ID: 1114570047

View in Genome Browser
Species Human (GRCh38)
Location 14:23660579-23660601
Sequence CTCACTGCTCAGACAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114570047_1114570059 13 Left 1114570047 14:23660579-23660601 CCTTCCTCTGTCTGAGCAGTGAG No data
Right 1114570059 14:23660615-23660637 TGAGGGGTGGGGCCCAGGGCTGG No data
1114570047_1114570064 30 Left 1114570047 14:23660579-23660601 CCTTCCTCTGTCTGAGCAGTGAG No data
Right 1114570064 14:23660632-23660654 GGCTGGTGAGGTCAAGGTCTTGG No data
1114570047_1114570057 8 Left 1114570047 14:23660579-23660601 CCTTCCTCTGTCTGAGCAGTGAG No data
Right 1114570057 14:23660610-23660632 GGGTGTGAGGGGTGGGGCCCAGG No data
1114570047_1114570056 2 Left 1114570047 14:23660579-23660601 CCTTCCTCTGTCTGAGCAGTGAG No data
Right 1114570056 14:23660604-23660626 AGAGATGGGTGTGAGGGGTGGGG No data
1114570047_1114570061 24 Left 1114570047 14:23660579-23660601 CCTTCCTCTGTCTGAGCAGTGAG No data
Right 1114570061 14:23660626-23660648 GCCCAGGGCTGGTGAGGTCAAGG No data
1114570047_1114570051 -5 Left 1114570047 14:23660579-23660601 CCTTCCTCTGTCTGAGCAGTGAG No data
Right 1114570051 14:23660597-23660619 GTGAGCTAGAGATGGGTGTGAGG No data
1114570047_1114570053 -3 Left 1114570047 14:23660579-23660601 CCTTCCTCTGTCTGAGCAGTGAG No data
Right 1114570053 14:23660599-23660621 GAGCTAGAGATGGGTGTGAGGGG No data
1114570047_1114570052 -4 Left 1114570047 14:23660579-23660601 CCTTCCTCTGTCTGAGCAGTGAG No data
Right 1114570052 14:23660598-23660620 TGAGCTAGAGATGGGTGTGAGGG No data
1114570047_1114570055 1 Left 1114570047 14:23660579-23660601 CCTTCCTCTGTCTGAGCAGTGAG No data
Right 1114570055 14:23660603-23660625 TAGAGATGGGTGTGAGGGGTGGG No data
1114570047_1114570054 0 Left 1114570047 14:23660579-23660601 CCTTCCTCTGTCTGAGCAGTGAG No data
Right 1114570054 14:23660602-23660624 CTAGAGATGGGTGTGAGGGGTGG No data
1114570047_1114570058 9 Left 1114570047 14:23660579-23660601 CCTTCCTCTGTCTGAGCAGTGAG No data
Right 1114570058 14:23660611-23660633 GGTGTGAGGGGTGGGGCCCAGGG No data
1114570047_1114570060 18 Left 1114570047 14:23660579-23660601 CCTTCCTCTGTCTGAGCAGTGAG No data
Right 1114570060 14:23660620-23660642 GGTGGGGCCCAGGGCTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114570047 Original CRISPR CTCACTGCTCAGACAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr