ID: 1114570056

View in Genome Browser
Species Human (GRCh38)
Location 14:23660604-23660626
Sequence AGAGATGGGTGTGAGGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114570046_1114570056 3 Left 1114570046 14:23660578-23660600 CCCTTCCTCTGTCTGAGCAGTGA No data
Right 1114570056 14:23660604-23660626 AGAGATGGGTGTGAGGGGTGGGG No data
1114570047_1114570056 2 Left 1114570047 14:23660579-23660601 CCTTCCTCTGTCTGAGCAGTGAG No data
Right 1114570056 14:23660604-23660626 AGAGATGGGTGTGAGGGGTGGGG No data
1114570048_1114570056 -2 Left 1114570048 14:23660583-23660605 CCTCTGTCTGAGCAGTGAGCTAG No data
Right 1114570056 14:23660604-23660626 AGAGATGGGTGTGAGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114570056 Original CRISPR AGAGATGGGTGTGAGGGGTG GGG Intergenic
No off target data available for this crispr