ID: 1114553724

View in Genome Browser
Species Human (GRCh38)
Location 14:23549633-23549655
Sequence TAGAATGAACTGAAGGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 288}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114553719_1114553724 24 Left 1114553719 14:23549586-23549608 CCTAGGAAGAAGATGAACTAAAA 0: 1
1: 0
2: 2
3: 48
4: 489
Right 1114553724 14:23549633-23549655 TAGAATGAACTGAAGGATGGGGG 0: 1
1: 0
2: 3
3: 31
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114553724 Original CRISPR TAGAATGAACTGAAGGATGG GGG Intronic
901238313 1:7679277-7679299 TAGAATGAACCCAAGGATGCTGG + Intronic
902047908 1:13539720-13539742 TAAAATGAGCTGGAGGAAGGAGG - Intergenic
902270976 1:15304830-15304852 TAGAATTAACAGAAGGATCAAGG - Intronic
902991353 1:20189491-20189513 AGCAATGAACTGAAGCATGGTGG - Intronic
907697817 1:56751682-56751704 GAGAAGGAACAGAAGAATGGTGG - Intronic
908333691 1:63097936-63097958 AAGAAGGAAAAGAAGGATGGGGG + Intergenic
909023467 1:70457901-70457923 TAGAATAAACTGAAAACTGGTGG - Intergenic
909981615 1:82109001-82109023 TAGAATGAACTAGAGGAGTGTGG + Intergenic
910523934 1:88155884-88155906 TAGTGTGAAGTGGAGGATGGAGG - Intergenic
910780545 1:90927817-90927839 AAGAAGGAAGTGAAGGAGGGAGG - Intronic
911402012 1:97387202-97387224 TAACATAAACTGTAGGATGGGGG - Intronic
911596271 1:99801739-99801761 CAGCTTGAACTGAGGGATGGAGG - Intergenic
912042941 1:105415565-105415587 TAGAATGTAATGAATCATGGGGG + Intergenic
912227741 1:107754699-107754721 GAGAGTGAAGGGAAGGATGGTGG - Intronic
915412573 1:155714071-155714093 TAGAATGAGCAGAAGTATAGAGG + Intronic
915579011 1:156802227-156802249 TTGAGTGAACTGAAGGAGGTGGG - Intergenic
917247182 1:173016695-173016717 CAGAATGAACTAAAGTGTGGTGG + Intergenic
917774917 1:178322583-178322605 TAGAATGACTAGAAGGATGGTGG - Intronic
919248401 1:195019241-195019263 TAGAATGAAATGAATGAATGAGG + Intergenic
920128720 1:203714108-203714130 TGGTAGGAACTGAAGGGTGGGGG + Intronic
921648282 1:217646160-217646182 AAGACAGAAATGAAGGATGGGGG - Intronic
922314596 1:224432772-224432794 CAGAATGAAATGAAGGGGGGAGG - Intronic
923515759 1:234696612-234696634 TACACTGAATTGAAGTATGGTGG + Intergenic
924455665 1:244217100-244217122 TCTAAGGAGCTGAAGGATGGAGG + Intergenic
1064454860 10:15477996-15478018 TTGAATGAACTGAAGGCTGTGGG + Intergenic
1065909248 10:30287081-30287103 ATGAACGAATTGAAGGATGGTGG + Intergenic
1066484776 10:35832900-35832922 CTGAATGAACTGAATGAAGGAGG + Intergenic
1068211970 10:53932147-53932169 TGGAATTAACTGAAGTATGCTGG - Intronic
1068813676 10:61285582-61285604 TTGAATGAATTGAAGGAGGCAGG + Intergenic
1069926363 10:71853255-71853277 TGCAAGGAGCTGAAGGATGGGGG - Intergenic
1070332592 10:75429083-75429105 TAGAAGGAACAGAAGGAGGAAGG - Intergenic
1072307392 10:94120748-94120770 TGGAAAGAAATGAAGGATGCAGG + Intronic
1073102719 10:101015200-101015222 TGGCATGCAGTGAAGGATGGAGG + Intronic
