ID: 1114549507

View in Genome Browser
Species Human (GRCh38)
Location 14:23524923-23524945
Sequence CTGGGGGAGCCTCCGGCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 294}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114549507_1114549515 -2 Left 1114549507 14:23524923-23524945 CCTGCAGCCGGAGGCTCCCCCAG 0: 1
1: 0
2: 0
3: 26
4: 294
Right 1114549515 14:23524944-23524966 AGTGCCTCCTCCGGTTGGCATGG 0: 1
1: 0
2: 0
3: 4
4: 84
1114549507_1114549511 -7 Left 1114549507 14:23524923-23524945 CCTGCAGCCGGAGGCTCCCCCAG 0: 1
1: 0
2: 0
3: 26
4: 294
Right 1114549511 14:23524939-23524961 CCCCCAGTGCCTCCTCCGGTTGG 0: 1
1: 0
2: 1
3: 12
4: 193
1114549507_1114549519 13 Left 1114549507 14:23524923-23524945 CCTGCAGCCGGAGGCTCCCCCAG 0: 1
1: 0
2: 0
3: 26
4: 294
Right 1114549519 14:23524959-23524981 TGGCATGGACCCACCCTCACAGG 0: 1
1: 0
2: 1
3: 14
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114549507 Original CRISPR CTGGGGGAGCCTCCGGCTGC AGG (reversed) Exonic
900101760 1:964928-964950 CGGGGTGAGCCCCTGGCTGCAGG - Intronic
900137648 1:1125179-1125201 CTGGAGGAGCTCCCGGCTCCCGG + Intergenic
900163537 1:1235748-1235770 GCGGGGGTGCCTCCGGATGCAGG - Intergenic
900358933 1:2278729-2278751 CTGGGGCAGCCTCCAGCAGAAGG - Intronic
900366759 1:2314787-2314809 GGGGGGGAGCCTGAGGCTGCGGG - Intergenic
900514110 1:3073202-3073224 TGGGGGGAGCCCCTGGCTGCTGG - Intronic
900629052 1:3624265-3624287 CTGGGGGCACCTCCGGGAGCTGG + Intergenic
901142848 1:7046396-7046418 CTCTGGAAGCCTCCGGCAGCTGG - Intronic
901192760 1:7422323-7422345 CTGGTGGATCCTCCTGCTGGGGG + Intronic
901626323 1:10627204-10627226 CGGGCGGGGCCTGCGGCTGCAGG - Intronic
901677793 1:10897093-10897115 GTGAGGGAGGCTCAGGCTGCCGG - Intergenic
902040352 1:13487790-13487812 CTGAGAGATCCTCTGGCTGCAGG - Intronic
902624553 1:17668973-17668995 CTGGGGGAGCCGCCTGGAGCCGG + Intronic
902939133 1:19787169-19787191 CTGGGGGAGGCTACGGCAGAGGG + Intronic
903032994 1:20476706-20476728 CTCTGGGAGCTTCCAGCTGCAGG + Intergenic
903462701 1:23530625-23530647 CTGCGGGAGGCGCCGTCTGCGGG + Exonic
904415153 1:30356405-30356427 CTGGGGCAGGCTCTGGGTGCAGG - Intergenic
906017354 1:42593627-42593649 CTGGGGCAGCCTCAGGATGTAGG - Intronic
907012632 1:50977941-50977963 CTGGGGCAGACTCCGGCCACTGG - Intergenic
908301157 1:62761830-62761852 GTTGGGGAGGCTCAGGCTGCAGG - Intergenic
912439420 1:109687416-109687438 CTCTGGGAGACTCCGGCTGCAGG - Intronic
912442726 1:109711856-109711878 CTCTGGGAGACTCCGGCTGCAGG - Intergenic
913186536 1:116374064-116374086 CGGGGGCAGCCTCCGGGTTCGGG + Exonic
915519901 1:156436113-156436135 TTTTGGGAGCCTCCGGCCGCGGG + Intergenic
916601115 1:166294387-166294409 CTGTGGGAGCCAAGGGCTGCGGG + Intergenic
917740950 1:177961620-177961642 CTGGGGGATCATCCCGCTCCGGG + Exonic
917853114 1:179082093-179082115 CTGCGGGACCATCCGGCTGCCGG - Exonic
918501445 1:185200845-185200867 CTGGGGGAAGCTGCGGCTGTGGG - Intronic
