ID: 1114567540

View in Genome Browser
Species Human (GRCh38)
Location 14:23643682-23643704
Sequence CACCCTTAGGAACTGGCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 139}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114567531_1114567540 14 Left 1114567531 14:23643645-23643667 CCAGGTCCTGCAGATCTGACTGT 0: 1
1: 0
2: 1
3: 16
4: 174
Right 1114567540 14:23643682-23643704 CACCCTTAGGAACTGGCCAGGGG 0: 1
1: 0
2: 1
3: 17
4: 139
1114567533_1114567540 -10 Left 1114567533 14:23643669-23643691 CCCCTCACAGACACACCCTTAGG 0: 1
1: 0
2: 4
3: 25
4: 355
Right 1114567540 14:23643682-23643704 CACCCTTAGGAACTGGCCAGGGG 0: 1
1: 0
2: 1
3: 17
4: 139
1114567529_1114567540 26 Left 1114567529 14:23643633-23643655 CCTGCCTGTGTTCCAGGTCCTGC 0: 1
1: 0
2: 2
3: 33
4: 427
Right 1114567540 14:23643682-23643704 CACCCTTAGGAACTGGCCAGGGG 0: 1
1: 0
2: 1
3: 17
4: 139
1114567528_1114567540 27 Left 1114567528 14:23643632-23643654 CCCTGCCTGTGTTCCAGGTCCTG 0: 1
1: 0
2: 3
3: 40
4: 406
Right 1114567540 14:23643682-23643704 CACCCTTAGGAACTGGCCAGGGG 0: 1
1: 0
2: 1
3: 17
4: 139
1114567530_1114567540 22 Left 1114567530 14:23643637-23643659 CCTGTGTTCCAGGTCCTGCAGAT 0: 1
1: 0
2: 0
3: 19
4: 237
Right 1114567540 14:23643682-23643704 CACCCTTAGGAACTGGCCAGGGG 0: 1
1: 0
2: 1
3: 17
4: 139
1114567532_1114567540 8 Left 1114567532 14:23643651-23643673 CCTGCAGATCTGACTGTACCCCT 0: 1
1: 0
2: 0
3: 6
4: 136
Right 1114567540 14:23643682-23643704 CACCCTTAGGAACTGGCCAGGGG 0: 1
1: 0
2: 1
3: 17
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114567540 Original CRISPR CACCCTTAGGAACTGGCCAG GGG Intronic
904276028 1:29384816-29384838 CAGCCCTAGGCACTGGGCAGGGG - Intergenic
920972909 1:210757865-210757887 TACCCTTAGGCAGTGGCCAGAGG + Intronic
923314930 1:232771168-232771190 TACCCATAGGAACTAGGCAGTGG + Intergenic
923473676 1:234313683-234313705 CACCCTTAGCACCTGTCCAGGGG + Intronic
924724435 1:246655706-246655728 CACATTAAGGAACTGGCAAGAGG + Intronic
1067302611 10:45026180-45026202 CACATTTAGGAACTTGCCAGGGG + Intergenic
1069528992 10:69201329-69201351 CACCGTTAGGACATGGCCACAGG - Intronic
1071991394 10:91103847-91103869 TCTCCTTAGGAACTGCCCAGGGG + Intergenic
1072222417 10:93337756-93337778 CATCCTTTGAAACTGGCCACAGG - Intronic
1073108091 10:101044280-101044302 TACCCCTAGGAGGTGGCCAGGGG + Intergenic
1074850197 10:117433220-117433242 GACTCTTAGGAACTGGCAAGAGG + Intergenic
1075522127 10:123149322-123149344 CACCTTTATGAATGGGCCAGGGG - Intronic
1076144064 10:128103030-128103052 CACACTGAGGAACTGGCAAATGG - Exonic
1078477383 11:11642705-11642727 CCCCCTTACCATCTGGCCAGTGG + Intergenic
1079974742 11:27077076-27077098 CACCCTTAAGTTCTGGCCAAGGG + Intronic
1084629849 11:70340903-70340925 CACCACTTGGAACTGGCCACCGG + Intronic
1084630453 11:70345000-70345022 CACCACTTGGAACTGGCCACCGG + Intronic
1086925217 11:92632683-92632705 TTCCCTTAGGAACTGGTCAGGGG - Intronic
1087316281 11:96606834-96606856 CAGGCTAAGGAACTTGCCAGGGG - Intergenic
1087849197 11:103009315-103009337 CTCCATTAGGTACTGCCCAGTGG + Intergenic
1089030121 11:115317566-115317588 GCCCCTTGGGAACTGGTCAGAGG - Intronic
1090352353 11:126115445-126115467 CACCCTCAGCCACAGGCCAGAGG - Intergenic
