ID: 1114577098

View in Genome Browser
Species Human (GRCh38)
Location 14:23725454-23725476
Sequence GGCTTGGTATGGGACTGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114577098_1114577108 24 Left 1114577098 14:23725454-23725476 CCAATTCAGTCCCATACCAAGCC No data
Right 1114577108 14:23725501-23725523 TTCTGCTCCCGATTCTCTCCTGG No data
1114577098_1114577109 30 Left 1114577098 14:23725454-23725476 CCAATTCAGTCCCATACCAAGCC No data
Right 1114577109 14:23725507-23725529 TCCCGATTCTCTCCTGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114577098 Original CRISPR GGCTTGGTATGGGACTGAAT TGG (reversed) Intergenic
No off target data available for this crispr