919804805 1:201375229-201375251 CTGGGGAAGCCTCCACCTGGAGG - Intronic
920386209 1:205571705-205571727 CTGGTGGAGCTTCTGGCTGGGGG - Intronic
921324082 1:213973464-213973486 CTGGGGTGGCCTCTTGCTGCTGG - Intergenic
922554705 1:226523845-226523867 CTGGGGTGGCCTGCGGATGCAGG + Intergenic
922573704 1:226648189-226648211 CTGAGGGAGCCTGCAGCTGGTGG - Intronic
922764218 1:228149204-228149226 ATGGGGCAGCCTGAGGCTGCAGG + Intergenic
924694030 1:246381784-246381806 CTGGAGGAGTCTGAGGCTGCAGG - Intronic
924743203 1:246809670-246809692 CAGGGGGAGCCTCCCGCAGGGGG + Intergenic
1063193252 10:3717683-3717705 CTTGGGGGGCCTCCTCCTGCAGG - Intergenic
1065151987 10:22831482-22831504 CTGGGGGAGCCTCACGGGGCTGG + Intergenic
1067081771 10:43216342-43216364 CTGGGGGAGCCTCCTGGGGAGGG - Intronic
1067794384 10:49310152-49310174 CTGCGGGAGGCTCAGGCAGCTGG - Intronic
1069709410 10:70479122-70479144 CTGGAGCAGCCTCGGGCTGGGGG - Intronic
1070794129 10:79207165-79207187 CTGGGGCAGGCTCATGCTGCAGG + Intronic
1072618033 10:97062702-97062724 CTGGGGGAGCTGCAGGCAGCAGG + Intronic
1074127741 10:110543149-110543171 CTGGGGCATCATCCAGCTGCTGG + Intergenic
1074311061 10:112323770-112323792 CTGGGGCAGCCACCAGCAGCTGG + Intergenic
1075684398 10:124353664-124353686 GTGGGGGGGACTCCTGCTGCAGG - Intergenic
1075909470 10:126111797-126111819 CTGGGGGAGTCGCCGGCTCAGGG + Intronic
1076169245 10:128306122-128306144 CTGCCGAAGCCGCCGGCTGCTGG - Intergenic
1076881236 10:133240173-133240195 CTGCGGGAGCTTCCTGCTGCGGG + Exonic
1076985269 11:231619-231641 CTTGGGAAGCCTCCTGCAGCTGG - Intronic
1078904393 11:15670884-15670906 GTGGGGGAGCCGCAGGCTCCCGG + Intergenic
1079452045 11:20605896-20605918 CAGGGGCAGCCGCCGGCTGCTGG - Intronic
1081115311 11:39192693-39192715 CTTGGGGAGGCTCGGGCTGAGGG + Intergenic
1081530435 11:43954923-43954945 AAGAGGGAGCCTCCAGCTGCCGG + Intergenic
1081629616 11:44680436-44680458 CTGGGGGCAGCTCAGGCTGCAGG - Intergenic
1081855413 11:46300245-46300267 CTCTGGGAGTCTCAGGCTGCAGG - Intronic
1083682332 11:64357366-64357388 CTGGGGGATCCCCCAGCTGAAGG + Exonic
1083998546 11:66283959-66283981 CAGGGGGAGCCTCAGGGTGGGGG - Exonic
1084063961 11:66692920-66692942 CTGGGGGTGGAGCCGGCTGCAGG - Intronic
1084216276 11:67648563-67648585 CTGGGGGAGGCTCCAGCTCAGGG - Intronic
1084451353 11:69240665-69240687 CTGGGGGAGCATGCACCTGCTGG + Intergenic
1084775013 11:71369288-71369310 CTGTGGGAGGCTCCTGCTGTGGG + Intergenic
1085505243 11:77055081-77055103 GTGGGGTAGCCTCCGCCTCCAGG - Intergenic
1087094262 11:94305151-94305173 CTGGGGGAGCCATGGGCTCCTGG + Intergenic
1088635317 11:111814414-111814436 CTGGGGGAGCTCCTGGGTGCTGG + Intronic
1090626779 11:128615139-128615161 CTGGGGCAGCCAGCGGCTTCTGG - Intergenic
1090639529 11:128718431-128718453 CTGGGGGAGCCTCTGAATGTTGG - Intronic
1090665040 11:128909305-128909327 CTGAGGGTGACTCCAGCTGCAGG - Intronic
1090986841 11:131774847-131774869 CTGAGAGAACCTCAGGCTGCTGG + Intronic
1091225862 11:133956315-133956337 CTGCGGGAAACTCTGGCTGCGGG - Intronic
