ID: 1114576606

View in Genome Browser
Species Human (GRCh38)
Location 14:23719989-23720011
Sequence ATTTTTCCACAGATGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114576606_1114576616 19 Left 1114576606 14:23719989-23720011 CCCTGCTCCATCTGTGGAAAAAT No data
Right 1114576616 14:23720031-23720053 CCACGGTGCCAAAGAGGTTGGGG No data
1114576606_1114576613 17 Left 1114576606 14:23719989-23720011 CCCTGCTCCATCTGTGGAAAAAT No data
Right 1114576613 14:23720029-23720051 GTCCACGGTGCCAAAGAGGTTGG No data
1114576606_1114576609 2 Left 1114576606 14:23719989-23720011 CCCTGCTCCATCTGTGGAAAAAT No data
Right 1114576609 14:23720014-23720036 TCTTCCACAAAACCAGTCCACGG 0: 3
1: 266
2: 602
3: 1144
4: 1278
1114576606_1114576614 18 Left 1114576606 14:23719989-23720011 CCCTGCTCCATCTGTGGAAAAAT No data
Right 1114576614 14:23720030-23720052 TCCACGGTGCCAAAGAGGTTGGG No data
1114576606_1114576611 13 Left 1114576606 14:23719989-23720011 CCCTGCTCCATCTGTGGAAAAAT No data
Right 1114576611 14:23720025-23720047 ACCAGTCCACGGTGCCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114576606 Original CRISPR ATTTTTCCACAGATGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr