ID: 1114549507

View in Genome Browser
Species Human (GRCh38)
Location 14:23524923-23524945
Sequence CTGGGGGAGCCTCCGGCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 294}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114549507_1114549515 -2 Left 1114549507 14:23524923-23524945 CCTGCAGCCGGAGGCTCCCCCAG 0: 1
1: 0
2: 0
3: 26
4: 294
Right 1114549515 14:23524944-23524966 AGTGCCTCCTCCGGTTGGCATGG 0: 1
1: 0
2: 0
3: 4
4: 84
1114549507_1114549511 -7 Left 1114549507 14:23524923-23524945 CCTGCAGCCGGAGGCTCCCCCAG 0: 1
1: 0
2: 0
3: 26
4: 294
Right 1114549511 14:23524939-23524961 CCCCCAGTGCCTCCTCCGGTTGG 0: 1
1: 0
2: 1
3: 12
4: 193
1114549507_1114549519 13 Left 1114549507 14:23524923-23524945 CCTGCAGCCGGAGGCTCCCCCAG 0: 1
1: 0
2: 0
3: 26
4: 294
Right 1114549519 14:23524959-23524981 TGGCATGGACCCACCCTCACAGG 0: 1
1: 0
2: 1
3: 14
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114549507 Original CRISPR CTGGGGGAGCCTCCGGCTGC AGG (reversed) Exonic