1091452084 12:578815-578837 CTGCTGGGGCCTCTGGCTGCTGG - Intronic
1091452227 12:579994-580016 CTGCTGGGGCCTCTGGCTGCTGG + Intronic
1091798495 12:3310458-3310480 CTGGGAGAGCCCCTGGGTGCGGG - Intergenic
1091843014 12:3633859-3633881 CTGTGGCAGCCTCCTGGTGCAGG - Intronic
1093329597 12:17819176-17819198 CTGGGGAAGCCTCTGACTTCTGG - Intergenic
1093879987 12:24393188-24393210 CTGGGGCAGCCTGGGGCTGATGG + Intergenic
1096134486 12:49188386-49188408 CTGCCGGAGCCCCCGGCAGCGGG - Intronic
1096395468 12:51262872-51262894 CTCGGGGAGCCGCCCTCTGCTGG - Intronic
1096973479 12:55685141-55685163 CTGGGGCAGCCCCCGGCGGGAGG - Exonic
1100110997 12:91242559-91242581 CTGAGGGAATCTCCTGCTGCAGG - Intergenic
1100618048 12:96247035-96247057 CCGGGAGAGCCTTCTGCTGCAGG + Exonic
1101603888 12:106233319-106233341 GTCGGGGAGGCTCGGGCTGCAGG - Intergenic
1101874399 12:108589232-108589254 CTGGGGCCCCCTCCGGCTGGAGG + Intergenic
1102238264 12:111308311-111308333 CTGGGGGAGGCTGCAGGTGCTGG - Exonic
1103850570 12:123930317-123930339 CTGGGTGAGCCTCTGGCCCCGGG + Exonic
1104945800 12:132414431-132414453 CTGGAGGAGCCCCCGGTTGAGGG - Intergenic
1105890720 13:24680715-24680737 CTGGTGGCGCCGCGGGCTGCGGG - Exonic
1107482198 13:40794461-40794483 CTGGGGGAGCCTCAGGCTCTTGG - Intronic
1108506148 13:51114095-51114117 CTGGGGCAGCCACAGGCAGCAGG + Intergenic
1112363792 13:98740334-98740356 CTGGGGGAAGCTCAGGTTGCTGG - Intronic
1113565719 13:111318546-111318568 CTGCGGGAGCCACTGGCTGGGGG - Intronic
1113813851 13:113158589-113158611 CTGGGGGAGGTGCCGGCAGCAGG - Intergenic
1113949037 13:114060936-114060958 CTGTGGGGGGCTCCGTCTGCCGG - Intronic
1113949053 13:114060982-114061004 CTGTGGGGGGCTCCGTCTGCCGG - Intronic
1114549507 14:23524923-23524945 CTGGGGGAGCCTCCGGCTGCAGG - Exonic
1115082014 14:29465127-29465149 GTTGGAGAGCCTCCAGCTGCTGG - Intergenic
1118371851 14:65144302-65144324 CTCGGGGACCCACCGGCTGCAGG + Intergenic
1121537972 14:94704158-94704180 CTGGGTGAGGCTGCTGCTGCTGG + Intergenic
1122024805 14:98867935-98867957 CTGGCATAGCCTCCTGCTGCAGG - Intergenic
1122156889 14:99755290-99755312 CCCGGGGAGCCTGGGGCTGCCGG + Intronic
1122273916 14:100581451-100581473 CTGGAGGGGCTTCCGGCTCCTGG + Intronic
1122287479 14:100660160-100660182 CTAGGGGAGCCTGAGGCTTCGGG + Intergenic
1122346476 14:101064203-101064225 CTGGAGAGGGCTCCGGCTGCAGG - Intergenic
1122881513 14:104692497-104692519 CTGGGGTAGGCTCAGGGTGCTGG + Intronic
1123029757 14:105446147-105446169 GTGGGGGTGCCTCTGGCTCCTGG - Intronic
1124139952 15:27068322-27068344 CTGCAGGAGCCTGCGGCTGGAGG + Intronic
1124192187 15:27589453-27589475 CTGGGGTGGCCTCCTGCGGCCGG + Intergenic
1125518967 15:40337844-40337866 GTGGGGGAGCCCCCGGAGGCGGG - Exonic
1128636803 15:69307779-69307801 CTGGGGGACCCTGTGGCTGTCGG + Intronic
1129755323 15:78094575-78094597 CTGGGGGAGCTGCAGGGTGCTGG + Intronic
1129755328 15:78094594-78094616 CTGGGGGAGCTGCAGGTTGCTGG + Intronic
1129793977 15:78362133-78362155 CTGGGTGAGCCTTCGGCTGACGG + Intergenic
1131672174 15:94631656-94631678 GTGGGGGAGCCCCTGTCTGCTGG - Intergenic
1132883210 16:2171383-2171405 CTGTGGGGGCCTCTGGCAGCAGG - Intronic
1132885566 16:2180654-2180676 CTGCTGGTGCCTGCGGCTGCCGG - Exonic
1133097621 16:3458156-3458178 GTGGGGGAGCCGGCGGCCGCTGG - Intronic
1134066728 16:11233139-11233161 CTGGGGGTGGCAGCGGCTGCCGG + Intergenic
1134093344 16:11403136-11403158 CTCGGGCAGCCTCCTGCTGTGGG - Intronic
1134116627 16:11553534-11553556 CTGCGGGAGCCTGTGCCTGCTGG - Exonic
1135429963 16:22374550-22374572 CTGCGTGAGACTCCGGCTCCAGG - Exonic
1136233871 16:28903066-28903088 CTGGGTGAACATCTGGCTGCTGG + Exonic
1136364979 16:29805838-29805860 CTCGGGGCGACTCGGGCTGCTGG + Intergenic
1136579137 16:31141581-31141603 CTGGAGCAGCCTCCAGCCGCAGG + Exonic
1137811720 16:51359128-51359150 CTGGGCTGGCCTCCTGCTGCTGG + Intergenic
1138350865 16:56345563-56345585 CCTGGGGAGCCTCTGGCAGCCGG + Exonic
1138537503 16:57667726-57667748 GTGGGGGAAGCTCAGGCTGCAGG + Intergenic
1138594047 16:58020024-58020046 CTGGGCGAGGCTGAGGCTGCAGG - Intronic
1139319860 16:66105675-66105697 CTGGCAGAGCCTCCTGCTTCGGG - Intergenic
1140481638 16:75265656-75265678 TTGGGGGAGCCTCCCCCAGCCGG + Intronic
1141443364 16:84043195-84043217 TTGGGGGAGGCGGCGGCTGCTGG + Intergenic
1142214563 16:88824293-88824315 CTGGGGTAGCCTGGGGCGGCAGG + Intronic
1142382157 16:89739073-89739095 CAGAAGGAGCCTCCGGCTGGGGG + Intronic
1142866463 17:2794483-2794505 CTGGGGTGGCTTCAGGCTGCTGG - Intronic
1143497837 17:7322614-7322636 CTGGGGTAGCTGCCGGCTCCAGG - Intronic
1143970200 17:10789831-10789853 CTAGGGGAGGCTGAGGCTGCTGG + Intergenic
1144658671 17:17054446-17054468 CTGGGAGAGGCTCCAGCTACCGG - Intronic
1146176174 17:30667789-30667811 CTCTGGGAACCTCCGCCTGCGGG + Intergenic
1146349632 17:32083900-32083922 CTCTGGGAACCTCCGCCTGCGGG + Intergenic
1147363489 17:39945555-39945577 CTGAGGGAGCCCCCAGCTGAGGG + Intergenic
1148155873 17:45425129-45425151 CTGGGACAGCCTGGGGCTGCAGG + Intronic
1148687838 17:49510479-49510501 CTGGAGGTGCCTCAGGCTCCTGG - Exonic
1149453919 17:56771898-56771920 CTGTGGGAGCCTCCAGCTCAAGG + Intergenic
1149996619 17:61409260-61409282 CTGGGGGGGCCCTTGGCTGCGGG + Exonic
1150636250 17:66915287-66915309 GAGGGGGAGCCTCTGCCTGCTGG + Intergenic
1151233410 17:72701029-72701051 TTGGTGGAGCTTCAGGCTGCAGG - Intronic
1151543881 17:74780105-74780127 CTGAGGGTGCCTCTGCCTGCTGG + Intronic
1152130606 17:78474050-78474072 CTGGGAGAGCCTCCAGTTTCTGG - Intronic
1152188055 17:78870859-78870881 CTGTGCCAGCCTCCGGCTGATGG + Intronic
1152593183 17:81223427-81223449 CTGGGGGAGCCCCGGGCCGCGGG - Intergenic
1152642676 17:81455735-81455757 GCGGGGGCTCCTCCGGCTGCCGG + Intronic
1152642849 17:81456419-81456441 CGGGGGTAGCCTCCTTCTGCTGG - Exonic
1152800322 17:82327912-82327934 CTGGGGGGGCCGCTGGCTGCAGG - Intronic
1153006136 18:500333-500355 CTGGGGGCGCACCCGGCTCCCGG - Intronic
1153933179 18:9896839-9896861 CTGGCAGAGCCTCCGAATGCTGG + Intergenic
1157288334 18:46392658-46392680 CTGGGCCAGCCTCGGGCTGAGGG + Intronic
1157858540 18:51121773-51121795 CTGGGGGAGCCCCCAGCATCAGG + Intergenic
1157863544 18:51162025-51162047 CCGGGGGAGTCTGAGGCTGCAGG + Intergenic
1159782337 18:72674853-72674875 CTGGGGGTGGCTGCGGCTGGAGG - Intergenic
1160039789 18:75335156-75335178 CTGCAGGAGCCTGGGGCTGCTGG - Intergenic
1160835755 19:1123773-1123795 CTGGGGGAGCACCTTGCTGCAGG - Intronic
1160874055 19:1289085-1289107 CTGGAGTCGCATCCGGCTGCAGG + Intronic
1161065535 19:2235708-2235730 CTGCGGGTGCCCCGGGCTGCGGG + Intronic
1161066985 19:2243496-2243518 CAGGGAGCGCCTCCGGCAGCTGG + Exonic
1161237352 19:3204551-3204573 CTAATGGCGCCTCCGGCTGCAGG + Exonic
1161967363 19:7555838-7555860 ATGGGGGAGCCTCCGGGGTCAGG + Intronic
1162349518 19:10140165-10140187 CTGGGGCAGCCGCTGGCCGCGGG + Exonic
1162453515 19:10768732-10768754 CTGGGGAAGCCTGTGGCAGCCGG + Intronic
1162481469 19:10929189-10929211 GTCGGGGACCCTCCTGCTGCTGG + Exonic
1162828193 19:13267314-13267336 TTGGGGGAGCCTCAGGCTCATGG + Intronic
1162917477 19:13882116-13882138 CTGGGCGATCATCCAGCTGCAGG - Intergenic
1163371250 19:16902553-16902575 CAGGAGGAGCTTCCGGCTCCAGG - Intronic
1164634493 19:29782274-29782296 CCTGGGGAGCCACAGGCTGCAGG - Intergenic
1165817003 19:38648403-38648425 TTGGGGGAGCCTCAGGTTGGGGG + Intronic
1166830999 19:45639491-45639513 CGGTGGGACCCTCCGGCTCCAGG - Intronic
1167115657 19:47487802-47487824 CTGGGGGAGGCTCCCGGGGCTGG + Exonic
1167435541 19:49476431-49476453 CTGCGGGGGCCTCTGGCGGCTGG + Exonic
1167492577 19:49801059-49801081 GTGAGGGAGCCTCAGCCTGCAGG + Intronic
1168263630 19:55209382-55209404 CTGGGGGAACCTGGTGCTGCTGG - Exonic
925161128 2:1685197-1685219 TTTGGGGGCCCTCCGGCTGCAGG - Intronic
925927163 2:8678794-8678816 CTGGGCGAGCCTGGGACTGCCGG + Intergenic
926094392 2:10071752-10071774 CTGGAGGAGCCCCTGTCTGCAGG - Intronic
926593106 2:14760371-14760393 CTGGGGTCGCCTCAGGCTCCCGG - Intergenic
927207098 2:20617605-20617627 CTGAGGGAGCCCCCGGCTGATGG - Intronic
927911082 2:26900171-26900193 CTGGAGGAGCTTCTGGGTGCTGG - Intronic
928919599 2:36512893-36512915 CTGGAGAAGCCTCAGGCAGCAGG - Intronic
930030521 2:47055772-47055794 CTGGGGTGGCCTCCAACTGCGGG - Intronic
931263440 2:60639457-60639479 GTGGTGGAGCCACTGGCTGCAGG - Intergenic
932735844 2:74254054-74254076 CTGGCGGTGCTTGCGGCTGCAGG - Intronic
932754863 2:74400272-74400294 CTTGGGGTGACTCCAGCTGCAGG + Intergenic
933698737 2:85239211-85239233 CAGGGGGAGCCTCAGCCTGGCGG - Intronic
935301673 2:101698184-101698206 CTGGGCGCGGCCCCGGCTGCCGG - Intronic
936163862 2:110103672-110103694 CTGAAGGAGCCACCGGCTGCTGG - Intronic
937265242 2:120611250-120611272 CTGGGGCAGCCTCCAGCAACTGG - Intergenic
937306328 2:120873730-120873752 CTCGGGGAGCCTGTGGTTGCTGG - Intronic
938102048 2:128504116-128504138 CTGGGAGAGCCTCCGGACTCAGG - Intergenic
