ID: 1114578142

View in Genome Browser
Species Human (GRCh38)
Location 14:23731662-23731684
Sequence CTTTATGAGCAGAAGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114578142_1114578144 20 Left 1114578142 14:23731662-23731684 CCTTCTTTCTTCTGCTCATAAAG No data
Right 1114578144 14:23731705-23731727 CTGAGCCCTTTCAAAAGTGCTGG No data
1114578142_1114578146 25 Left 1114578142 14:23731662-23731684 CCTTCTTTCTTCTGCTCATAAAG No data
Right 1114578146 14:23731710-23731732 CCCTTTCAAAAGTGCTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114578142 Original CRISPR CTTTATGAGCAGAAGAAAGA AGG (reversed) Intergenic
No off target data available for this crispr