ID: 1114552138

View in Genome Browser
Species Human (GRCh38)
Location 14:23538800-23538822
Sequence AGGGCTGGGGGCCTCTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 614
Summary {0: 1, 1: 0, 2: 7, 3: 64, 4: 542}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114552134_1114552138 -9 Left 1114552134 14:23538786-23538808 CCTGGGTAGAGGCAAGGGCTGGG 0: 1
1: 0
2: 5
3: 47
4: 536
Right 1114552138 14:23538800-23538822 AGGGCTGGGGGCCTCTGTGAAGG 0: 1
1: 0
2: 7
3: 64
4: 542

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114552138 Original CRISPR AGGGCTGGGGGCCTCTGTGA AGG Intronic
900408228 1:2501721-2501743 GGGGCTGCGGGCCTCTGAGCAGG + Intronic
900513867 1:3072307-3072329 ACAGCTGGGGGCCTCTGTGCAGG + Intronic
900557962 1:3289525-3289547 AGGGCTGGGGGCTTGGGTGAAGG + Intronic
900610061 1:3540924-3540946 AGGGCTGGGCGCTTCTGGCATGG + Intronic
901082529 1:6591678-6591700 AGGGCAGGGGGGCTCCCTGAGGG + Exonic
901746658 1:11378245-11378267 AGGGATGGGGGCCTCATTGCTGG - Intergenic
901832180 1:11899166-11899188 AGAGCTGGGGGGCTCTGTGCCGG - Intergenic
902862086 1:19253771-19253793 AGGCCTGGGTCCCTTTGTGAAGG + Intronic
903053447 1:20618643-20618665 AGGGCTGGGGCCCACTGGGCAGG - Exonic
903385765 1:22925158-22925180 AGGGCTGGGGGGCTGAGGGAAGG - Intergenic
903669687 1:25028117-25028139 AGGTCTGGGGGCCCTTCTGAAGG + Intergenic
904306709 1:29594667-29594689 AGCCCTGGGGGCCTCTGAGGGGG + Intergenic
904377029 1:30088136-30088158 CAGGCTTGGGGCCTCTGTGATGG + Intergenic
904486039 1:30825012-30825034 GGGGGTGGGGGGCTTTGTGAGGG - Intergenic
904873478 1:33636092-33636114 ATGTCTGGGGGCCTCTGTTGAGG + Intronic
905009412 1:34737048-34737070 AGTGCTGGTGGCCTCTGTTGGGG - Intronic
905339234 1:37266879-37266901 AGGGGTGGGTGCCTGTGTGGGGG - Intergenic
905435897 1:37954947-37954969 TGTGCTGGAGGGCTCTGTGAAGG - Intergenic
906099927 1:43253695-43253717 ATGGGTGGGGGCCTCTGTGCAGG + Intronic
906164217 1:43673778-43673800 ATGGCCCGGGGCCTCTGCGAAGG - Intronic
906332391 1:44897585-44897607 AGGGCTGGGGTCCACTGTCCTGG - Intronic
906524646 1:46487197-46487219 AGGTCTGTGTGTCTCTGTGAAGG + Intergenic
907310153 1:53534478-53534500 AGGGCTGAGTGCCTCTATGTGGG + Intronic
907310244 1:53534935-53534957 AGGGCTGAGCTCCTCTGTGAAGG - Intronic
907718083 1:56946347-56946369 AGGGCATGGGACCTCTCTGATGG + Intronic
909696716 1:78475576-78475598 AGGGCTGGGGGCCTAGGGGAGGG + Intronic
911093731 1:94038771-94038793 AGGGCTTTGGGCATCTGGGAGGG + Intronic
912302637 1:108533886-108533908 AGGGCTGGCGGCCTTTGTGGTGG + Intergenic
912421199 1:109543490-109543512 GGGGCTGGTGGCCTCTGTGCTGG + Exonic
912841725 1:113044975-113044997 AAGACTGGGGACCTGTGTGATGG + Intergenic
913319151 1:117576487-117576509 AGGGATGGGGGCTGCTATGATGG - Intergenic
913474953 1:119228130-119228152 AGGACCGGGGGCCTCAGCGAAGG - Intergenic
913971344 1:143420472-143420494 AGGGCTGGGGGACCATGGGATGG + Intergenic
914065721 1:144246085-144246107 AGGGCTGGGGGACCATGGGATGG + Intergenic
914113430 1:144720269-144720291 AGGGCTGGGGGACCATGGGATGG - Intergenic
914815797 1:151061083-151061105 AAAGGTGGGGGCCTCTGTGTTGG + Intronic
915651213 1:157312230-157312252 AGGGCTGGTTTCCTCTCTGAAGG - Intergenic
915660143 1:157398862-157398884 AGGGCTGGTTTCCTCTCTGAAGG + Intergenic
916491141 1:165303635-165303657 AGGGCTGGTGGTCTGAGTGAAGG - Intronic
917795630 1:178530822-178530844 GGGACTGGGGGCCACTGAGAAGG - Intronic
917930227 1:179817761-179817783 AGGGCTGGAGGCCTGGGTGCTGG - Intergenic
919423362 1:197399715-197399737 AGGGCTGGGGTCTCCTCTGATGG + Intronic
919937674 1:202265336-202265358 AGGGCTTGTGTGCTCTGTGAGGG + Intronic
920505670 1:206513630-206513652 AGGGCTGGCGGCAGCTGGGAAGG + Intronic
922206716 1:223454691-223454713 AGGGCTGAGGAACTCTGTAACGG - Intergenic
922696999 1:227735746-227735768 AGAGCTGGGGGGCCCTGGGATGG + Intronic
922720356 1:227897060-227897082 AGTGCTGGGGGACTCTGGGTGGG - Intergenic
922811104 1:228416254-228416276 TGGGCTGGGTGCCTCCGTTAGGG - Intronic
922885639 1:229018479-229018501 AGGCCTGGCTGTCTCTGTGATGG - Intergenic
923559126 1:235025158-235025180 AGGGCAGGAGGCCTGTGGGAAGG + Intergenic
923667054 1:236007731-236007753 GGGGCTGTGGTCTTCTGTGATGG - Intronic
1063415574 10:5870253-5870275 TGCACTGGGGGCCTCCGTGAAGG - Intronic
1063734970 10:8742424-8742446 GGGGCTGGGGGCCTGGGGGAGGG + Intergenic
1063964413 10:11335535-11335557 GGGGCTGGCCGCCTCAGTGATGG + Exonic
1064615201 10:17146356-17146378 ATGGCCAGGGTCCTCTGTGAAGG + Intronic
1064762311 10:18633904-18633926 AGAGCCGAGGGTCTCTGTGAAGG - Intronic
1065178919 10:23105673-23105695 AGGGCTGGGGTCCACTCTGTGGG - Intronic
1065836016 10:29659219-29659241 AGGGCTGGAGCCTTCTGTGTTGG - Intronic
1066148217 10:32585516-32585538 AGGGGTGGGGGCCTAGGAGAGGG - Intronic
1066256105 10:33680187-33680209 AGTGCTAGGGCCCCCTGTGATGG - Intergenic
1066484295 10:35828526-35828548 AGGGCTGGGGGGCTCTTGGTGGG + Intergenic
1066649428 10:37640494-37640516 TGGGCCAGGGGCCTGTGTGAGGG + Intergenic
1067106508 10:43370620-43370642 AGGGATGGGGGTCTCTGGGCTGG - Intergenic
1067249282 10:44573797-44573819 AGTGCTGGGGTGCTCTGAGAGGG - Intergenic
1068045655 10:51882966-51882988 ATGTCTGGGTGCATCTGTGAGGG + Intronic
1068579243 10:58720551-58720573 AGGGCTGGGGCATTCTGTGTGGG + Intronic
1069657850 10:70103260-70103282 AGGACTGGGGGCCTGGGTGTGGG + Intronic
1069799947 10:71075872-71075894 ATGTCTGCCGGCCTCTGTGACGG + Intergenic
1069905084 10:71727452-71727474 AGAGCTGGGGGCCTTCCTGAAGG + Intronic
1070516624 10:77214050-77214072 AGGGCTGAGGGCTTCTGTTATGG - Intronic