938760198 2:134418438-134418460 CTGGGGGAGCCTAGGACTGATGG - Intronic
941819246 2:169828004-169828026 CCGGGGGCGCCTGCGACTGCGGG + Exonic
942444960 2:176071715-176071737 CTCCCGGAGCCACCGGCTGCTGG + Intergenic
946286919 2:218710944-218710966 CTAGGGGCGCCTGAGGCTGCCGG + Exonic
947014086 2:225598878-225598900 CTGGAGAAGCCTCATGCTGCAGG - Intronic
947592881 2:231395441-231395463 CTGGCGGAGCCTCCCGGGGCGGG - Intergenic
947669112 2:231925666-231925688 CTGGCCGAGCCGCAGGCTGCGGG - Exonic
947841158 2:233208718-233208740 CTGGGGAACCCACTGGCTGCTGG + Intergenic
1168921120 20:1537164-1537186 CTGCTGCTGCCTCCGGCTGCTGG - Exonic
1168956682 20:1838968-1838990 CTGGAGGAGCCTGGGGCAGCAGG + Intergenic
1172930587 20:38583669-38583691 CTGGAGGAGACTCATGCTGCAGG - Intronic
1173250622 20:41362510-41362532 CTGGTGCAGCCTCCGGCTGGCGG + Exonic
1173422997 20:42919153-42919175 CTGGGGGATCCCCAGGCTGGAGG - Intronic
1173561933 20:44012378-44012400 CTGGGAGAGCCTCGGGCAGATGG + Intronic
1173710688 20:45153136-45153158 CTGAGGGAGCCTCTGGATCCAGG + Intergenic
1173973929 20:47173142-47173164 CTGTGAGAGCCTCTGGCTGTGGG - Intronic
1175946491 20:62561355-62561377 CTGGGGACGGCTGCGGCTGCAGG + Intronic
1176255048 20:64147297-64147319 CTGAGGGAGGCTGCGGCTGGTGG - Intergenic
1176973329 21:15290339-15290361 CTGGGGGGGCCTGAGGCAGCAGG + Intergenic
1178351154 21:31873702-31873724 CTGGGGGAGCCGGCGGCGCCTGG + Exonic
1179548171 21:42125899-42125921 CAGAGGGAGCTGCCGGCTGCAGG - Intronic
1179552657 21:42153392-42153414 CTGGGGGTGGCCCCAGCTGCAGG + Intergenic
1180136524 21:45865865-45865887 CTTTGGGAGGCTCCGGCTGTGGG - Intronic
1180196072 21:46195048-46195070 CTGGGAGAGAGTCCGGCGGCTGG + Intronic
1181513241 22:23398078-23398100 CTGGGGGAGTCTTCAGCTGAGGG + Intergenic
1181574088 22:23783027-23783049 CTAGGGTAGCCTCCAGCTCCAGG + Intronic
1182422638 22:30256052-30256074 CTAGGGGAGGCCCCGGCTGCAGG - Intergenic
1183335724 22:37244834-37244856 CTGGGGGAGCCTCTGGGTCCTGG - Intergenic
1183344714 22:37300913-37300935 CCTGTGGAGCTTCCGGCTGCCGG + Exonic
1183732175 22:39624622-39624644 CTGCGGGAGCCGCAGGCTGTTGG + Intronic
1184403119 22:44285519-44285541 CTGGGGGAGGCTGCGGCTGTGGG + Exonic
1184480010 22:44740883-44740905 CTGGGAGGGCCTTCGGCTGCAGG - Intronic
1184654795 22:45935604-45935626 CTGGGTGCCCCTCAGGCTGCAGG + Intronic
1185042689 22:48513549-48513571 CTTGGGAAGCCTCCGGGTCCTGG - Intronic
1185139805 22:49093871-49093893 CTGTGGGAGCCGCTGCCTGCGGG - Intergenic
1185150265 22:49160316-49160338 CTGGTGCAGCCTCTGCCTGCGGG - Intergenic
953032500 3:39187684-39187706 TTGGGGGTGCCTCAGGCTGGGGG + Exonic
953872732 3:46641512-46641534 CTAGGGCAGCCTCCTGCTGCTGG - Intergenic
954630976 3:52047481-52047503 CTGGGGAAGCCCGCGGGTGCTGG - Intergenic
956966375 3:74465880-74465902 CTGGGGCAGCCTCCACCTCCTGG - Intronic
961037320 3:123651669-123651691 CAGGGAAAGCCTCCTGCTGCCGG - Intronic
961415879 3:126756361-126756383 CCTGGGGAGCCACAGGCTGCTGG + Intronic
961666558 3:128496600-128496622 CTCGGGCAGCCTCCGGGAGCCGG - Intergenic
962273626 3:133996196-133996218 CTGGGGGAACCTCTGCCTGGGGG + Intronic
962301802 3:134250358-134250380 CTGGGGCAGCTTCCGGCCGCCGG - Intronic
963043722 3:141087498-141087520 CTGGGGGAGCCCCCAGTTGTAGG + Intronic
965661039 3:171042252-171042274 CTGGGAGAGCCTGCTGATGCTGG + Intergenic
968360137 3:198140903-198140925 CTGGGGGAGTGTCTGTCTGCCGG + Intergenic
968508903 4:986913-986935 CTCGGGGAGCCTCGGGGAGCCGG - Intronic
968593661 4:1471877-1471899 TTGGGGGAGCCGCCGGGGGCGGG + Intergenic
968720393 4:2198294-2198316 CTGTGGGAGCAGCCGGCTCCAGG - Intronic
969269906 4:6092424-6092446 GGAGGGGAGCCTGCGGCTGCAGG - Intronic
972686932 4:41360879-41360901 CGGGGGGCGGCTCGGGCTGCAGG - Exonic
978327793 4:107579050-107579072 CAGTGGGAGCCTCCAACTGCAGG - Intergenic
981713658 4:147732502-147732524 CTGGGGGAGCCTCTCTCGGCAGG + Intronic
982647020 4:158037156-158037178 GTGGGGGTGACTCAGGCTGCTGG - Intergenic
982680172 4:158419177-158419199 CTGGGTGAGCCTGTGACTGCCGG - Intronic
985111819 4:186554656-186554678 TTGGAGGAGCCGCCGCCTGCCGG + Intronic
986051499 5:4094468-4094490 CGAGGGGAGGCTCCGGATGCTGG + Intergenic
986125372 5:4879022-4879044 GTGGGGCAGCTTCCAGCTGCGGG - Intergenic
986552508 5:8974210-8974232 CTGGGAGAGCCCCAGGCTCCTGG + Intergenic
998765181 5:145478437-145478459 CTGGGGGATCCTCCTGAGGCAGG + Intronic
999369435 5:151044985-151045007 CTGTGGCAGGCTTCGGCTGCTGG + Intronic
1001871772 5:175162360-175162382 CTGGGGGACCCTCCTGCAACAGG + Intergenic
1003028304 6:2578540-2578562 CTGGGGCTGCCTCCAGCTTCAGG + Intergenic
1003096893 6:3149368-3149390 CTAGAGGACCCTCGGGCTGCTGG - Intronic
1003564901 6:7214594-7214616 CTGGGGCAGCCTGCGCCAGCGGG + Intronic
1005000392 6:21234143-21234165 CATGGGGAGCCTCCTGGTGCTGG - Intergenic
1006060032 6:31412662-31412684 CTGTGGCATCCTCCTGCTGCAGG + Intronic
1006798575 6:36745601-36745623 CTGGGGGAGCCCAGGCCTGCTGG - Intronic
1007431411 6:41779568-41779590 TTGGGGGAGCCAGAGGCTGCAGG + Intronic
1007787707 6:44290733-44290755 CAGGGGGAGCCCCAGGTTGCTGG + Intronic
1015834074 6:137400375-137400397 GTGTGGGAGCCTCGAGCTGCAGG - Intergenic
1017325134 6:153133923-153133945 GTCGGGGAGGCTCCGGCCGCAGG - Intergenic
1017962490 6:159233842-159233864 CTGTGGGAGACTCCACCTGCTGG - Exonic
1018826806 6:167414232-167414254 CTGGGGGAGCCTGTTGCTCCCGG - Intergenic
1019115221 6:169755299-169755321 CTGGGGAAGCGTGAGGCTGCTGG + Exonic
1019147893 6:169986580-169986602 CTGGGGGTTCCTTCAGCTGCAGG + Intergenic
1019259860 7:75728-75750 CTGGGGGAGTGTCTGTCTGCCGG - Intergenic
1019274374 7:168163-168185 GTGGGGGAGCTCCAGGCTGCCGG + Intergenic
1019322976 7:424032-424054 CTGGGGGAACGTGCGGCTTCAGG - Intergenic
1019478338 7:1254856-1254878 CTGCAGAAGCCTCTGGCTGCAGG - Intergenic
1019481699 7:1269941-1269963 CTGGGGCAGCCTCGGCCGGCCGG - Intergenic
1019625002 7:2011498-2011520 CTGGGGGTGCCGCCAGCTCCTGG - Intronic
1019643049 7:2115081-2115103 CTGGGGGAGCCTTGGGTCGCGGG - Intronic
1019712798 7:2525080-2525102 GTGGGGGAGGCTACGGCCGCCGG + Intronic
1019800500 7:3084767-3084789 CTGCAGGAGAGTCCGGCTGCTGG + Intergenic
1020577144 7:9947488-9947510 CTGGGAGAGACTCCTTCTGCTGG + Intergenic
1021331072 7:19339772-19339794 CTGGGGCAGCCTCCAGTAGCTGG - Intergenic
1021340258 7:19455857-19455879 CTGGGTGAGCCTGTGGCTACCGG - Intergenic
1022138950 7:27475615-27475637 CTGGGGGAGCCCCACGATGCTGG + Intergenic
1025004224 7:55342714-55342736 CGTGGGGGACCTCCGGCTGCTGG + Intergenic
1029432260 7:100539111-100539133 CTGGGACGGCCTCCGGTTGCTGG - Intergenic
1029546195 7:101211806-101211828 TTGGGGTGCCCTCCGGCTGCGGG + Intronic
1029575732 7:101402131-101402153 GCGGGGGTGCCACCGGCTGCCGG + Intronic
1032076216 7:128837334-128837356 CAGGGGGAGACTGGGGCTGCTGG + Intronic
1032784339 7:135188604-135188626 GTGAGGGGGCCTCCTGCTGCAGG - Intronic
1034229190 7:149508007-149508029 CTGTGGGAGCCTCAGGATTCAGG + Intergenic
1034270324 7:149800533-149800555 CTGGGGGAGGCTTGGGCAGCAGG + Intergenic
1034393275 7:150801691-150801713 CAGGGGCAGCAGCCGGCTGCTGG + Exonic
1034427089 7:151019652-151019674 CTGGGGACGCCTCCAGGTGCTGG + Intronic
1036824204 8:11963718-11963740 CTGGGGAGGGCTCCGGATGCAGG + Intergenic
1037901360 8:22691284-22691306 TTGGGGGTGCCCCCGGCTTCAGG - Exonic
1042190037 8:66177288-66177310 CCGGCCGAGCCTGCGGCTGCTGG + Exonic
1043346770 8:79307159-79307181 CTGGGGCAGCCTCAGGCTGGCGG + Intergenic
1045338831 8:101233620-101233642 CTGTGGGAGCCTTGAGCTGCTGG - Intergenic
1047181043 8:122588420-122588442 CTGGGGGGGCCTCAGGCTTCAGG - Intergenic
1047411537 8:124628412-124628434 CTGGGCAAGCATCCTGCTGCCGG - Intronic
1049218340 8:141417817-141417839 GTGTGGGAGCCCCCGGCAGCCGG + Intronic
1049399512 8:142418697-142418719 GTGGGGGAGCCTGGGGCTGAGGG - Intergenic
1049688657 8:143949368-143949390 GTGTGTGAGCCTCGGGCTGCAGG + Intronic
1050723043 9:8612722-8612744 CTGGGGGACCCTGAGGCTGGTGG + Intronic
1053022192 9:34702332-34702354 CTGTGTGAGCCTCCGCCTGCTGG - Intergenic
1057733704 9:97633620-97633642 CTCGGGCTGCCTCCGCCTGCCGG - Exonic
1060407867 9:123381719-123381741 CTGGGGGACCCAGCGGCTGTAGG + Exonic
1062309258 9:135927160-135927182 CTGGAGGAGCCTGTGGCTGCAGG - Intergenic
1062363369 9:136197807-136197829 CCAGGGGTGCCTCCGCCTGCAGG - Intronic
1062489813 9:136799647-136799669 CTGGAGGAGCCAGCGGCTGCGGG + Intronic
1062744840 9:138204731-138204753 CTGGGGGAGTGTCTGTCTGCCGG + Intergenic
1190735006 X:53250393-53250415 CTAAGGGAGCCTCCGGCTACCGG - Exonic
1191690552 X:63933902-63933924 CTGGGGCATCCTGCGGCTCCTGG + Intergenic
1199894021 X:152115371-152115393 CTGGGGGAGGTGCCTGCTGCTGG - Intergenic
1199942357 X:152638435-152638457 CTGGGGGCGACTCGGGCTGGGGG + Intronic
1200047496 X:153410544-153410566 CTCAGGGAACCTCCGGTTGCAGG - Intergenic
1200089188 X:153626422-153626444 CTCAGGGAACCTCCGGCTGCAGG + Intergenic
1200244788 X:154517187-154517209 CTGGGGTGGTCTCCGGCCGCAGG + Intergenic