1092104329 12:5910712-5910734 CACCCTAAGAAGCTGTCCAGGGG + Intronic
1096824232 12:54262363-54262385 CACCCTTAAGAACTGCCTAAAGG + Intronic
1100325308 12:93534609-93534631 CACCCTATGGCACTGGCCACAGG - Intergenic
1101442444 12:104713804-104713826 CATCCATAGGAGCTGGCCTGGGG - Intronic
1102762249 12:115398272-115398294 CCTCTTTAGGAACAGGCCAGTGG + Intergenic
1114567540 14:23643682-23643704 CACCCTTAGGAACTGGCCAGGGG + Intronic
1114957981 14:27847313-27847335 CAACTTTAGAAACTGCCCAGCGG + Intergenic
1117093884 14:52277548-52277570 CACATTTACGAACTCGCCAGGGG - Intergenic
1118276245 14:64388319-64388341 CGTGCTTAGGGACTGGCCAGGGG - Intronic
1118420219 14:65594221-65594243 CAACTGCAGGAACTGGCCAGGGG + Intronic
1119212307 14:72841322-72841344 AAAACTTAGGAACTGGACAGGGG + Intronic
1120053880 14:79899684-79899706 CACACTGAGGAACTGGCAAGAGG - Intergenic
1122011162 14:98749979-98750001 CAACCTTGGGAAATGGCCTGGGG + Intergenic
1122201334 14:100124393-100124415 CAGTCTTAGGAAAAGGCCAGAGG - Intronic
1122793631 14:104194920-104194942 CACTCTTGGGGACTGGACAGTGG + Intergenic
1124883610 15:33663756-33663778 CTTCCATAGGAACTGGACAGAGG - Intronic
1124955509 15:34357514-34357536 CACCTTTAGGGACTGGCAAGTGG - Exonic
1125492134 15:40156183-40156205 CATCCCTAGGACCTGGCCCGAGG - Intergenic
1126480239 15:49110884-49110906 CATTCTCAGGCACTGGCCAGAGG - Intronic
1128136001 15:65263900-65263922 CACCCTTAGGTACAGGGAAGGGG + Intronic
1128248791 15:66150893-66150915 CACCCTTAGTCACTGACAAGGGG - Intronic
1129466355 15:75726226-75726248 CACCCTTAGGACCTGGGCAGGGG + Intronic
1130538796 15:84806263-84806285 GAGCCTTAGGAACTGGGCACAGG + Exonic
1132435564 15:101798831-101798853 TACCCCTAGGGAATGGCCAGGGG + Intergenic
1132508535 16:324903-324925 CGCCCTTAGGAACTGTGCACCGG - Intronic
1135379946 16:21987527-21987549 CACCAAGAGGAAATGGCCAGAGG + Intronic
1142720355 17:1771697-1771719 CATCCCCAGGCACTGGCCAGGGG - Intronic
1145251150 17:21297730-21297752 CACCCCTAGGGACAGGCGAGAGG - Intronic
1145931058 17:28686093-28686115 CATCCTTGGGACCTAGCCAGTGG + Intronic
1148739572 17:49884900-49884922 CACCCTGAGGAACTGCTCATTGG + Intergenic
1149157936 17:53655772-53655794 CTCACTTAGTCACTGGCCAGAGG - Intergenic
1149597557 17:57873261-57873283 CTCCCTTGGGAAAGGGCCAGAGG - Intronic
1149658011 17:58320360-58320382 CACCCTGAGAAATAGGCCAGTGG + Intronic
1149794717 17:59508638-59508660 CACCCTGAGGAGCTGAGCAGAGG - Intergenic
1150426105 17:65078351-65078373 CATCCTGAGGACCTGGACAGGGG + Intergenic
1151459868 17:74248174-74248196 ATCCCTAAGGAACAGGCCAGAGG + Intronic
1151598681 17:75093436-75093458 CACCCCTGGGAGGTGGCCAGAGG - Intronic
1151979284 17:77499184-77499206 TACCCTTAGGAGCAGGGCAGGGG - Exonic
1161200293 19:3010849-3010871 CACAATGAGGAACTGCCCAGAGG + Intronic
1167349828 19:48967684-48967706 CACTGAGAGGAACTGGCCAGTGG + Intergenic
1167473805 19:49689114-49689136 CACCCTCAGGGCCTGGCCACGGG + Exonic
925922473 2:8646865-8646887 CACTTTTGGGACCTGGCCAGTGG + Intergenic
927400726 2:22707195-22707217 CACACTGAGGTACTGCCCAGTGG - Intergenic
929302640 2:40323671-40323693 CCCCCTTAGGAACTGGGCATTGG - Intronic
931174103 2:59835528-59835550 AAGCCTTAGGACCTGGCCAGGGG + Intergenic
932270022 2:70401121-70401143 CACCCTATGGAACTGGACATGGG - Intergenic
933985461 2:87588172-87588194 CAGCCTAAGGAGCTGGACAGTGG - Intergenic
934479324 2:94620732-94620754 CAACTTTAGAAACTGCCCAGCGG - Intergenic
935226421 2:101056923-101056945 GATCCTTAGGATTTGGCCAGAGG + Intronic
936308380 2:111362629-111362651 CAGCCTAAGGAGCTGGACAGTGG + Intergenic
940855723 2:158727237-158727259 CAGCCTTAGAAACTGGTGAGTGG - Intergenic
943700441 2:190983541-190983563 CTCCCTTAACAACTGGCCATTGG + Intronic
945443547 2:209909485-209909507 CAGCAATAGGAGCTGGCCAGGGG - Intronic
948164818 2:235852763-235852785 CACCCCTCGGCCCTGGCCAGGGG - Intronic
948618843 2:239220568-239220590 GACTCTTAGGAACTGGTCAGCGG + Intronic
1170212631 20:13860586-13860608 CACATTTAGGAAGTGGGCAGAGG - Intronic
1170546347 20:17438467-17438489 CATCCTCAGGAACTGGCCCGGGG + Intronic
1174745345 20:53056851-53056873 GAACCTTAGGATCTGTCCAGTGG + Intronic
1175150671 20:56931464-56931486 CACCACCAGGAAGTGGCCAGAGG - Intergenic
1175907141 20:62386562-62386584 CACCCGCAGGAACTCGGCAGAGG - Intergenic
1180003514 21:45007117-45007139 AACCCGTAGGAACAGCCCAGGGG - Intergenic
1181040176 22:20188349-20188371 CAGCCTCAGCAACTGGGCAGGGG + Intergenic
1181313565 22:21958245-21958267 CACCCTCAGGACCTGGGCACAGG - Intronic
1183481929 22:38069996-38070018 GAGCCTTAGCACCTGGCCAGCGG - Intronic
950040429 3:9916235-9916257 CACTCTGAGGCTCTGGCCAGAGG + Exonic
951085058 3:18502601-18502623 CAGACTTATGAACTGGACAGGGG - Intergenic
951579251 3:24144414-24144436 GAACCTAAGGAACTTGCCAGAGG - Intronic
954104393 3:48401857-48401879 CACCTGTTGGCACTGGCCAGTGG + Intergenic
954455439 3:50596097-50596119 CACTCTAAGGAACAGGCCACAGG - Intergenic
954705387 3:52477716-52477738 CAGCCTTGGGAATTGGCCAGGGG + Intronic
958667696 3:97161347-97161369 CACCTGTAGGAACTTGCCAAAGG + Intronic
958943046 3:100335532-100335554 CAGCATGAGGAACTGCCCAGTGG + Intronic
959734531 3:109642884-109642906 AACCCTCAGGAACTGGAGAGAGG + Intergenic
960914215 3:122680658-122680680 AACCCTTTGGGGCTGGCCAGCGG - Exonic
965976915 3:174636472-174636494 TACCATTAAAAACTGGCCAGTGG + Intronic
968066158 3:195760869-195760891 CACCCTCAGTAAGTGGCCCGAGG - Exonic
969251188 4:5969921-5969943 CACCCCTAGGGTCTGGCCTGGGG - Intronic
969457526 4:7308614-7308636 CACCTTTAGGAACTGCCCTGAGG - Intronic
971872298 4:32258150-32258172 CAGCCTTGGGAACTGGCAAGAGG + Intergenic
985284090 4:188316904-188316926 CACCCTGAGGAGCTAGGCAGTGG + Intergenic
985998403 5:3610808-3610830 CTCCCCCAGGAGCTGGCCAGGGG - Intergenic
986623974 5:9706382-9706404 CACAAGTAGGAACTGTCCAGTGG + Intronic
990686923 5:58314792-58314814 CACACTTAGAAACTGGCCAAAGG + Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
991650521 5:68847952-68847974 CACCCTTAGCAAGCAGCCAGTGG + Intergenic
992058831 5:73021282-73021304 CACCCATAGGAGCTCCCCAGTGG - Intronic
995565577 5:113430572-113430594 CACCCTGAGCAACTGTCCTGAGG - Intronic
998096041 5:139395952-139395974 CAGCCTTAGGACCTGCCCTGGGG + Intergenic
998462291 5:142318796-142318818 TACTCTTACGAACTGGCAAGAGG + Intronic
1000053062 5:157578531-157578553 CACCCCAAGGCACTGGGCAGGGG + Intergenic
1001197062 5:169682994-169683016 TACCATTGGTAACTGGCCAGTGG - Intronic
1001650825 5:173314872-173314894 CCTCCTTAGGAAGTGGCCACTGG + Exonic
1002202605 5:177538690-177538712 CACCCTGAGGGACTGACCGGTGG + Intronic
1002361834 5:178678261-178678283 GATCCTTAGGACCTGGCCTGCGG + Intergenic
1002584316 5:180232314-180232336 CACCCTTCGGAGCTGGTCAAAGG - Intergenic
1004026296 6:11822607-11822629 CACACTTAGCCATTGGCCAGGGG - Intergenic
1005229580 6:23684687-23684709 CACACTAGGGAAGTGGCCAGTGG - Intergenic
1007064315 6:38974551-38974573 CACATTTAGGAGATGGCCAGTGG + Intronic
1007585410 6:42986076-42986098 CAACATTAAGAACTGGCCTGTGG - Intronic
1011671867 6:89691195-89691217 CACCCCAAGGAGCTGGCCAAGGG + Intronic
1013662100 6:112308240-112308262 CAGACTTAGGAACTGGCCACAGG + Intergenic
1014227218 6:118862052-118862074 CACTCTTGTGACCTGGCCAGGGG - Intronic
1017391935 6:153949732-153949754 CACTCTTAGGATTTGGCAAGAGG + Intergenic
1018728776 6:166633322-166633344 CATCCTTACACACTGGCCAGAGG - Intronic
1019565906 7:1678960-1678982 CACCCCGAGGAACTGGCCTTGGG + Intergenic
1022525457 7:31034274-31034296 CACCCATGGGGGCTGGCCAGTGG + Intergenic
1023875012 7:44282174-44282196 GACCCACAGGAACTGGCCACAGG + Intronic
1024384787 7:48738893-48738915 CCCCCTGGGGAACTGCCCAGTGG + Intergenic
1028723714 7:94062788-94062810 GACCCTTAGCAACTGGTCTGTGG - Intergenic
1029420316 7:100468539-100468561 GACCCCTGGGATCTGGCCAGAGG + Intronic
1029605641 7:101598090-101598112 CAACGTTACGACCTGGCCAGTGG - Intergenic
1031389183 7:121192129-121192151 TATACTTAGGAAATGGCCAGTGG - Intronic
1033261758 7:139850042-139850064 CACCCTTTGGTGCTGGCTAGTGG + Intronic
1033762400 7:144449821-144449843 CTCTCTTAGGAAATGGGCAGGGG - Intergenic
1036759413 8:11496948-11496970 CAGCCTTGGGGACTGGCCACCGG + Intronic
1037566052 8:20119379-20119401 CCCCCATAGCACCTGGCCAGTGG - Intergenic
1037911030 8:22743653-22743675 CAGCCTTAGGAAATGGGCAGGGG + Intronic
1040946683 8:52892570-52892592 TTCTCTTAGGAAGTGGCCAGAGG + Intergenic
1041955712 8:63556482-63556504 CACCCTAACGAACGGCCCAGGGG - Intergenic
1042733634 8:71963878-71963900 CACCCTTAGGAAGCAGGCAGGGG + Intronic
1043978725 8:86614166-86614188 CACACTGAGGAACTGGGAAGAGG - Intronic
1045221455 8:100204272-100204294 CACCTCTAGGGGCTGGCCAGAGG - Intronic
1047724035 8:127669096-127669118 CCTCCATAGGAACTGGCCCGGGG - Intergenic
1048960720 8:139574573-139574595 CACCCTGAGGAACTGGAAGGAGG - Intergenic
1053678505 9:40462834-40462856 CAACTTTAGAAACTGCCCAGCGG + Intergenic
1054285221 9:63162109-63162131 CAACTTTAGAAACTGCCCAGCGG - Intergenic
1054291582 9:63298372-63298394 CAACTTTAGAAACTGCCCAGCGG + Intergenic
1054389598 9:64602914-64602936 CAACTTTAGAAACTGCCCAGCGG + Intergenic
1054506114 9:65913461-65913483 CAACTTTAGAAACTGCCCAGCGG - Intergenic
1060521223 9:124295104-124295126 CACCCTGAGGAAGGGGGCAGCGG + Intronic
1060831452 9:126720202-126720224 GATCCTGAGGACCTGGCCAGAGG - Intergenic
1061538888 9:131266663-131266685 CACCCTCATGAACAGGCCACGGG - Intronic
1062403468 9:136382560-136382582 CAGCCTGAGGAACTGGCTGGGGG - Intronic
1187745976 X:22409944-22409966 CACCATTAGGAATTGAGCAGAGG + Intergenic
1189467598 X:41289109-41289131 CACACCTAGGGCCTGGCCAGGGG - Intergenic
1189986977 X:46562197-46562219 CACACTGAGGAACTGGCAAATGG - Intergenic