1070744685 10:78926596-78926618 TGGGATGGTGGCCTCTTTGATGG + Intergenic
1070832893 10:79431159-79431181 TGAGCTGGGGGCCCCTGTGCTGG + Intronic
1071273052 10:84026640-84026662 AGGCCTGTGTGCTTCTGTGATGG - Intergenic
1073139396 10:101237405-101237427 AGGGCTGGTGGCCTCCCTGGAGG - Intergenic
1073321262 10:102617557-102617579 AGGGCCTGGGGCCTGTGTGTAGG + Intronic
1074849787 10:117430539-117430561 AGGGGTGGGGGCCTAGGGGAGGG - Intergenic
1075222351 10:120596167-120596189 AGAGGTGGGGGCCTTTGGGAGGG - Intergenic
1075327158 10:121543153-121543175 TGGGGTGGGTGCCTCTGTGAAGG - Intronic
1075742996 10:124707043-124707065 TGGGCGGGGGGACTCTGAGAAGG - Intronic
1076097679 10:127745168-127745190 AGGTCTGGGGGCCTCCGTGCAGG - Intergenic
1076206970 10:128611329-128611351 AGAGCTGGGGGCTTCGGGGATGG + Intergenic
1076409641 10:130236810-130236832 AGGGCTGGGTGCTTTTGGGATGG + Intergenic
1076507358 10:130986965-130986987 AGGGCAGGAGGCATCTGTGAAGG + Intergenic
1076694778 10:132242225-132242247 GGGGCTGGTGTCCTCTGAGAGGG + Intronic
1077023718 11:430692-430714 GGGCGTGGGGGCATCTGTGAGGG + Intronic
1077116384 11:886760-886782 TGAGCTGGGGGGCTCTGTGTGGG - Intronic
1077241828 11:1514683-1514705 GTGGTTGGGGGCCTCTGGGAAGG - Intergenic
1077310408 11:1886445-1886467 AGGGCTGGGGGACCATGGGATGG - Intronic
1077339079 11:2018044-2018066 TGGGCGGGGGAGCTCTGTGAAGG + Intergenic
1078542715 11:12224528-12224550 AGGGCAGGGGGCCACTGGCACGG - Intronic
1081713679 11:45233917-45233939 GGGCCACGGGGCCTCTGTGAGGG - Intronic
1081715845 11:45249748-45249770 AGGGGTGGGGGCCTGGGGGAGGG + Intronic
1083290959 11:61689905-61689927 AGGGCTGAGGGGCTTTGTGCGGG - Intronic
1083633054 11:64105562-64105584 AGGGCTGGGTGCCTGAGTGTTGG - Intronic
1083634243 11:64111604-64111626 AGGGCTGTGGACCTGTGTGTAGG + Intronic
1083773272 11:64879870-64879892 AGGGCTAGGGGCCTGTATCAGGG + Intronic
1084178373 11:67434928-67434950 AGTGCTGGGAGCCTCTGGCAGGG + Intronic
1084599040 11:70133957-70133979 AGAGCTGGCGGCCTCTGTCCCGG - Intronic
1084648749 11:70475753-70475775 AGGGCTGGGTGCCCCTGAGTGGG + Intronic
1084890766 11:72235866-72235888 CGGGCAGGAGGCCTCTGTGAAGG - Exonic
1084986315 11:72875943-72875965 AGGGCTGGGCTCAGCTGTGATGG - Intronic
1085082980 11:73648946-73648968 AGGGCTGGGGGCTTCTCTCCAGG + Intronic
1085259840 11:75198173-75198195 AGGCCTGGGGGTCTCTGGAAGGG - Intronic
1085515911 11:77111936-77111958 AGGGGTGGGGGCTGCTGTGGGGG + Intronic
1085527787 11:77174128-77174150 GAGGCTGTGGGGCTCTGTGAGGG - Intronic
1085703304 11:78764084-78764106 AAGGCTGTGGGCCTGTCTGATGG + Intronic
1087699899 11:101423967-101423989 AGGATTGTGGGCCTCTGTGGTGG + Intergenic
1089382712 11:118047572-118047594 AGGTCTGGGATCCTCTGAGATGG - Intergenic
1089433058 11:118437883-118437905 GGGGAAGGGGGCCCCTGTGAGGG + Intronic
1090459440 11:126877069-126877091 AGGGCTGGGGACCTCTTGCAGGG + Intronic
1090532718 11:127607838-127607860 AGGGCAGGGGGAACCTGTGAAGG - Intergenic
1090726289 11:129530247-129530269 TGGGATGGTGGCCTCTGTGAGGG - Intergenic
1202822063 11_KI270721v1_random:73226-73248 TGGGCGGGGGAGCTCTGTGAAGG + Intergenic
1091545891 12:1501051-1501073 AGGCCCAGAGGCCTCTGTGAGGG - Intergenic
1091714243 12:2765769-2765791 AGGGCTGGGGGAATCTGTCAGGG - Intergenic
1093521723 12:20058917-20058939 GGGGGTGGGGGCCTCGGGGAGGG - Intergenic
1095944263 12:47745216-47745238 AGGGCTGGAGGCACCTGGGAGGG - Intronic
1098460622 12:70729567-70729589 AGAGCTGGGGGCCTCTCAAAAGG - Intronic
1100177843 12:92051110-92051132 GGGGTTGGGGACCCCTGTGATGG + Intronic
1101196659 12:102390331-102390353 AGGGCTGGGGGGCTGGGGGAGGG + Intergenic
1101655514 12:106716657-106716679 TGGGCTTGGGGCAGCTGTGAAGG - Intronic
1102020459 12:109678741-109678763 GGGGCTGGCAGCCACTGTGAAGG - Intergenic
1102584251 12:113912122-113912144 AAGGCTGGTGGCCTCCGGGAAGG + Intronic
1103008643 12:117440698-117440720 AGGGTTGGGGGCCTTTGGCAAGG - Intronic
1103054781 12:117810061-117810083 AGGGCTGGGGGCCTCAGCAAAGG - Intronic
1103482794 12:121261714-121261736 AGGGCTGGAAGCCTCTGTTTGGG - Intronic
1104264623 12:127219983-127220005 AGGACGGGGAGCCTCTGTGTCGG - Intergenic
1105938928 13:25129539-25129561 AGGGCTGTGAGGCGCTGTGAGGG + Intergenic
1106339454 13:28815176-28815198 AGGGGTCAGGGCCTCTGGGAAGG - Intergenic
1106480902 13:30136113-30136135 AGGGTTGGCGGCCTCTGGGGTGG - Intergenic
1106642284 13:31597147-31597169 AGGGCTTGTGATCTCTGTGAAGG + Intergenic
1108706509 13:52993354-52993376 AAGCCTGGGAGCCTCTCTGAGGG + Intergenic
1109188476 13:59297686-59297708 AGGGCTGGGGGGCTAGGGGAGGG + Intergenic
1110806833 13:79764832-79764854 AAGGCTGGTGGCCACTGTGTTGG + Intergenic
1112076018 13:95914097-95914119 AGGGATGGGGGCCTGAGGGAGGG + Intronic
1114514020 14:23285975-23285997 AGGGCAGGGGGCCTCCGAGTGGG + Exonic
1114552138 14:23538800-23538822 AGGGCTGGGGGCCTCTGTGAAGG + Intronic
1115852717 14:37600063-37600085 AGGGCTAGGGGCCTAGGGGAGGG + Intronic
1116417742 14:44698937-44698959 GGGGCTGGGGGCCTAGGGGAGGG + Intergenic
1117162724 14:53005215-53005237 AGGGATGGGGGTCTCTGATACGG + Intergenic
1118215053 14:63800934-63800956 AGGTTTGGGGGTCCCTGTGAAGG - Intergenic
1118323846 14:64768686-64768708 GGGGCTGGGGGCCTGGGGGAGGG - Intronic
1118495091 14:66300457-66300479 AGGGGTGGGGGCCTGGGGGAGGG + Intergenic
1118771721 14:68946772-68946794 AGGGCTGAGGGCCTCCATGATGG - Intronic
1118988845 14:70779984-70780006 AGGCCTGGGTGCCTGTCTGAAGG - Intronic
1119325128 14:73755302-73755324 GGGGCTGGGGGTCTCCCTGAGGG - Intronic
1119793549 14:77376401-77376423 AGGCCAGGGGGCCTATGTGCAGG + Intronic
1119865257 14:77967862-77967884 GGTGCTGTGGGCCTGTGTGATGG - Intergenic
1122112852 14:99514119-99514141 AGGGCAGGGGTCCTCACTGAGGG - Exonic
1122598446 14:102909055-102909077 AGGGTTGGGTGGCTCAGTGAGGG + Exonic
1122983479 14:105201875-105201897 AGTCCTGGGGGCATCAGTGATGG + Intergenic
1123117108 14:105899757-105899779 AGAGCAGGGTGCCTCTGGGAGGG - Intergenic
1124890371 15:33726577-33726599 GGGCCTGGGGGCCACTGTGCTGG - Intronic
1125227671 15:37413190-37413212 AGCCCTGGGGGCTTCTGGGATGG + Intergenic
1125233488 15:37484336-37484358 ATGCCTCTGGGCCTCTGTGATGG + Intergenic
1125293201 15:38172772-38172794 TGGGCTGAGCCCCTCTGTGATGG + Intergenic
1128225406 15:65998027-65998049 AGGGGTGGGGGGCACTGTGAGGG + Intronic
1128323383 15:66707523-66707545 AGGGCTAGGGGCCGCTGAGCCGG - Intronic
1128497403 15:68206317-68206339 TGGGCTGGGGGCCTTTGTGTAGG - Intronic
1128555639 15:68629958-68629980 AGGGCAGGGTGCCTCTGGCAGGG - Intronic
1129165572 15:73775352-73775374 AGGGCCCAGGGCCTCAGTGATGG - Intergenic
1129243912 15:74268464-74268486 AGGGCTGGGGCCCTCTGGGGTGG + Intronic
1129460125 15:75696330-75696352 AGGTCTGGGGGCCCGTGGGAGGG + Intronic
1129676932 15:77636781-77636803 AGGGCTGTGGGTCTCTGTGGTGG - Intronic
1131979562 15:97981618-97981640 CGAGCTAGGGGCCTCTCTGAGGG - Intergenic
1132181259 15:99754412-99754434 AGAGCTGGGGGGATCTGTGTAGG - Intergenic
1132404242 15:101532817-101532839 CAGGCTGGGGGCCTGTGTCACGG - Intergenic
1132570086 16:640776-640798 TGTGCTGGGGGCGTCTGTGCTGG - Intronic
1132570090 16:640791-640813 TGTGCTGGGGGACTCTGTGCTGG - Intronic
1132640493 16:976153-976175 GGGGCTGAGGTCCTCTGAGAAGG - Intronic
1132807207 16:1780350-1780372 AGGGGTGGGGGTCCCTGTGGGGG - Intronic
1132891756 16:2208171-2208193 AGGCCTTGGGCCCTCCGTGACGG + Intronic
1132905139 16:2278624-2278646 AGGGCTGGAGGCCCCAGAGAAGG + Intronic
1134453682 16:14378945-14378967 AGGGCTGGGGGACTCCGCGTGGG - Intergenic
1134629234 16:15745085-15745107 AGGGCTGGGGGCCCCTGGGAAGG + Intronic
1135424956 16:22327917-22327939 AGGGGAGGGGGCATCTGGGATGG - Intronic
1135580226 16:23619281-23619303 ATGGCTGGGGACTCCTGTGATGG + Intronic
1135846170 16:25920585-25920607 AGGGGTGGGGGCGGCAGTGAGGG - Intronic
1136997450 16:35200552-35200574 AGGGCTGAGGGCTTCTGGGTGGG + Intergenic
1137323653 16:47411517-47411539 AGGGCAGGGGACCTCTGGGCAGG - Intronic
1137816263 16:51400706-51400728 AGTGCTGGGGGCCTCTCTTTAGG - Intergenic
1138125256 16:54433225-54433247 AGGGCTGAGGTCTTCTGTGCAGG - Intergenic
1138465436 16:57186515-57186537 AGGGTTGGGGACGTCTGTGAGGG + Exonic
1139357773 16:66377480-66377502 AGGGCTGAGGGTGTCTGTGCTGG - Intronic
1139661467 16:68423934-68423956 AGGTCTGGAGGCCTCAGTGGCGG + Intronic
1141110659 16:81268292-81268314 AGGCCTGGGGGCCATTCTGAAGG - Intronic
1141119920 16:81345595-81345617 AGGGGTGGGGGCCTAGGGGAGGG + Intronic
1141689604 16:85588758-85588780 AGGGAGGGGGGCCTTTGTCAGGG + Intergenic
1141698748 16:85632836-85632858 AGGGGTGGGGGCGTCTCTGCGGG + Intronic
1141868689 16:86769471-86769493 AGTGCTGGGAGCCTCTGCTATGG - Intergenic
1142118522 16:88374102-88374124 AGGGCTATGTGCATCTGTGATGG - Intergenic
1142183177 16:88681535-88681557 AGCTCTGGGGGCCTCTGGGCTGG - Exonic
1142278083 16:89133395-89133417 GGGGCTGGGGGCCACTGTTACGG + Intronic
1142715572 17:1745278-1745300 AGGGTGGGGGGCCTGTGGGAAGG + Intronic
1142894384 17:2964483-2964505 AGGTCTGAGGGCCTCTGTCCTGG + Intronic
1142996974 17:3766229-3766251 AGCCCTGGGGGCTTCTGGGATGG - Intronic
1143324074 17:6087083-6087105 ACGGCTTGGGGACTGTGTGACGG + Intronic
1143542820 17:7579746-7579768 AGGGGAGGGGGCCCCTGGGAGGG + Intronic
1143628441 17:8123810-8123832 AGGACTAGGGGCCTCGGTAATGG - Intronic
1144625401 17:16841918-16841940 AGGGCTGGGGGCCTCTTGGCGGG - Intergenic
1144656413 17:17040068-17040090 GGGGCTGGGTGCCCCTGTGTGGG + Intergenic
1144881027 17:18430803-18430825 AGGGCTGGGGGCCTCTTGGCAGG + Intergenic
1144943725 17:18959251-18959273 AGGACTGGCGGCCTGTGGGAGGG + Intronic
1145151204 17:20513584-20513606 AGGGCTGGGGGCCTCTTGGCAGG - Intergenic
1145787428 17:27603292-27603314 AGGGCTCGGGGCCTCTGTGCTGG + Intronic
1146636782 17:34512348-34512370 AAGGCTGGGCTCATCTGTGAAGG + Intergenic
1146915215 17:36673943-36673965 GGGGGTGGGGGTCTCTGAGAAGG + Intergenic
1147157085 17:38549378-38549400 AGGGCTTGGGGCTTGTGTGCAGG - Intronic
1147579555 17:41620614-41620636 AGGGCTGGGGGTCTCTTGGCAGG - Intronic
1147940122 17:44040632-44040654 GTGGCTGGGGGACTATGTGATGG + Intronic
1148091547 17:45025230-45025252 AGGAGAGGGGGTCTCTGTGATGG - Intronic
1148094211 17:45041209-45041231 GGGCCTGGAGACCTCTGTGAAGG - Intronic
1148674714 17:49438691-49438713 AGGGCTGGGGGCCTGTGGCCAGG - Intronic
1150613082 17:66749217-66749239 GGGTCTTGGGGCCCCTGTGAAGG - Intronic
1152254176 17:79227781-79227803 TAGGCTCGGGGCCTCTGTGTTGG + Intronic
1152334759 17:79694344-79694366 AGGGCTGTGTTCCTCTGTGGAGG - Intergenic
1152541964 17:80981249-80981271 AGGTCTGGGGGCCTCCCTTAGGG + Intergenic
1152614248 17:81330600-81330622 AGGGTTGGGGGACTCTCAGACGG + Exonic
1152724678 17:81939384-81939406 AGTGCTGCGGGCCTCTGGGAGGG + Intronic
1152846529 17:82603378-82603400 AGAGCTGGAGCCCTCTGTGGAGG - Exonic
1153229870 18:2925293-2925315 GGGGATGGGGTCCACTGTGATGG + Exonic
1153706375 18:7749574-7749596 AGGACTGGGGCCCTCTGGAAGGG + Intronic
1153981574 18:10315028-10315050 AGTGCAGGTGGCCTCTGTGAGGG + Intergenic
1155059205 18:22213575-22213597 ATTGCTGGAGGCCTCTCTGAGGG + Intergenic
1155115686 18:22764373-22764395 AGGGGTGGGGGCATATGGGAGGG + Intergenic
1155742446 18:29305773-29305795 AGAGCTGAAGGCTTCTGTGACGG + Intergenic
1156353755 18:36323207-36323229 AGGGCTGGGAGTCTCTGACAGGG + Intronic
1157260856 18:46174423-46174445 AGGGCTGCGGGCCGCGGTGAGGG + Intronic
1157270861 18:46275076-46275098 AAGGTTGGGGACCACTGTGATGG - Intergenic
1158526222 18:58216639-58216661 CTGGCTGGGGGCCACTGAGATGG + Intronic
1159950326 18:74478260-74478282 AGGGCTGGGGGCCTGTGGCCAGG - Intergenic
1160151535 18:76398610-76398632 AGGAATGGGGGCCTTTCTGAAGG + Intronic
1160511435 18:79455636-79455658 TGGGCTGGGGGCCTCCGGGAGGG - Intronic
1160558075 18:79739032-79739054 TGCACTGGGGGCCTCTGGGAGGG + Intronic
1160580936 18:79884343-79884365 AGAGCTGGGGGCCTCCTTGAAGG - Intronic
1160817326 19:1042183-1042205 AGGCCGGGGGGCCTCTGGCAGGG + Intronic
1161290921 19:3492855-3492877 AGGCCTGCGGGCCACTGTAAGGG + Intronic
1161327464 19:3670649-3670671 AGGGCTGGGGTCCTCACTGGAGG - Intronic
1162028571 19:7907706-7907728 AGGCCTGGTGGGCTCTGTCAGGG + Intronic
1162327670 19:10008440-10008462 AGGGGTGGGGGGGTCTGTCAGGG + Intronic
1162992790 19:14314221-14314243 AAGGCTGTGGGGCTGTGTGAGGG - Intergenic
1163144189 19:15369710-15369732 TGTGCTGTGGGCCTCTGTGGTGG - Intronic
1165097588 19:33418032-33418054 AGGGCGAGGGGCAGCTGTGAAGG - Intronic
1165177215 19:33939160-33939182 AGGGCAGTGGGCCAATGTGAGGG - Intergenic
1165476145 19:36032259-36032281 GGGGCTGGGGGCCTCGGGGACGG + Exonic
1165828234 19:38717763-38717785 AGTGCTGGGGGGCCCTGTGTAGG + Intronic
1166046704 19:40234394-40234416 GGGTCTGGGGGCCACTGGGAGGG - Intronic
1166055261 19:40284746-40284768 AGGGGTGGGGGCTTCTGGGGAGG - Intronic
1166211205 19:41307725-41307747 TGGGGTGGGGGCCTCTTTAAAGG + Intronic
1166740085 19:45109350-45109372 AGGGCTGGGGCCCTCAGAGAGGG + Intronic
1166913274 19:46176581-46176603 ATGCCTGTGGGCTTCTGTGAGGG - Intergenic
1167059492 19:47134779-47134801 ATGGATGGGGGCCTCTGAGTGGG + Intronic
1167520908 19:49954296-49954318 AGGGCTGTTGGCCTCAGTAAAGG - Intronic
1167539150 19:50074335-50074357 AGGGCTGGGGGCATCAGAGAGGG + Intergenic
1167573618 19:50306327-50306349 AGGGCTGGGGGCGAGTGGGAAGG - Intronic
1167603749 19:50469106-50469128 AGGTCTGTGGGCCACGGTGAGGG - Intronic
1168291413 19:55359444-55359466 ATGGCTGGGGCCTTCTGGGATGG + Exonic
1168291422 19:55359474-55359496 ACGGCTGGGGCCTTCTGGGATGG + Exonic
925055098 2:851188-851210 AGGGGTGGGGGCCAGTGTGAGGG + Intergenic
925060310 2:885594-885616 AGGACTGGGGGGCTCTGAGGTGG + Intergenic
925306586 2:2851254-2851276 ATGTCTGGGGCCATCTGTGAGGG + Intergenic
925909799 2:8566200-8566222 GGGGCTGGAGGACTCTGTCAGGG - Intergenic
925911531 2:8576678-8576700 AGGTCTGAGGGCCTCTCTGGGGG - Intergenic
926165818 2:10521778-10521800 GGGGCTGGGCCCCTCTGAGAGGG + Intergenic
926783029 2:16492890-16492912 AGGTTTGGGGGCATATGTGAAGG - Intergenic
927153050 2:20206469-20206491 AGGTCTTGGGGCCAGTGTGAAGG - Intronic
927155147 2:20217045-20217067 AGGGCAGGGGGTCTCCCTGAGGG - Intronic
927643721 2:24861840-24861862 GGGGCTGGGGGCCAGCGTGACGG + Intronic
928320334 2:30278190-30278212 AGGGCTGGGGTCCCATCTGAAGG - Intronic
928444408 2:31320233-31320255 AGGGATTGGGGCATCTTTGAGGG - Intergenic
929347252 2:40899796-40899818 AGGCATAGGGGCCACTGTGAGGG - Intergenic
929782153 2:44964181-44964203 GGGTCTGGGGGCCTTTGTCATGG + Intergenic
929920654 2:46169020-46169042 AGGGCTGAGCCCCTCTGTGAGGG - Intronic
930145959 2:48004606-48004628 AGGGCTGGGGTGCTCTTTGTAGG - Intergenic
930264169 2:49180667-49180689 AGGGGTGGGGGCCTAGGGGAGGG - Intergenic
930764574 2:55071695-55071717 AGTGCTGGGGACATCAGTGAAGG - Intronic
932632476 2:73357405-73357427 AGGGCTGGGGGCAAGGGTGAAGG + Intergenic
933360128 2:81271156-81271178 AGGGGTGGGGGCCACGGGGAGGG + Intergenic
934176039 2:89581405-89581427 AGGGCTGGGGGACCATGGGATGG + Intergenic
934286349 2:91655767-91655789 AGGGCTGGGGGACCATGGGATGG + Intergenic
934557195 2:95293740-95293762 AGGGCTGGCGGCCCAGGTGAGGG + Intergenic
934862490 2:97775867-97775889 AGGGTTGGAGGTCTCTGTGGTGG + Exonic
935948554 2:108308163-108308185 AGGCCTAGGGGACTCTGTGCAGG - Intronic
937689493 2:124738771-124738793 AGGTCTGGGAGTCTTTGTGAAGG + Intronic
937908828 2:127065539-127065561 AGGGCAGGGGGTATGTGTGATGG - Intronic
937911003 2:127075680-127075702 AGGGCTGGGAGCAGCTGGGAGGG - Intronic
937911137 2:127076098-127076120 AGGGCTGAGGGCAGCTGGGAGGG - Intronic
938245999 2:129778523-129778545 AGGGCTGTGGGCGAGTGTGATGG - Intergenic
938858553 2:135341733-135341755 AGGGCGGGGGGCCTCTAAAATGG + Intronic
939796274 2:146647842-146647864 AGGGGTGGGGGCCTGGGGGAGGG + Intergenic
941233264 2:162938418-162938440 AGGGCAGAGGGCCAGTGTGACGG - Intergenic
941486548 2:166089153-166089175 AGGGGTGGGGGCCTAGGGGAGGG - Intronic
942303914 2:174588015-174588037 AGGACTGGGTGCCTGTGTTAGGG + Intronic
945545483 2:211145100-211145122 AGGGCTGCTGCCCTATGTGATGG + Intergenic
946009845 2:216555577-216555599 AGGCCTGGGGGCCGCTGTCCTGG + Intronic
946158281 2:217821046-217821068 AGGGCTGGAGGCATTTGTGAAGG - Intronic
946341740 2:219073902-219073924 CAGGCTGGGGGCCTCAGGGAGGG + Intergenic
946400659 2:219466724-219466746 AGGGCTGGGGTGCTCTGTCTGGG + Intronic
946685744 2:222268166-222268188 AGTCCTGGGGGCCTCTTTAAAGG + Intronic
948297828 2:236876056-236876078 GTGGCTGGGGGCCTCTTTGACGG - Intergenic
948425907 2:237886440-237886462 TGGGCTGGGGGGCTCTGGAATGG + Intronic
948744627 2:240079630-240079652 GGGGGTGGGGGACTCTGGGAGGG - Intergenic
949027475 2:241773379-241773401 AGGGCTGGGGGCCCTTGGGGTGG + Intergenic
1168935902 20:1665107-1665129 GGGGCTGGGAGCCTCTTAGAGGG + Intergenic
1169012214 20:2260125-2260147 GTGACTGGGGGCCTCTGTGGAGG + Intergenic
1169025987 20:2371957-2371979 TGGAATGGGGGCTTCTGTGAGGG + Intergenic
1169065270 20:2691668-2691690 AGGTGAGAGGGCCTCTGTGATGG + Intergenic
1170004019 20:11646557-11646579 TGCCCTGGGGGCCACTGTGATGG + Intergenic
1171135134 20:22688803-22688825 AGGGCTGGAGGTCAATGTGAGGG - Intergenic
1171359325 20:24575962-24575984 AGGGCCTGGGGCCTCCATGAAGG - Intronic
1172062542 20:32196429-32196451 TGAGCTGAGGGCCTCTGTGGGGG + Exonic
1172149612 20:32780621-32780643 AGGGCTGCGGGCAGGTGTGAAGG - Intronic
1172628983 20:36365828-36365850 AGGTCTAGGGGGCTCTGGGATGG - Intronic
1173382061 20:42554446-42554468 AGGGCTTGCAGACTCTGTGAGGG + Intronic
1173703524 20:45093773-45093795 AGGGCTGGACGTCTGTGTGATGG + Exonic
1174002481 20:47384999-47385021 AGGGCAGGAGGCATCCGTGAAGG - Intergenic
1174753680 20:53137524-53137546 AGGGATGGTGGCAACTGTGATGG - Intronic
1174803641 20:53586798-53586820 AGAGCTGGAGGCTTCTGGGAAGG - Intronic
1175118905 20:56703321-56703343 AGTGCTGGGGGGCTCTCTGGAGG + Intergenic
1175294638 20:57900015-57900037 AGGGCTGGTGGCCTTGGTGGTGG - Intergenic
1175395080 20:58651965-58651987 TGGGCGGGGGGCCCCTGAGAGGG + Exonic
1176172750 20:63703531-63703553 GGGGTTGGCGGCCTCTGTGTGGG - Intronic
1176343848 21:5723098-5723120 AGTGCTGGGAGACTTTGTGAAGG + Intergenic
1176500979 21:7601358-7601380 AGTGCTGGGAGACTTTGTGAAGG - Intergenic
1176524612 21:7856697-7856719 AGGGGTTGGGGCTTCTGTGTAGG - Intergenic
1176538169 21:8121167-8121189 AGTGCTGGGAGACTTTGTGAAGG + Intergenic
1176975547 21:15316846-15316868 GGGGCTGGGGGCCTGGGGGAGGG - Intergenic
1177359499 21:20049909-20049931 AGGGGAGGGGGCTGCTGTGAAGG - Intergenic
1177764318 21:25439472-25439494 GGGGTTGGGGGCCTAGGTGAGGG + Intergenic
1178366680 21:31994150-31994172 AAGGCTGGTGGCAGCTGTGAAGG + Intronic
1178658632 21:34486710-34486732 AGGGGTTGGGGCTTCTGTGTAGG - Intergenic
1178787120 21:35663991-35664013 TAGGCTGGGAGCCTGTGTGATGG - Intronic
1178931343 21:36821204-36821226 TGGGCAGGGGGCCACAGTGAGGG + Intronic
1179128222 21:38611358-38611380 AGGGCCGTGGGTCTGTGTGATGG - Intronic
1179151950 21:38816543-38816565 AGGGCTGTGGGAGTCTGGGATGG - Intronic
1179522934 21:41957033-41957055 AGGGCTGGGAGCTTGTGTAAAGG - Intergenic
1179659286 21:42864310-42864332 TGTGCTGGGGGCCACTGTCAAGG + Intronic
1179785588 21:43728081-43728103 AGGGCTGGGGGCCCAGGCGATGG + Intronic
1179960654 21:44765481-44765503 GGGGCTGGGTGCCTTTGTGTGGG - Intergenic
1179975187 21:44861446-44861468 AGGGCTGCTGGCCGCTGTGCTGG - Intronic
1179975206 21:44861535-44861557 AGGCCACGGGGCCTCTGTGTTGG + Intronic
1180001871 21:44998758-44998780 AGGGCTCTGGGGCTCTGTGCAGG + Intergenic
1180184265 21:46131697-46131719 AGGGCCTGGGGCCTGTGTCAGGG + Intronic
1180612291 22:17105784-17105806 AGGGCTGGGGGCCTCAGGGTGGG + Intronic
1180877515 22:19181579-19181601 AGCGCTGGGGGCGTCTCAGAGGG + Intronic
1181487671 22:23241754-23241776 AGGGCTGGGGGCTTCTGCGATGG - Intronic
1181602178 22:23959178-23959200 ATGGCTGGGGGCCTGTCAGACGG - Intronic
1181606332 22:23982129-23982151 ATGGCTGGGGGCCTGTCAGACGG + Intronic
1182065812 22:27430948-27430970 AGGGCTGGGTGGCTCCGTGGGGG + Intergenic
1182655157 22:31884234-31884256 AGGGCTGGGGTCTTGTGTGCAGG - Intronic
1182724916 22:32437034-32437056 AGGGCTGCTGACCTCTGTCAGGG - Intronic
1183055359 22:35301785-35301807 AGGGCAGGGGTCCTTTGAGAGGG - Intronic
1183373712 22:37450028-37450050 AAGGCTGTGGGTGTCTGTGAAGG + Intergenic
1183534620 22:38391176-38391198 AGAGCTGGAGGCTTCTGGGAAGG - Intronic
1183544089 22:38446454-38446476 AGTTCTGGGGGCCTGGGTGAGGG + Intronic
1183625149 22:38997282-38997304 GGGCCTGGGGCCCTCTGGGAGGG + Intergenic
1184493859 22:44826021-44826043 AGGGCAGGGGGCAGCAGTGATGG - Intronic
1184649172 22:45911795-45911817 AGGGCTGGGGAGCTCAGGGAGGG + Intergenic
1185060658 22:48604784-48604806 CAGGCTGGGGGCCTCTCTAAGGG + Intronic
1185189180 22:49423337-49423359 AGGTGTGGGGGCCTCGGGGATGG - Intronic
1185224252 22:49644015-49644037 AGGTCTGGTGGCCTCTGTGGGGG - Intronic
1185297368 22:50061014-50061036 AGGGCTGGGCGCCTCTGTCCTGG - Exonic
1185393413 22:50574621-50574643 CGGGGTGGGGGCCTCTGTCTGGG + Intronic
1185412921 22:50695370-50695392 AGGGCTGGTGGCCTGTGGTAAGG + Intergenic
1203243116 22_KI270733v1_random:37523-37545 AGTGCTGGGAGACTTTGTGAAGG + Intergenic
949282523 3:2362619-2362641 AGGGCTGAGGGCCTAGGAGATGG + Intronic
950112127 3:10425975-10425997 AGAGCAGGGGCCCTCTGTGCAGG - Intronic
950156364 3:10724397-10724419 AGGGCTGGTGTCCGGTGTGAGGG - Intergenic
950410638 3:12834144-12834166 TGGGCTGGGGGCCTTTGAGTTGG - Exonic
950487336 3:13281510-13281532 GGGGCTGGGGGGCTCTTTGGAGG - Intergenic
951041786 3:17995960-17995982 GGGGCTGGAGGCCTCTGGGTGGG + Intronic
952945730 3:38477041-38477063 AGGCCTAGGGGCAGCTGTGATGG + Intronic
953183442 3:40617300-40617322 AGTGCTGGGGGCGTCTGCAAGGG - Intergenic
954226836 3:49187388-49187410 AGGGCTAAGGGCCCCTGTGGAGG + Intronic
954798829 3:53175333-53175355 AGGGATGGGTGCCGCAGTGAGGG + Intronic
956740309 3:72270670-72270692 AGTGAGGGGGACCTCTGTGAAGG + Intergenic
956751320 3:72346167-72346189 AGGACTGGGGGCATCTTTGACGG - Intergenic
958252481 3:91286605-91286627 AGAACTGGGGGTCTCTGTCAAGG + Intergenic
960021477 3:112959474-112959496 AGGACTTGGGGCCTCTGTGCTGG + Intronic
962600634 3:136988353-136988375 AGGGCTGTGGGCCTCTCTGCTGG + Intronic
963060250 3:141219847-141219869 AGGGCTGGGAACCACTGTGGAGG - Intergenic
