ID: 1114570051

View in Genome Browser
Species Human (GRCh38)
Location 14:23660597-23660619
Sequence GTGAGCTAGAGATGGGTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114570046_1114570051 -4 Left 1114570046 14:23660578-23660600 CCCTTCCTCTGTCTGAGCAGTGA No data
Right 1114570051 14:23660597-23660619 GTGAGCTAGAGATGGGTGTGAGG No data
1114570047_1114570051 -5 Left 1114570047 14:23660579-23660601 CCTTCCTCTGTCTGAGCAGTGAG No data
Right 1114570051 14:23660597-23660619 GTGAGCTAGAGATGGGTGTGAGG No data
1114570048_1114570051 -9 Left 1114570048 14:23660583-23660605 CCTCTGTCTGAGCAGTGAGCTAG No data
Right 1114570051 14:23660597-23660619 GTGAGCTAGAGATGGGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114570051 Original CRISPR GTGAGCTAGAGATGGGTGTG AGG Intergenic
No off target data available for this crispr