG + Intronic
1187135166 X:16540992-16541014 AGGAAGAAAGAGAGGAAGAAAGG + Intergenic
1187167542 X:16818536-16818558 AGGAGAAAAAAGATGGAGAAGGG - Intronic
1187208831 X:17209139-17209161 AGGAATAAAGAAGTGCAGAAAGG + Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1187810460 X:23170890-23170912 TGGCATAAAGGGAAGGAGAAGGG - Intergenic
1188002938 X:24999060-24999082 AGGTAGTAAGGGCTGGAGAAAGG - Intergenic
1189217312 X:39337364-39337386 AGGGAGAGAGAGAGGGAGAAAGG - Intergenic
1189224413 X:39400664-39400686 AGAGAGAAAGAGAAGGAGAAGGG - Intergenic
1190702956 X:53001678-53001700 AGGGAGAAAAAGATGGGGAAGGG - Intergenic
1190735766 X:53255243-53255265 AGGAAGAAAGAGAATGAGAAAGG + Intronic
1191185307 X:57605463-57605485 AGGTCAAAAGAGATAAAGAAGGG - Intergenic
1192191038 X:68991266-68991288 AAGAACAAAGAGATGGAGGAAGG - Intergenic
1192544672 X:72003779-72003801 AGGATTAAAGAGATGATGAATGG - Intergenic
1194710349 X:97228958-97228980 AGCTATACATAGATGGACAAGGG - Intronic
1194771377 X:97910124-97910146 AGGAAAAAAGAGAGAGAGAAAGG - Intergenic
1196142547 X:112280317-112280339 AGGAAGAAAGAGAGGGGGAAAGG + Intergenic
1196170750 X:112586427-112586449 TGCTATAAAGAGATGCATAAAGG + Intergenic
1196630572 X:117934528-117934550 ATGGATAAAGAATTGGAGAATGG + Intronic
1196695969 X:118612097-118612119 AGAAATGAAGAGAGGGAGAATGG - Intronic
1197239866 X:124112155-124112177 AGGTAGCAAGAGAGGAAGAAAGG - Intronic
1197584752 X:128331722-128331744 AGGAAAAAAAAGATGAAGAATGG - Intergenic
1197604335 X:128566606-128566628 TGGTTTAAAGAGAAGTAGAATGG - Intergenic
1197618861 X:128723963-128723985 ATCTATAAAGAGGTGAAGAAAGG - Intergenic
1197900006 X:131360767-131360789 AGGGATAAGAACATGGAGAAAGG + Intronic
1197909790 X:131468983-131469005 AGGAATAAACAGATGGAGTAAGG - Intergenic
1197990913 X:132316162-132316184 AGGAATAAAGAGCTCCAGAATGG - Intergenic
1198101438 X:133425571-133425593 AGATAAAAAGAGTTGGAGAGAGG + Intergenic
1199366055 X:146984988-146985010 AGGTATAAAGTGAAGGTGAGTGG + Intergenic
1200325386 X:155232807-155232829 AGGCAGAAAGAGATAGAGACAGG - Intronic
1201887705 Y:18903963-18903985 AGGTAAAAGGGGATGGAGGAAGG + Intergenic