967012903 3:185453394-185453416 AGGGATGGGGGGCTATGAGAAGG - Intronic
967845086 3:194036571-194036593 AGGCATGCAGGCCTCTGTGAAGG + Intergenic
967877617 3:194277637-194277659 AGGGCTGGGAGCCTTTGGGGAGG - Intergenic
968554961 4:1242191-1242213 GGGGCAGGGGGCCCCTGAGAGGG + Intronic
968731670 4:2272019-2272041 AGGGCTGGATGCCCCTGTCAGGG - Intronic
969406522 4:6996697-6996719 AGCCCTGGGGGCTTCTGGGATGG - Intronic
969422762 4:7107019-7107041 AGGGATGGGGGAGTGTGTGAAGG - Intergenic
969534260 4:7746271-7746293 GAGGCTGGGGACCGCTGTGAAGG - Intergenic
969586706 4:8098042-8098064 TGGACTGGGGGCCTCTGAGCTGG - Intronic
969606938 4:8206485-8206507 GGAGCTGGGAGCCTCTGGGAAGG + Intronic
970368181 4:15382142-15382164 ACAGCTGAGAGCCTCTGTGAAGG - Intronic
970481804 4:16483699-16483721 GGGGCTGGTGGCCTCTGTATTGG - Intergenic
973650915 4:52996361-52996383 AGGGCTGGAGGCTCCAGTGACGG - Intronic
975260183 4:72288798-72288820 AGGGCTGGGGACCACTGTGATGG - Exonic
976564026 4:86532910-86532932 AGGGATTGGGGCCTTTGTGTTGG + Intronic
978285926 4:107076290-107076312 GGGGCTGGGGGCCTAGGGGAGGG + Intronic
980411322 4:132423238-132423260 AGGGCTGGTCTCCTATGTGATGG + Intergenic
980467785 4:133207845-133207867 AGGGTTGACAGCCTCTGTGATGG + Intronic
984288909 4:177767441-177767463 ATGTCTGGGTACCTCTGTGAGGG - Intronic
984905974 4:184626121-184626143 AGGGGAGGGGGCCTCTGAAATGG - Intergenic
985541219 5:488622-488644 GGGGCTGGGGGTCTGTGGGAGGG - Intronic
985589084 5:755515-755537 GGCCCTGGAGGCCTCTGTGATGG - Intronic
985603763 5:848031-848053 GGCCCTGGAGGCCTCTGTGATGG - Intronic
986349879 5:6867453-6867475 GGGGCTGGGGGCTTCTGAGAAGG - Intergenic
986448045 5:7840257-7840279 AGGGGTGGAGGTCACTGTGAGGG - Intronic
987065219 5:14283348-14283370 AGGGCTGGTGTCATATGTGAAGG + Intronic
989674696 5:43960097-43960119 GGGGGTGGGGGGCTATGTGAGGG - Intergenic
990745300 5:58953223-58953245 AGGGGTGGGGGGCTGTGGGAGGG - Intergenic
991161941 5:63513279-63513301 AGGGCTGGGGGGCTTGGGGAGGG + Intergenic
994418658 5:99505699-99505721 AGGGGTGGGGGGCTATGGGAGGG - Intergenic
995732997 5:115265454-115265476 AGGCCCGGGGGGCTCTGGGATGG - Intergenic
997882182 5:137601143-137601165 AGGGCTGGGGGCTGCCATGAGGG - Intergenic
1000281812 5:159788902-159788924 AGGGCGGGAGGTCTCTGTGGGGG + Intergenic
1001086337 5:168702429-168702451 AGTGCTGGGAGCCTCTATGCAGG + Intronic
1002056012 5:176598232-176598254 AGGTCTGGTGGCCTCTGGAAAGG - Exonic
1002061298 5:176627507-176627529 ATGTCTGGGGGCCGCTGGGAAGG + Intronic
1002455650 5:179344480-179344502 AGGGTCGGGGGACTCTCTGACGG - Intronic
1002586269 5:180250763-180250785 GGGGCTGGGGGCCTCTTTTTGGG - Intronic
1002870239 6:1160488-1160510 AGGTCGGGAGGCCTCAGTGATGG + Intergenic
1003565621 6:7219858-7219880 AGGGCTGGGGGTCCCAGTGGAGG - Intronic
1004516656 6:16327161-16327183 GGGGGTCCGGGCCTCTGTGATGG - Exonic
1005346792 6:24898342-24898364 TAAGCTGGGGTCCTCTGTGAGGG + Intronic
1006610512 6:35291764-35291786 AGGGGTTGGGGCCTGAGTGAGGG - Intronic
1010149290 6:72711552-72711574 AGGTCTGGTGGACTCTGCGAAGG + Intronic
1010208807 6:73346865-73346887 AGGGCTTGGGGTCTGTGGGAGGG - Intergenic
1010933703 6:81835163-81835185 GGGGCTGGGGGGCTATGGGAGGG - Intergenic
1011326470 6:86153745-86153767 CTGGCGGGTGGCCTCTGTGAAGG - Intergenic
1016633543 6:146260150-146260172 AGGGGTGGGGGCCTAGGGGAGGG - Intronic
1017464151 6:154678949-154678971 AGGGTTGGGGACCACTGTGTTGG + Intergenic
1017747847 6:157462764-157462786 AGGGCTGGGGGGCACTGGGCTGG - Intronic
1017787663 6:157769712-157769734 AGGTCTGGAGGCCTGTGTGGAGG + Intronic
1018468835 6:164079207-164079229 AGGGTGGGGGGAGTCTGTGAAGG + Intergenic
1019121524 6:169808559-169808581 AGTGCTGGGGGCATCAGTGGTGG - Intergenic
1019121552 6:169808697-169808719 AGTGCTGGGGGTCTCAGTGTTGG - Intergenic
1019121581 6:169808861-169808883 AGTGCTGGGGGTCTCAGTGGTGG - Intergenic
1019121605 6:169808980-169809002 AGTGCTGGGGGTCTCAGTGTTGG - Intergenic
1019121643 6:169809145-169809167 AGTGCTGGGGGTCTCAGTGTTGG - Intergenic
1019121659 6:169809220-169809242 AGTGCTGGGGGTCTCAGTGTTGG - Intergenic
1019121667 6:169809250-169809272 AGTGCTGGGGGTCTCAGTGTTGG - Intergenic
1019121693 6:169809384-169809406 AGTGCTGGGGGTCTCAGTGTTGG - Intergenic
1019121707 6:169809444-169809466 AGTGCTGGGGGTCTCAGTGTTGG - Intergenic
1019121721 6:169809518-169809540 AGTGCTGGGGGACTCAGTGTTGG - Intergenic
1019121732 6:169809563-169809585 AGTGCTGGGGGTCTCAGTGTTGG - Intergenic
1019338165 7:494763-494785 AGGATGGGGGGCTTCTGTGAGGG + Intergenic
1019415496 7:924910-924932 AGGGCAGGGTTCCCCTGTGAGGG + Intronic
1019420321 7:947847-947869 AGGGCTGGGGGACGCTGTGAGGG - Intronic
1019476662 7:1247659-1247681 AGAGCTGGGGGGCGCTGTGCTGG - Intergenic
1019542634 7:1558459-1558481 ATGGCTGGGGGCCCGTTTGAAGG + Intronic
1019735540 7:2648252-2648274 AGGGCTGGGGGCAAGTGTGCTGG - Intronic
1019862416 7:3672032-3672054 AGTCCTGGCGGCCTCTGGGAGGG + Intronic
1021890240 7:25180140-25180162 GGGGCTGGGGGCGCTTGTGACGG + Exonic
1023724835 7:43132156-43132178 GGGGCGGGGGGGCGCTGTGAGGG - Intronic
1024125550 7:46291015-46291037 AGGACTGGGTGCCACTGAGATGG + Intergenic
1024262437 7:47582275-47582297 AGGGCGGGGGACCCCGGTGAAGG - Intronic
1026467377 7:70665991-70666013 GCGGCTGGGGGCCTCTGAGCTGG + Intronic
1026867532 7:73832731-73832753 AGGGCTGGAGGCCTGGGTGCGGG + Intergenic
1026911602 7:74094591-74094613 AGGCGTGGGGGCTTCTGCGAGGG + Intronic
1027622695 7:80510660-80510682 AGTGCTGTGGGCCTGTGTGCAGG + Intronic