1073596101 10:104801718-104801740 AAGAAGGAACTGAAGCATTGAGG + Intronic
1075696113 10:124436729-124436751 CAGAATGAGATGAAGGAAGGAGG - Intergenic
1076034095 10:127184492-127184514 TAGCAGGACCTGCAGGATGGGGG - Intronic
1078414221 11:11152015-11152037 TTGAATGCAATGAAGGATGAAGG - Intergenic
1079390229 11:20015827-20015849 TAGAAGGAGCTGAAGGACTGTGG + Intronic
1079613179 11:22458161-22458183 CAGAAAGAAGTGAAGGAAGGAGG - Intergenic
1079699705 11:23529525-23529547 TACAATAAAATGATGGATGGAGG + Intergenic
1080062976 11:27977139-27977161 TAGAATGAAGTTATGGATTGAGG + Intergenic
1080063971 11:27988050-27988072 TACAATGAAAGGAAGAATGGAGG + Intergenic
1080962344 11:37175260-37175282 TACCTTGAACTGAAGGATGTTGG + Intergenic
1081376066 11:42359987-42360009 TAGAGTTAACTGAATCATGGGGG - Intergenic
1081867650 11:46368324-46368346 TGGAATGAATTGACGAATGGTGG + Intronic
1083140256 11:60715544-60715566 TAGACTGAATTGAAGAATGAAGG - Exonic
1084257530 11:67953295-67953317 TCGCATGACCTGAAGGATGATGG - Intergenic
1084270916 11:68028714-68028736 AAGGATGAAATGAAGGATTGAGG + Exonic
1084490983 11:69478182-69478204 TAGAATGATCAGAAAAATGGAGG + Intergenic
1085408016 11:76275602-76275624 TTGCATGACCTGATGGATGGTGG + Intergenic
1085747035 11:79123765-79123787 TAGGATGAACTGAAGAACAGAGG + Intronic
1085838225 11:79979277-79979299 TAGAATTAACTGAGGGTTGGAGG - Intergenic
1086357812 11:86023713-86023735 TAAAATGAACTGAATGAGGGAGG + Intronic
1089757836 11:120699391-120699413 TAGAATGAACTAAAGACTGCAGG - Intronic
1090025717 11:123166104-123166126 TGGAATGAATGGAAGGATTGTGG - Intronic
1090150116 11:124375071-124375093 CAGAATGAGCTGGAAGATGGGGG - Intergenic
1090865048 11:130692526-130692548 TAGCCTGCACTGAAGGAGGGAGG - Intronic
1092427759 12:8388091-8388113 TCGCATGACCTGAAGGATGATGG - Intergenic
1092429029 12:8395072-8395094 TCGCATGACCTGAAGGATGATGG - Intergenic
1094050027 12:26209005-26209027 AAGAATAAAATGAAGGAGGGTGG - Intronic
1096338270 12:50774398-50774420 TAGAAGGAACTGAGAAATGGTGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1099480739 12:83162796-83162818 TGGAATGAATTGAAGAATGAAGG - Intergenic
1103455126 12:121059537-121059559 AAGGATGAAGTGAAGGATGCCGG - Intergenic
1106388692 13:29314191-29314213 TAGAATGAAATGGAGAATTGAGG + Intronic
1109398978 13:61799671-61799693 TAAATTGAACTGAAGGCTGTAGG - Intergenic
1112724349 13:102285406-102285428 TAGACTGAACTGACAGTTGGTGG + Intronic
1112906219 13:104425538-104425560 TAAAATGAAGATAAGGATGGAGG + Intergenic
1113865700 13:113521620-113521642 GAGAATGAAAAGAAGGATCGGGG - Intronic
1114553724 14:23549633-23549655 TAGAATGAACTGAAGGATGGGGG + Intronic
1114999256 14:28401507-28401529 AAGAAAGAAATAAAGGATGGGGG - Intergenic
1115258044 14:31423301-31423323 TAGAATGAACTGTATGATGCTGG - Intronic
1115919506 14:38356321-38356343 GAGAAGTAACTGAAGCATGGGGG + Intergenic
1116067620 14:40004103-40004125 AATAATTAACTTAAGGATGGTGG - Intergenic
