ID: 1114577019

View in Genome Browser
Species Human (GRCh38)
Location 14:23724816-23724838
Sequence ATTTTGATGTATAGTGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114577016_1114577019 16 Left 1114577016 14:23724777-23724799 CCCACTAGGTGGTAGCAGTGGAA No data
Right 1114577019 14:23724816-23724838 ATTTTGATGTATAGTGAAGATGG No data
1114577015_1114577019 17 Left 1114577015 14:23724776-23724798 CCCCACTAGGTGGTAGCAGTGGA No data
Right 1114577019 14:23724816-23724838 ATTTTGATGTATAGTGAAGATGG No data
1114577017_1114577019 15 Left 1114577017 14:23724778-23724800 CCACTAGGTGGTAGCAGTGGAAA No data
Right 1114577019 14:23724816-23724838 ATTTTGATGTATAGTGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114577019 Original CRISPR ATTTTGATGTATAGTGAAGA TGG Intergenic
No off target data available for this crispr