1028127566 7:87131245-87131267 ATTTCTGGGTGCCTCTGTGAAGG + Intergenic
1028862359 7:95667109-95667131 AGGGGTGGGGGCCTAGGGGAGGG + Intergenic
1029611027 7:101626675-101626697 AGGGCAGGGGCCCCCTGGGAGGG - Intronic
1030185270 7:106755515-106755537 AGGTCTGGGGGCACATGTGAAGG - Intergenic
1032078588 7:128847761-128847783 AGGGCTGGGGGCTGGTGTCAGGG + Exonic
1032389534 7:131546921-131546943 CAGGCTGGGGGCCTCAGTGCGGG - Intronic
1033206018 7:139423666-139423688 AGGCATGTGGGCCTCTGTGAAGG + Intergenic
1033210192 7:139454405-139454427 AGGGCTGGGGGCCAAAATGAGGG + Intronic
1033587759 7:142787067-142787089 AAGGCTGGGGGTCTCTAGGAGGG + Intergenic
1034343687 7:150372976-150372998 AGGGCTGGGGTCCTTCGTGGTGG + Intronic
1034442155 7:151091219-151091241 AGGACTGGGGGGGTCTGGGATGG + Intronic
1034882491 7:154773175-154773197 AGAGCTGGGCTCCTCTGGGAGGG + Intronic
1034957409 7:155343680-155343702 AGGGCTGGGGGCCTCTCTGTGGG + Intergenic
1035102707 7:156414717-156414739 AGAGAGGGGGGCCTCTGTGCTGG + Intergenic
1035231817 7:157469976-157469998 GGCGCTGGGGGCCACTGTGGTGG - Intergenic
1035261932 7:157667488-157667510 GGAGCTGGGGGCCTCTGGCAGGG + Intronic
1035314149 7:157987857-157987879 AGAGCTGGGGGCATCAGTGATGG - Intronic
1035522611 8:287248-287270 AGGGCTGTGGGCCACTGTTAGGG + Intergenic
1035582304 8:747790-747812 TGGGATGGGGGGCTCTGTGGTGG + Intergenic
1035582320 8:747830-747852 TGGGATGGGGGGCTCTGTGGTGG + Intergenic
1035582365 8:747950-747972 TGGGATGGGGGGCTCTGTGGTGG + Intergenic
1036582706 8:10090214-10090236 ATGACTGGGTGCCTCTGGGAGGG + Intronic
1036767570 8:11558455-11558477 AAGGCTGAGGGCCCCTGGGATGG - Intronic
1037202561 8:16275880-16275902 AGGGGATGGGGCCTCTGAGATGG + Intronic
1037620526 8:20559571-20559593 GGGGCTGGGGGCTTCAGGGAAGG + Intergenic
1037787498 8:21911629-21911651 AAGGCTGGGGGCCCAGGTGAGGG - Intronic
1037815109 8:22107979-22108001 TGGGCTGGGGGCCTCTCTCCTGG - Intronic
1037827433 8:22167705-22167727 AGGGCTGGGGGCGGCTGAGAGGG + Intronic
1037911557 8:22746668-22746690 AAGGCTGAGGTCCTCTGTGAAGG - Intronic
1038764561 8:30415165-30415187 AGGGCTGGGCACCTAGGTGAAGG - Intronic
1039904767 8:41778384-41778406 AGCACTGGGGGCATCTTTGATGG + Intronic
1040286102 8:46101185-46101207 AGTCCTGGGGGCTTCTGAGATGG + Intergenic
1040287912 8:46109839-46109861 AGACCTGGGGGCTTCTGGGATGG + Intergenic
1040288117 8:46110706-46110728 AGCCCTGGGGGCTTCTGAGATGG + Intergenic
1040288580 8:46112796-46112818 GGCCCTGGGGGCCTCTGGGATGG + Intergenic
1040288767 8:46113706-46113728 AGACCTGGGGACTTCTGTGATGG + Intergenic
1040289801 8:46118449-46118471 CAGCCTGGGGGCTTCTGTGATGG + Intergenic
1040290273 8:46120610-46120632 AGCTCTGGGGGCTTCTGAGATGG + Intergenic
1040291803 8:46129393-46129415 AGCCCTGGGGGCTTCTGTGATGG + Intergenic
1040292092 8:46130720-46130742 AGATCTAGGGGCTTCTGTGATGG + Intergenic
1040292189 8:46131177-46131199 AGCCCTGGGGGCTTCTGGGATGG + Intergenic
1040292323 8:46131825-46131847 AGCCCTGGGGGCTTCTGGGATGG + Intergenic
1040292424 8:46132260-46132282 AGCCCTGGGGGCTTCTGGGATGG + Intergenic
1040293676 8:46138334-46138356 AGTCCTGGGGGCTTCTGGGATGG + Intergenic
1040294582 8:46142619-46142641 AGCCCTGGGGGCTTCTGTGATGG + Intergenic
1040295971 8:46149259-46149281 AGCCCTGGGGGCTTCTGGGATGG + Intergenic
1040298104 8:46173756-46173778 AGCCCTGGGGGCTTCTGAGATGG - Intergenic
1040298730 8:46176916-46176938 AGCTCTGGGGGCTTCTGAGATGG - Intergenic
1040298978 8:46178221-46178243 AGTGCTGGGGGCTTCTGGGATGG - Intergenic
1040299213 8:46179311-46179333 AGGCCTGGGGGCTTCTGTCATGG + Intergenic
1040300112 8:46183569-46183591 AGACCTGGGGGCTTCTGGGATGG + Intergenic
1040300655 8:46186297-46186319 AGTCCTGGGGGCTTCTGGGAAGG + Intergenic
1040301571 8:46190737-46190759 AGCCCTGGGGGCTTCTGGGATGG - Intergenic
1040302099 8:46193362-46193384 ACAACTGGGGGCCTCTGGGATGG - Intergenic
1040302214 8:46194009-46194031 AGCACTGGGGGCTTCTGGGATGG - Intergenic
1040302784 8:46196595-46196617 AGAACTGGGGGCTTCTGGGATGG - Intergenic
1040303384 8:46199715-46199737 AGCCCTGGGGGCTTCTGGGATGG - Intergenic
1040307911 8:46221776-46221798 AGTCCTGGGAGCTTCTGTGACGG - Intergenic
1040308171 8:46223077-46223099 AGCCCTGGGGGCTTCTGGGATGG - Intergenic
1040308357 8:46223846-46223868 AGTCCTGGGGGCTTCTGGGATGG - Intergenic
1040308617 8:46225125-46225147 AGCCCTGGGGGCTTCTGGGATGG - Intergenic
1040311511 8:46239207-46239229 AGCCCTGGGGGCTTCTGAGATGG - Intergenic
1040311553 8:46239424-46239446 AGTCCTGGGGGCATCTGGGATGG - Intergenic
1040311685 8:46240069-46240091 AGACCTGGTGGCTTCTGTGATGG - Intergenic
1040311859 8:46240936-46240958 AGACCTGGGGGCTTCTGGGATGG - Intergenic
1040312344 8:46243290-46243312 AGCCCTGGGGGCTTCTGGGATGG - Intergenic
1040312569 8:46244339-46244361 CGCGCTGGGGGCTTCTGGGATGG - Intergenic
1040313514 8:46249034-46249056 AGTGCTGGGGGCTTCTGGGATGG - Intergenic
1040313654 8:46249705-46249727 AGCCCTGGGGGCTTCTGGGATGG - Intergenic
1040314794 8:46255232-46255254 AGCCCTGGGGGCTTCTGTGATGG - Intergenic
1040315122 8:46256961-46256983 AGCCCTGGGGGCTTCTGTGATGG - Intergenic
1040315217 8:46257412-46257434 AGCCCTGGGGGCCTCTGGAATGG - Intergenic
1040315564 8:46259109-46259131 AGCCGTGGGGGCTTCTGTGATGG - Intergenic
1040326185 8:46342779-46342801 AGCCCTGGGGGCTTCTGGGATGG - Intergenic
1040326276 8:46343208-46343230 AGCCCTGGGGGCTTCTGGGATGG - Intergenic
1040329920 8:46380692-46380714 AGGCATGGGGGCCCCTGGGATGG - Intergenic
1040330476 8:46383282-46383304 AGCGTTGGGGGCTTCTGGGATGG - Intergenic
1040331292 8:46387103-46387125 AGCCCTGGGGGCTTCTGGGATGG - Intergenic