1116074807 14:40097834-40097856 AAGAAGGAACGGAAGGAGGGAGG - Intergenic
1116538085 14:46061435-46061457 TAAAATGAACAGAAGGTAGGTGG + Intergenic
1116785281 14:49281247-49281269 TAGAAAGAAATTAAGGAAGGAGG + Intergenic
1117441966 14:55768459-55768481 TTGAATGAAGAGAAGAATGGTGG + Intergenic
1117522315 14:56563022-56563044 GAGAAGGAAGGGAAGGATGGAGG + Intronic
1118567549 14:67158418-67158440 GAGAATGAATTGGAGGAGGGTGG + Intronic
1118795909 14:69143949-69143971 TAAAATGAAGTGAAATATGGCGG - Intronic
1119012213 14:71005027-71005049 CAGAATGAAGGGAAGGTTGGGGG + Intronic
1119114074 14:72002183-72002205 TAGAATGAGATTAAGGATGCTGG - Intronic
1119352556 14:73978223-73978245 GAGAACAAACTGTAGGATGGGGG - Intronic
1120515799 14:85468768-85468790 TAGAGGGAACTGAATCATGGGGG - Intergenic
1121051360 14:90820882-90820904 ATGAATGAGCTGAAGGAAGGTGG + Intergenic
1124192273 15:27590756-27590778 TAGCATGAAGGGAAGGAAGGAGG - Intergenic
1125273167 15:37962552-37962574 CAGAATGAATTGGGGGATGGGGG + Intronic
1125881715 15:43201398-43201420 TAAAAGGATATGAAGGATGGTGG + Intronic
1126320675 15:47419454-47419476 GAGAATGAACTGGAGGATGGTGG + Intronic
1126743648 15:51803095-51803117 AAGAATGAAATAAAAGATGGTGG + Intronic
1127765612 15:62183353-62183375 TAGAAAGAAAGGAAGGAAGGAGG - Intergenic
1128285004 15:66429567-66429589 TAGAGTAACCTGAAGGATTGAGG + Intronic
1132190489 15:99851874-99851896 TTGATTGAATTGAAGGATGCAGG - Intergenic
1132261572 15:100429693-100429715 GAGGATCAACTGAAGGATGGGGG - Intronic
1132485445 16:188048-188070 TAGAAAGAACTGAAAGGTGTTGG + Intergenic
1133523312 16:6579877-6579899 TAAAAAGGACTGAAGGCTGGCGG - Intronic
1133739441 16:8640481-8640503 AAGAATGGACGGATGGATGGAGG + Intronic
1133770993 16:8867210-8867232 GAGAATGGAGGGAAGGATGGAGG - Intronic
1134325613 16:13204886-13204908 AAGAATGAACTGAAGGAACCAGG - Intronic
1136127392 16:28193963-28193985 TAGCATGAACTGAAGGGTGTGGG + Intronic
1137814109 16:51381957-51381979 TAGACTGAACTCAATGGTGGTGG - Intergenic
1138472361 16:57247899-57247921 TAAAATGGACTGAAGGATGGTGG + Intronic
1141212728 16:81996228-81996250 GAGAATGGACTGAAGGAAGGAGG + Exonic
1142889762 17:2935596-2935618 TAGAATTAATTTCAGGATGGGGG - Intronic
1143237580 17:5416557-5416579 TAGAATTACCTAAAAGATGGGGG - Exonic
1143555097 17:7655031-7655053 TAGAAGGAACTGACGGGTGGGGG - Intronic
1144237185 17:13272894-13272916 TAGAAGGAAGGGAAGGAGGGAGG + Intergenic
1145044525 17:19602696-19602718 TAGAATTAACAGCAGGATGATGG - Intergenic
1145784160 17:27583228-27583250 AGGAATGGACTGAAAGATGGGGG - Intronic
1148068082 17:44888173-44888195 GAGAATGGAGCGAAGGATGGGGG + Intronic
1148234143 17:45956191-45956213 AGGAATGAGCTGAAGGATGGGGG + Intronic
1149544315 17:57491805-57491827 TTGAATGAACAGCAGGAAGGAGG - Intronic
1154055114 18:11005316-11005338 GAGAATGAAGTGTAGCATGGTGG - Intronic
1155339552 18:24799912-24799934 TTGAATGAATTAAAGGAAGGGGG + Intergenic
1156742604 18:40350470-40350492 TTGAATGAGTTGAAAGATGGAGG + Intergenic
1157949585 18:52019717-52019739 GAGAAGGAACTGAAGGTTGGAGG - Intergenic
1158276071 18:55768930-55768952 GAGAATGAAAAGAAAGATGGTGG - Intergenic
1158892579 18:61886861-61886883 TTGAATGAAATGAGAGATGGAGG + Intronic
1159736874 18:72111012-72111034 TAGAAGAAAGTGAAGGAGGGAGG + Intergenic
1159742335 18:72187830-72187852 TGGAATGAACTGAAGGAATTAGG + Intergenic
1160280667 18:77487027-77487049 TAGGATAAATTGAAGGATGCAGG - Intergenic
1162062982 19:8107915-8107937 GAGGATGAATGGAAGGATGGGGG + Intronic
1163347648 19:16753934-16753956 GAGAATGGATGGAAGGATGGAGG - Intronic
1165256437 19:34579449-34579471 TAGACAGTCCTGAAGGATGGAGG + Intergenic
1166627482 19:44372071-44372093 CAGAATGAGCTGTAGGAAGGTGG - Intronic
1166761057 19:45224697-45224719 TAAAAGGAACTGGAGGATGGTGG + Intronic
1168433794 19:56302260-56302282 AAGAATGAAATGAGAGATGGAGG - Intronic
924968470 2:100739-100761 TAGAGGGAACAGAAAGATGGAGG + Intergenic
925030174 2:644263-644285 TAGAGTGAATGAAAGGATGGAGG + Intergenic
925030180 2:644340-644362 TAGAGTGAATGAAAGGATGGAGG + Intergenic
925239303 2:2309020-2309042 TAGAATGTACTGAAGGACAGGGG - Intronic
925509192 2:4605684-4605706 TAGAATGAACTGAAAAAAAGTGG + Intergenic
926695713 2:15769099-15769121 TAGAATGAAATGAAGGTGTGCGG - Intergenic
926988548 2:18651331-18651353 CAGAATGAACCATAGGATGGCGG - Intergenic
928373690 2:30758857-30758879 AGGAAGGGACTGAAGGATGGAGG - Intronic
928539212 2:32268608-32268630 TAGAATAAACTAAATGCTGGAGG + Intergenic
929929892 2:46245677-46245699 TACAAGGAAATGAAGGATGCAGG - Intergenic
930296396 2:49559991-49560013 TTGAATGCACTGTAAGATGGAGG + Intergenic
930392384 2:50778543-50778565 TGGAATGAACAAAAGGAAGGTGG + Intronic
930887782 2:56347703-56347725 CAGAGTGAACTGGAGGAGGGTGG + Intronic
931461459 2:62453823-62453845 TAGACTGAGCTAAAGGGTGGGGG + Intergenic
931952714 2:67383076-67383098 AAGAATGAGATGAAGGATGGAGG - Intergenic
933386357 2:81615899-81615921 TATAATTAGCTTAAGGATGGAGG - Intergenic
935542132 2:104361118-104361140 TGGAATGAACAGGAGGATGAAGG + Intergenic
936409083 2:112238091-112238113 TAGAGGGAGCTGGAGGATGGAGG - Intronic
938546023 2:132332490-132332512 CAGAATGAGCTGCAGGAAGGCGG + Intergenic
938894776 2:135739182-135739204 CTGAAAGAAGTGAAGGATGGTGG - Intergenic
940139045 2:150473163-150473185 TAGAATGACTTGAAGTAGGGAGG - Intronic
940479707 2:154212712-154212734 TAGAAGGAGAAGAAGGATGGGGG - Intronic
940702920 2:157068895-157068917 AAAAAGGAAGTGAAGGATGGAGG - Intergenic
942615032 2:177782842-177782864 AAGAAGGAAGGGAAGGATGGAGG - Intronic
943191684 2:184685773-184685795 ATGAATGAACTGAAGCCTGGGGG - Intronic
944590236 2:201210089-201210111 TAGCATGAACAAAAGCATGGGGG + Intronic
947681566 2:232038306-232038328 AAGAAAGAACAGAAAGATGGTGG + Intronic
1169006535 20:2212027-2212049 TAGAATGAACAGACGGCTGAAGG + Intergenic
1169245053 20:4018523-4018545 GAGAATGAACGGAAGGAGGAGGG + Intergenic
1170536545 20:17346404-17346426 GAGGAGGAACAGAAGGATGGTGG - Intronic
1171874886 20:30565223-30565245 CAGAATGAGCTGCAGGAAGGCGG + Intergenic
1172783396 20:37450540-37450562 ATGAATGAACAGATGGATGGAGG - Intergenic
1173502168 20:43561983-43562005 TAGAATGAACTCAAAGTTGCTGG + Intronic
1174109376 20:48187550-48187572 CACAAGGAAATGAAGGATGGCGG + Intergenic
1177886368 21:26750760-26750782 GCGAATGAACTGAAATATGGTGG + Intergenic
1178840845 21:36136387-36136409 GGGAGTGAAATGAAGGATGGGGG + Intronic
1179399505 21:41070789-41070811 TAGGAGGAAAAGAAGGATGGAGG + Intergenic
1182541543 22:31045632-31045654 TTGAAGGAACTGAGGGATGAGGG - Intergenic
1183008110 22:34920274-34920296 CACAATGAGCTGAAAGATGGTGG - Intergenic
1184002113 22:41682593-41682615 AAGAATTAGGTGAAGGATGGAGG + Intronic
1184092315 22:42299169-42299191 TAGAAGGCACGGGAGGATGGGGG + Intronic
1184541064 22:45125331-45125353 AGGAATGAACTAAAGGCTGGTGG + Intergenic
949324087 3:2844026-2844048 TATATGGAACAGAAGGATGGGGG - Intronic
949880577 3:8657710-8657732 TAGAAGGAAGGGAAGGAGGGAGG + Intronic
950246630 3:11425991-11426013 TAGAATGAACAAATGGATTGTGG - Intronic
952106272 3:30073319-30073341 TAGAATAAAGTGAAGAAAGGTGG - Intergenic
952847511 3:37700728-37700750 TTGAATAAACTAATGGATGGTGG + Intronic
952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG + Intronic
952948826 3:38501402-38501424 TTGAAGGCACTGAAGGTTGGAGG - Exonic
956147655 3:66207279-66207301 TAGTATGGTCTAAAGGATGGGGG - Intronic
956362574 3:68464741-68464763 GAGAATAAACTGAAGGTAGGAGG + Intronic
957380220 3:79418088-79418110 TAGAATGAACATCAGCATGGTGG + Intronic
958498409 3:94874857-94874879 AAGAATGTCCTGAAGCATGGGGG - Intergenic
959944980 3:112116639-112116661 TAGAATGAAGTGATGGAGGCTGG + Exonic
960423237 3:117474851-117474873 TGGAATTAAGTGAAGCATGGTGG + Intergenic
963189365 3:142452146-142452168 AAGGATGACATGAAGGATGGGGG + Intronic
964307534 3:155357080-155357102 GTGGATGAATTGAAGGATGGTGG + Intergenic
964638213 3:158880650-158880672 TAGAAGGACCTTAGGGATGGTGG - Intergenic
964841557 3:160999103-160999125 TAGAATGTGCTGAAGAATGTAGG - Intronic
964930589 3:162017107-162017129 TAGAGGTAACTGAATGATGGGGG + Intergenic
964965985 3:162494614-162494636 TAGAAATAACTGAATCATGGGGG + Intergenic
966946960 3:184783545-184783567 TAGAATAAACTGGAGGATGGGGG + Intergenic
967612841 3:191528240-191528262 TAGATAGAACAGAAAGATGGAGG + Intergenic
967963331 3:194942185-194942207 TAGCATGAACTCAGGAATGGTGG - Intergenic
969016057 4:4105100-4105122 TCGCATGACCTGAAGGATGATGG - Intergenic
969459014 4:7317812-7317834 TAGAATCAGCTGAATGGTGGAGG - Intronic
970936840 4:21581760-21581782 TAGTATGAACTGACTGAAGGAGG - Intronic
971042824 4:22773668-22773690 GAGAATGAAGTGAAGGAGAGGGG + Intergenic
972714814 4:41634958-41634980 TAGAATGAAAGGAAAGAAGGAGG + Intronic
973604292 4:52571227-52571249 GAGAAGGAACAGCAGGATGGAGG - Intergenic
973666077 4:53160648-53160670 TAGAATTAATTGAAGGATTCTGG + Intronic
974623437 4:64390456-64390478 TAGAATGAACAGAAATGTGGTGG - Intronic
974796490 4:66757737-66757759 TAGAATAGTCTGGAGGATGGGGG + Intergenic
977918060 4:102615070-102615092 GAGAATGGACTGAAGGGAGGTGG - Intronic
977919984 4:102632301-102632323 ATGAATGAAGTGAAGGATGAGGG + Intronic
978151014 4:105434935-105434957 TAGATTGAATTGAAGCGTGGTGG - Intronic
978871804 4:113587567-113587589 TAAAGAGAACTGAAGGATTGAGG + Intronic
979213468 4:118134229-118134251 TAAAATTCAGTGAAGGATGGAGG + Intronic
980332314 4:131425954-131425976 GAGAAAGAAAGGAAGGATGGAGG + Intergenic
981009241 4:139907979-139908001 TAGAATAAGCAGATGGATGGTGG + Intronic
983332550 4:166349247-166349269 TATAATCAATAGAAGGATGGAGG - Intergenic
983647543 4:170007018-170007040 TAGAATGAAATGGAGGATAGAGG - Intronic
983760541 4:171400880-171400902 TAGACTGATCTGAAGCATTGAGG - Intergenic
984282425 4:177687705-177687727 TACTATGTACTGAATGATGGTGG + Intergenic
984536215 4:180978965-180978987 TAGAATGGATTGAGGGATGAGGG - Intergenic
986768689 5:10951666-10951688 AAGAATGAATTGAAGCATAGCGG - Intergenic
987733915 5:21813633-21813655 TGGAATGAAGTGAAGGAAGAGGG - Intronic
987759067 5:22135640-22135662 AAGAATGAAGAGAAGGCTGGAGG + Intronic
988495681 5:31743682-31743704 ATGGATGAACTGAAGGATGAAGG - Intronic
990470654 5:56112197-56112219 TTCAATGAGCAGAAGGATGGAGG + Intronic
991893779 5:71369086-71369108 AAGAATGAAGAGAAGGCTGGAGG + Intergenic
993250032 5:85509949-85509971 TAAAATGAACTTAATCATGGTGG + Intergenic
996060839 5:119031625-119031647 AAGAATGAACAGGAGGATGTGGG - Intergenic
996230185 5:121053697-121053719 GGGAAGAAACTGAAGGATGGAGG + Intergenic
996841769 5:127854134-127854156 GAGAATGAATGGAAGGATGGGGG - Intergenic
996939035 5:128981605-128981627 TAGAGTGAGCAGAAGGATGGAGG + Intronic
998092553 5:139379826-139379848 CAGCATGATCTGAAGGAGGGGGG + Exonic
998590894 5:143477052-143477074 TAGAATGAACTGAGATATGAAGG + Intergenic
998798493 5:145843776-145843798 ATGAATAAACTGAAGCATGGAGG + Intergenic
999377409 5:151096270-151096292 TAGAAACTACTGAAGGAGGGAGG - Intergenic
999380038 5:151114673-151114695 TACCATGAAATGAAGGATTGTGG - Intronic
999388214 5:151170705-151170727 GAGAAGGAACTGGAGAATGGGGG + Intergenic
1001123305 5:168997434-168997456 TAGAATTAACTGAAAGAGGGAGG + Intronic
1002161302 5:177315331-177315353 GAGAATGCGCTGAAGGAGGGAGG - Intergenic
1004547180 6:16609193-16609215 TAAAATGGACTGAACGCTGGAGG + Intronic
1005311813 6:24566069-24566091 TAGAATGTTCTGAAGGCTGGAGG - Intronic
1006354769 6:33548748-33548770 TAGGATGACCTGAAGGACAGTGG + Intergenic
1007943530 6:45804405-45804427 TTGAAGGAAGTGAAGGATGCTGG - Intergenic
1009439346 6:63657979-63658001 TTGAATGAACTGAAGGAAATAGG - Intronic
1009667244 6:66699811-66699833 TACAATCAAGTGAAGGATAGAGG - Intergenic