1040332102 8:46390986-46391008 AGCCCTGGGGGCTTCTGGGATGG - Intergenic
1040332253 8:46391632-46391654 AGCCCTGGGGGCTTCTGGGATGG - Intergenic
1040333354 8:46403623-46403645 AGCACTGGGGGCTTCTGAGATGG - Intergenic
1040335415 8:46413528-46413550 AGCCCTGGGGGCTTCTGGGATGG - Intergenic
1040335543 8:46414170-46414192 AGCCCTGGGGGCTTCTGAGATGG - Intergenic
1040335865 8:46415657-46415679 AGCCCTGGGGGCTTCTGGGATGG - Intergenic
1040336084 8:46416729-46416751 AGCCCTGGGGGCTTCTGAGAAGG - Intergenic
1040337016 8:46421209-46421231 AGCCCTGGGGGCTTCTGGGATGG - Intergenic
1040337066 8:46421423-46421445 AGCCCTGGGGGCTTCTGGGATGG - Intergenic
1040337199 8:46422072-46422094 AGCCCTGGGGGCTTCTGTGATGG - Intergenic
1040337418 8:46423152-46423174 AGGACTGGGGGCTTCTGATATGG - Intergenic
1040337845 8:46425185-46425207 AGCTCTGGGGGCTTCTGGGATGG - Intergenic
1040338502 8:46428185-46428207 AGCCCTGGGGGCTTCTGGGATGG - Intergenic
1040338600 8:46428618-46428640 AGCCCTGGGGGCGTCTGGGAAGG - Intergenic
1040338868 8:46429880-46429902 AGCCCTGGGGGCTTCTGAGATGG - Intergenic
1040338914 8:46430096-46430118 AGCCCTGGGGGCTTCTGGGATGG - Intergenic
1040339305 8:46432427-46432449 AGCCCTGGGGGCTTCTGGGATGG - Intergenic
1040340574 8:46438484-46438506 AGACCTGGGGGCTTCTGGGATGG + Intergenic
1040439646 8:47427824-47427846 GAGGCTGGGGGCCCCTGAGATGG + Intronic
1041111472 8:54487029-54487051 AGCACTGGGGGCATCTGTGAGGG - Intergenic
1041467282 8:58169400-58169422 AGTCCTGGGAGCCTCTGAGATGG + Intronic
1041519535 8:58740159-58740181 AGGGCTGTGTGACTCTGTGCTGG - Intergenic
1043463681 8:80485975-80485997 CGGGCTGGGGGTCTCAGGGAGGG - Intronic
1043982307 8:86657114-86657136 AGGCCTGGTGGCCTCCCTGATGG - Intronic
1044686166 8:94827902-94827924 AGGGCAGAAGGCCTGTGTGAAGG + Intronic
1045063188 8:98425715-98425737 AGGGCTTGGGGCCTCCTTGGAGG - Intronic
1045378759 8:101601968-101601990 AGGGGTGGGGGCCTAGGGGAGGG - Intronic
1047189006 8:122661197-122661219 AGGTCTGGGTGTCTCTGTCATGG - Intergenic
1048120906 8:131580750-131580772 AGGGCTGGAAGCTTCTGAGAAGG - Intergenic
1048821087 8:138381424-138381446 AAGGTTGGGGGCTTCTGTTAGGG - Intronic
1049127491 8:140805014-140805036 AGGGCTGCAGGGCTCTGTGCTGG + Intronic
1049240666 8:141535979-141536001 AGGGGCGGGGGCCTCTCTGCTGG + Intergenic
1049347600 8:142147058-142147080 AGGTGTGGGAGCCACTGTGATGG - Intergenic
1049391854 8:142375736-142375758 ATGACTGGGGGTCTCTGTGCGGG - Intronic
1049583721 8:143423663-143423685 AGGGAGGTGGGCCCCTGTGAGGG + Intronic
1052669189 9:31533955-31533977 AGGTTTGGGGGCATATGTGAAGG + Intergenic
1052991672 9:34522356-34522378 AGGGCTGTGTGCCTCTATGTGGG + Intronic
1052994792 9:34546206-34546228 GGGGTGGGGGGCTTCTGTGACGG + Intergenic
1053019351 9:34684310-34684332 AGGGCTGGAAACCTATGTGATGG + Intergenic
1053135206 9:35646543-35646565 AGGGCTGAGGGCCTCGGTGACGG + Intronic
1053137549 9:35660931-35660953 AGGTCTGCTGGCCTCTGTGTGGG - Exonic
1053544025 9:39004017-39004039 AGTGTTGGGGGCCTGAGTGAAGG - Intergenic
1053777623 9:41563781-41563803 AGGGGTGGGGGCCTAGGGGAAGG + Intergenic
1053808458 9:41827514-41827536 AGTGTTGGGGGCCTGAGTGAAGG - Intergenic
1054622134 9:67359914-67359936 AGTGTTGGGGGCCTGAGTGAAGG + Intergenic
1056126147 9:83538018-83538040 AGGGCGGGGGGCCTTTGCGGTGG - Intronic
1056315062 9:85380474-85380496 AGGGCTGGCGAGCTCTGGGAAGG - Intergenic
1057034203 9:91799869-91799891 AGAGCTGGGTGCCACTGTGTGGG - Intronic
1057193437 9:93100038-93100060 GGGGCTGGGGACCACGGTGATGG - Intronic
1058072473 9:100615602-100615624 AGGGCTGGGGGTCTAGGGGAGGG - Intergenic
1058552852 9:106134066-106134088 AAGGCTGGGGTCCTCTGGGACGG + Intergenic
1058693576 9:107539837-107539859 TGGGCTGGGGGCGTCTCAGAAGG - Intergenic
1059238281 9:112780974-112780996 ATGGTTAGGGGACTCTGTGACGG - Intronic
1060112258 9:120914596-120914618 TGGTCGGGGGGGCTCTGTGAGGG + Intronic
1061134049 9:128723375-128723397 AGGGCTGGGGTCTGCTGTGGGGG + Intronic
1061856641 9:133445219-133445241 AGGGCTCAGGGCCCCTGGGAAGG + Intronic
1062068882 9:134544608-134544630 AGGGCCGGGAGCCTCTGGGACGG - Intergenic
1062446915 9:136599007-136599029 AGGGCTGGGGGCCTCTGGCTGGG - Intergenic
1062448799 9:136606998-136607020 AGGGCTGGGGGCGGATGAGAAGG - Intergenic
1062550417 9:137083525-137083547 AATGCCGGCGGCCTCTGTGATGG + Exonic
1062591298 9:137275993-137276015 AGGGCTGGGGGAAGCAGTGAGGG + Intergenic
1203459441 Un_GL000220v1:20605-20627 AGTGCTGGGAGACTTTGTGAAGG + Intergenic
1186287568 X:8062325-8062347 AGGGTTGGGGACCTCTGGGTTGG - Intergenic
1190406948 X:50097767-50097789 AGGGCTTTGCTCCTCTGTGAGGG + Exonic
1192159356 X:68771330-68771352 AGGGCTGCAGGCCTGTGTGGTGG + Intergenic
1193478485 X:81996619-81996641 AGGTCTGTGCGCCTCTGGGATGG + Intergenic
1194212895 X:91090537-91090559 TGGGCTGGAGGCTTCTGTAAAGG + Intergenic
1194690499 X:96978821-96978843 AGGGTTGTGGTCCTGTGTGAAGG + Intronic
1195676348 X:107510057-107510079 AGAGCTGGGGCTCTCTGTTATGG - Intergenic
1196243749 X:113373788-113373810 AGGGGTGGGGGCCTGGGGGAGGG + Intergenic
1196888727 X:120272137-120272159 AGGGCTGGGGGCCTCAGTCTTGG - Intronic
1197703264 X:129615855-129615877 GGGGCGGGGGGCATTTGTGAGGG - Intergenic
1199477084 X:148257707-148257729 AGGGGTGGGGGCCTAGGGGAGGG - Intergenic
1199874716 X:151920889-151920911 AGGGCTGGGACCCTCTATCAGGG - Intronic
1201681837 Y:16654765-16654787 GGGGCTGGGGGTCTATGGGAGGG - Intergenic
1201952106 Y:19576853-19576875 AGGGGTGGGGGCCTAGGGGAGGG + Intergenic
1201965321 Y:19726554-19726576 AGGGCTGGGGGACTAGGGGAGGG + Intronic