1010692422 6:78926022-78926044 TAGGACCTACTGAAGGATGGAGG + Intronic
1010917793 6:81641999-81642021 AAGAATGAACTGAAGAAGGAAGG + Intronic
1011982657 6:93402192-93402214 TAGAAAGAACTGATGAAAGGGGG - Intronic
1012345991 6:98186726-98186748 AAGAATGAACTGTAAGATGAGGG - Intergenic
1015263769 6:131268050-131268072 TAGAAGGAAGGGAGGGATGGAGG + Intronic
1016531281 6:145060143-145060165 TAGAATGAGGTTAAGGTTGGTGG + Intergenic
1018316043 6:162557470-162557492 TAAAAGGCACTGAATGATGGTGG + Intronic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1020407212 7:7850790-7850812 TAAAATGAAGTGAAGGATTTGGG + Intronic
1021066070 7:16174239-16174261 TAGAAAAACCTCAAGGATGGGGG + Intronic
1023049964 7:36242433-36242455 ATGAATGAACAGAAGGAAGGAGG - Intronic
1023694636 7:42832129-42832151 CAGAGTGAATTGTAGGATGGAGG - Intergenic
1027469769 7:78558631-78558653 GTGAAGAAACTGAAGGATGGAGG - Intronic
1027695204 7:81402109-81402131 TTGAATGAACTAAAGTGTGGGGG - Intergenic
1027842884 7:83336781-83336803 TTGAATGAACTGAAGAAAGATGG - Intergenic
1027849976 7:83438836-83438858 AAAATTTAACTGAAGGATGGAGG + Intronic
1027869450 7:83688097-83688119 TACTTTGAACTGAAGGATGCTGG - Intergenic
1028210593 7:88069361-88069383 TAGAATGAACAGAAATATGTTGG - Intronic
1029074726 7:97926743-97926765 TCGCATGACCTGAAGGATGATGG - Intergenic
1029286137 7:99467413-99467435 CAGAATGAACTGAACGAGGGTGG - Intergenic
1030367686 7:108663934-108663956 TTGAATGAAGCGAAGGACGGAGG - Intergenic
1032125754 7:129191468-129191490 AGGAATGAGCTGAGGGATGGTGG - Intronic
1032565696 7:132940695-132940717 TAGACTGAAGTGAATAATGGAGG - Intronic
1032591193 7:133193908-133193930 CAGGATGGACTGAAGCATGGGGG - Intergenic
1033205181 7:139414134-139414156 TAGAATGAGGTGAAGAAGGGGGG - Intronic
1033479595 7:141726527-141726549 TAGACTGAACAAAAGGAAGGAGG - Intronic
1033540163 7:142349210-142349232 TGGCAGGAACTGCAGGATGGAGG - Intergenic
1036095404 8:5718767-5718789 TTGAATCAACTGAATCATGGGGG - Intergenic
1036257813 8:7219522-7219544 TAGCATGACCTGAAGGATGATGG - Intergenic
1036259062 8:7226519-7226541 TAGCATGACCTGAAGGATGATGG - Intergenic
1036307560 8:7612992-7613014 TCGCATGACCTGAAGGATGATGG + Intergenic
1036309861 8:7678118-7678140 TAGCATGACCTGAAGGATGATGG - Intergenic
1036311115 8:7685115-7685137 TAGCATGACCTGAAGGATGATGG - Intergenic
1036358411 8:8060993-8061015 TAGCATGACCTGAAGGATGATGG + Intergenic
1036359671 8:8068001-8068023 TCGCATGACCTGAAGGATGATGG + Intergenic
1036829747 8:12012639-12012661 TCGCATGACCTGAAGGATGATGG - Intergenic
1036891286 8:12598969-12598991 TCGCATGACCTGAAGGATGATGG - Intergenic
1036892543 8:12605959-12605981 TAGCATGACCTGAAGGATGATGG - Intergenic
1036898836 8:12656906-12656928 TCGCATGACCTGAAGGATGATGG - Intergenic
1037114474 8:15206887-15206909 TGGAATGAAAGGTAGGATGGAGG + Intronic
1037407174 8:18555159-18555181 TAGGATGAACGGAAGGAGAGCGG + Intronic
1037617655 8:20534008-20534030 AAGAAGGAATTGAAGGATGGGGG + Intergenic
1038696868 8:29813952-29813974 TAGGATTACCTGAAGGATGGTGG + Intergenic
1041318667 8:56591356-56591378 TAGAATGGATTGAAGGTTTGAGG - Intergenic
1042664219 8:71188798-71188820 TAGAATGAGCTGAAGGCTTCAGG - Intergenic
1042732232 8:71948778-71948800 AAGAATGAAAAGAAGGAAGGGGG + Intronic
1043010687 8:74878524-74878546 AAGAATGAACTGAAGGTTTCTGG + Intergenic
1043515244 8:80989892-80989914 TAGAAGGAAGTGAGGAATGGCGG + Intronic
1045578668 8:103453962-103453984 AAGAATAAGGTGAAGGATGGTGG + Intergenic
1046485223 8:114878863-114878885 TTGAATGAACTGATTGATGATGG - Intergenic
1046903372 8:119545873-119545895 TAGAATGCCATGAAGGAAGGGGG - Intergenic
1049314517 8:141955552-141955574 TTGAATAAACTGAAGTATAGAGG + Intergenic
1049350978 8:142164527-142164549 GAGATGGAAATGAAGGATGGAGG + Intergenic
1049505950 8:142998297-142998319 TAGACTGAACTAAAGGAAGACGG - Intergenic
1050018755 9:1262216-1262238 TAGACAGCACTGAAGGATGGAGG + Intergenic
1051179495 9:14395612-14395634 ATGAATGAACTGTAGGGTGGTGG - Intronic
1051930193 9:22375873-22375895 TAGAAAGAACTAAAGTTTGGTGG - Intergenic
1052001365 9:23285648-23285670 TAGAATCAGCTGAAGTTTGGTGG - Intergenic
1052830867 9:33214349-33214371 AAGAATGAATGGAAAGATGGAGG + Intergenic
1053047414 9:34931401-34931423 TATAATGAACTTGAGGATGCAGG + Intergenic
1057409490 9:94805004-94805026 TAGAATGAAGGCCAGGATGGTGG + Intronic
1058112941 9:101051592-101051614 TAGAAGCATCTGAAAGATGGAGG - Intronic
1058400540 9:104613163-104613185 CAGAAGGAAGAGAAGGATGGAGG + Intergenic
1058413459 9:104760860-104760882 AAGTATTAGCTGAAGGATGGTGG - Intergenic
1059854882 9:118385446-118385468 TTGAATGGACTGAATGATAGCGG + Intergenic
1061514336 9:131079880-131079902 GAGAATGAACTAATGAATGGAGG - Intronic
1186286485 X:8049342-8049364 TCAAATGCACTGAAGAATGGAGG + Intergenic
1186536512 X:10355637-10355659 GAGAAAGATCTGAAGGATTGAGG + Intergenic
1186697411 X:12051749-12051771 TTGAATAAACAGATGGATGGAGG - Intergenic
1187245767 X:17551692-17551714 GAGAATCAAATGAAGGAGGGTGG + Intronic
1188009025 X:25038716-25038738 AAGAATGGAAAGAAGGATGGTGG + Intergenic
1190255051 X:48756102-48756124 CAGAGTGAAATGAATGATGGAGG + Intergenic
1190504474 X:51113127-51113149 TAGAATGAAATGAAGCAAGAAGG + Intergenic
1190653200 X:52587635-52587657 CAGAATGAACTTAAGGAAGAAGG + Intergenic
1190887062 X:54539607-54539629 TAGAATCACCTGGAGGATGGGGG + Intronic
1192734865 X:73840943-73840965 TAGAATAAACTTAAGGAAGTGGG - Intergenic
1195085511 X:101409687-101409709 TTGAGAGAACTGAAGGGTGGGGG - Intronic
1195651491 X:107289585-107289607 CAGAATGAGCTGCAGGCTGGGGG - Intergenic
1197330067 X:125142718-125142740 TAGAATGACCTGAAGCTTTGTGG - Intergenic
1198077241 X:133205348-133205370 TAGAATGGACTGAAGAACAGAGG + Intergenic
1198947185 X:142028132-142028154 TAGAAATAATTGAATGATGGGGG - Intergenic
1201104166 Y:10751123-10751145 TGGAATGAAATGGAGGATAGTGG - Intergenic